ID: 961043835

View in Genome Browser
Species Human (GRCh38)
Location 3:123695254-123695276
Sequence AGAGGTCCGCCTAGGCCTGG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 153
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 140}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961043835_961043846 27 Left 961043835 3:123695254-123695276 CCCCCAGGCCTAGGCGGACCTCT 0: 1
1: 0
2: 0
3: 12
4: 140
Right 961043846 3:123695304-123695326 ATGTCAAAGCACGGCTCACAAGG 0: 1
1: 0
2: 0
3: 9
4: 97
961043835_961043843 18 Left 961043835 3:123695254-123695276 CCCCCAGGCCTAGGCGGACCTCT 0: 1
1: 0
2: 0
3: 12
4: 140
Right 961043843 3:123695295-123695317 AGCTCACCCATGTCAAAGCACGG 0: 1
1: 0
2: 1
3: 16
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961043835 Original CRISPR AGAGGTCCGCCTAGGCCTGG GGG (reversed) Intronic
901017791 1:6241861-6241883 AGAATTCCGCCCAGGCCTTGAGG + Intergenic
903940852 1:26930258-26930280 AGAGGACCGCCTGAGCCTAGTGG - Intronic
904256622 1:29258794-29258816 AGCGGTCAGCCTGTGCCTGGAGG + Intronic
906113824 1:43342178-43342200 AGAGGTACGGCCAGGCATGGTGG - Intronic
906662547 1:47593280-47593302 AGAGGTCAGCCCCGGGCTGGCGG - Intergenic
908321001 1:62978829-62978851 AGAGGTCGCCCTAGGCATTGTGG + Intergenic
915368813 1:155330919-155330941 AGAGGTCCTTCTAGGCTTGGGGG - Exonic
919880339 1:201896822-201896844 AGAGGGCAGTCTAGTCCTGGGGG - Exonic
919990769 1:202707710-202707732 AGAGGGCGGCACAGGCCTGGCGG + Intronic
921445014 1:215235678-215235700 AGAGGTGAGCCTAGGGGTGGGGG - Exonic
922719323 1:227892320-227892342 AAAGGTCCACCCAGCCCTGGGGG - Intergenic
1069549088 10:69350041-69350063 AGGGGTCAGCCTAGGGCTGCAGG - Intronic
1073291101 10:102413785-102413807 AGAGGACAGCCTTGGGCTGGGGG - Exonic
1075347867 10:121697492-121697514 AGAAGTCCCCTCAGGCCTGGAGG + Intergenic
1075777112 10:124996268-124996290 AGAGGGCAGCCTGGGGCTGGGGG - Intronic
1077048181 11:555337-555359 AGAGGCCGGGCTGGGCCTGGAGG - Exonic
1077164415 11:1128746-1128768 AGAGGGGGGCCGAGGCCTGGGGG + Intergenic
1078844210 11:15107069-15107091 AGAGGTTCGCCTGGGACAGGAGG - Intergenic
1079006449 11:16794605-16794627 AGGGGTCCGCACAGGGCTGGTGG + Exonic
1082004910 11:47414119-47414141 GGAGGTCAGCAAAGGCCTGGTGG - Intronic
1083968948 11:66060750-66060772 AGAGGTCAGGCTGGGCCTTGGGG + Intronic
1085516238 11:77113418-77113440 AGGGATACGCCTAGGCCAGGAGG + Intronic
1087182050 11:95150913-95150935 AGAGGTAGACCTAGGCCAGGAGG + Intergenic
1088446105 11:109930316-109930338 AGAGGTACGGCAAGGCCTGATGG + Intergenic
1089084820 11:115807902-115807924 AAAAGTCAGCCTGGGCCTGGAGG - Intergenic
1089321652 11:117630541-117630563 AGAGCTCCGGCAAGACCTGGTGG - Intronic
1089682099 11:120124295-120124317 TGAGGTCCGGCCAGGCCTGGGGG - Intronic
1090471907 11:126988554-126988576 ACAGGTGGGCATAGGCCTGGAGG + Intronic
1093348399 12:18068495-18068517 GGAGTTCCTCCTAGGTCTGGTGG - Intergenic
1098012865 12:66073079-66073101 AGAGGTGCGGCCAGGCATGGTGG + Intergenic
1112479023 13:99756985-99757007 AGAGGACCGCCTGAGCCTGGGGG - Intronic
1113990404 14:16023763-16023785 CGAGGTCCTGCTGGGCCTGGAGG + Intergenic
1119181768 14:72610254-72610276 AGAGGGCATCCAAGGCCTGGTGG + Intergenic
1119196057 14:72717444-72717466 AGAGATCAGCCTAGGCAAGGAGG - Intronic
1122601194 14:102922791-102922813 CGAGGTCGCTCTAGGCCTGGAGG + Intronic
1123697935 15:22892403-22892425 GGATGTCCGCCTGTGCCTGGAGG - Intronic
1125517977 15:40333473-40333495 AGAGGATCGCCTGAGCCTGGAGG + Intronic
1128632457 15:69280446-69280468 AGAGCTTAGCCCAGGCCTGGTGG + Intergenic
1129440594 15:75578651-75578673 AGAGGCCGGCGTAGGCCTCGGGG + Intronic
1130431287 15:83849653-83849675 AAAGGACCCCCTTGGCCTGGAGG - Intronic
1131158537 15:90089823-90089845 AGAAGCCAGTCTAGGCCTGGTGG + Intronic
1131252105 15:90837699-90837721 GGAGGTCCCACTGGGCCTGGAGG - Intergenic
1132373578 15:101313787-101313809 AGAGGTGGGCCTAGGCCTGTTGG - Intronic
1133212620 16:4271941-4271963 AGAGGTCCGCCTACTCCAAGAGG + Intronic
1137444502 16:48523528-48523550 AGAGCTCGCCCCAGGCCTGGTGG - Intergenic
1137634836 16:49977078-49977100 AGAGGTCCGGCTGGGTGTGGTGG + Intergenic
1138314808 16:56060827-56060849 AGAGGCTCTCCTGGGCCTGGGGG - Intergenic
1141539438 16:84708160-84708182 AGAGGTCTGGCTGGGCGTGGTGG + Intronic
1142175447 16:88643057-88643079 AAAGGTCCTCCCGGGCCTGGAGG - Intergenic
1142223850 16:88867920-88867942 AGAGGATGGCCTCGGCCTGGGGG - Intergenic
1144045351 17:11450171-11450193 AGAGATCCGGCTGGGCATGGTGG - Intronic
1144857594 17:18278213-18278235 AGAGGGCTGGCTAGCCCTGGGGG + Exonic
1145876066 17:28319123-28319145 AGCGGTCTGCCTAGCCCTCGCGG + Exonic
1146912890 17:36659550-36659572 AGGGGTCTGCCGAGGCCTGGGGG + Intergenic
1146919353 17:36699748-36699770 ATAGGTCAGCCAAGGCCTAGGGG - Intergenic
1146949420 17:36895339-36895361 AGAGGTCATCATAGGGCTGGCGG + Intergenic
1147588321 17:41665749-41665771 AGAGGTCAGCCCAGGGCTGGGGG - Intergenic
1149998217 17:61416070-61416092 AGAGGTCTGCCCTGGCCTTGGGG - Intergenic
1150124345 17:62627135-62627157 AGGGGTCCTCCTCGGCATGGAGG + Intergenic
1150284641 17:63948048-63948070 AGATGTCCTCGAAGGCCTGGGGG + Exonic
1151560448 17:74866852-74866874 AGATGTCCACGTGGGCCTGGGGG + Exonic
1152163518 17:78684911-78684933 AGAGGTCTGACCAGGCATGGTGG + Intronic
1152468981 17:80480615-80480637 AGGGGTGTGCCTAAGCCTGGTGG + Intergenic
1152835130 17:82524900-82524922 TGAGGTCTGCCTGGGTCTGGTGG + Intronic
1153684620 18:7533243-7533265 AGATGCAAGCCTAGGCCTGGGGG + Intergenic
1156459296 18:37312755-37312777 ACAGCACCTCCTAGGCCTGGGGG - Intronic
1157545945 18:48546607-48546629 TGAGGCTCGTCTAGGCCTGGGGG + Intronic
1161851601 19:6740391-6740413 AGAGGTCCGGCTAGGATAGGGGG - Intronic
1162116113 19:8430565-8430587 AGAGGGAGGCCTAGGCCTGGAGG + Intronic
1163002034 19:14374606-14374628 AGAGGTGTGGCTAGGCATGGTGG + Intergenic
1166782053 19:45348071-45348093 CCAGGTCCTCCAAGGCCTGGCGG - Exonic
1167455018 19:49593378-49593400 GGGGGGCCGCATAGGCCTGGCGG - Exonic
1168663660 19:58186070-58186092 AGAGTTCCGGCCAGGCATGGTGG + Intronic
926864231 2:17340958-17340980 GGAGTTCCTCCTAGGTCTGGTGG - Intergenic
929111707 2:38410357-38410379 ACAGGCCCGGCCAGGCCTGGTGG + Intergenic
929666724 2:43839131-43839153 GGAAGTCGGCCCAGGCCTGGTGG + Intronic
932860173 2:75283392-75283414 ACAGGTTTGCCTAGGACTGGGGG - Intergenic
937057419 2:118951254-118951276 GGAGTTCCTCCTAGGTCTGGTGG + Intronic
937908425 2:127064003-127064025 TGAGCTCCTCCTCGGCCTGGGGG + Exonic
937956046 2:127422343-127422365 AGAGGCCAGCCAAGGCCTGCTGG - Intronic
938560142 2:132464981-132465003 AGAGGTCCTAGCAGGCCTGGTGG + Intronic
943188578 2:184646770-184646792 AGAGGTTTGCCTAGGCACGGAGG - Intronic
947706150 2:232277174-232277196 AGGGATCAGCCTAGGCATGGTGG + Intronic
1168767003 20:388470-388492 AGAGGTCGTCCCAGTCCTGGGGG + Intronic
1172229954 20:33329942-33329964 AGAGGTCCCTTTGGGCCTGGTGG - Intergenic
1173340376 20:42147778-42147800 AGGGGACCGAGTAGGCCTGGGGG + Intronic
1174098816 20:48110833-48110855 AGAGGTCAGGCTGGGCATGGTGG - Intergenic
1174131808 20:48350166-48350188 TTAGGTCCACCTAGGGCTGGGGG - Intergenic
1174672278 20:52319326-52319348 AAGGGTCTGCCTAGGCTTGGAGG + Intergenic
1176146703 20:63568683-63568705 TGAGGCCCGCCTGGTCCTGGAGG - Exonic
1180316867 22:11283763-11283785 CGAGGTCCTGCTGGGCCTGGAGG - Intergenic
1180913449 22:19469410-19469432 AGAGGTCAGACTAGGGCTTGAGG + Intronic
1181424189 22:22822448-22822470 CGAGGTGTGCCCAGGCCTGGAGG + Intronic
1182899904 22:33889313-33889335 AGAAGTCTGCCTAGCCCAGGAGG - Intronic
950407504 3:12813934-12813956 AGAGATGCCCCTAGGCCTGAAGG + Intronic
952554836 3:34520250-34520272 GGAGTTCCTCCTAGGTCTGGTGG + Intergenic
954429203 3:50460565-50460587 AAAGGTCCGGCTGGGCGTGGTGG + Intronic
956670555 3:71685648-71685670 TGAGTTCCGGCTGGGCCTGGTGG - Intronic
958453301 3:94300415-94300437 ACAGGTCCATCTAGGCATGGAGG + Intergenic
961043835 3:123695254-123695276 AGAGGTCCGCCTAGGCCTGGGGG - Intronic
961456098 3:127024687-127024709 AGGGGTCCTCCTAGAACTGGAGG - Intronic
966751198 3:183323705-183323727 AGAGGACTGCTTGGGCCTGGAGG + Intronic
968542665 4:1175776-1175798 AGTGGTGGGCCTAGGCCTGGGGG + Intronic
968759086 4:2432896-2432918 AGAGATGGGCCTAGGCCGGGTGG - Intronic
975739150 4:77411762-77411784 GGGGTTCCGCCTAGGTCTGGTGG + Intronic
975762115 4:77630877-77630899 AGAGGACCCCCTTGGCCTAGGGG - Intergenic
977238846 4:94542022-94542044 AGAGGCCCGGCTGGGCATGGTGG + Intronic
977618178 4:99107969-99107991 GGAGTTCCTCCTAGGTCTGGTGG + Intergenic
984579341 4:181493441-181493463 AGAGGTACGACCAGGCGTGGTGG + Intergenic
984995026 4:185422295-185422317 AGAGGTGCGCCATGGGCTGGTGG + Intronic
987847564 5:23305458-23305480 AGAGGCCCGACCAGGCCTGGTGG - Intergenic
988558006 5:32254969-32254991 AGATGTCCCCCTAGACCAGGCGG + Intronic
998438577 5:142136465-142136487 AGAGGTCAGGCTGGGCATGGTGG + Intronic
1000304855 5:159985865-159985887 AGAGTTCCGTCTAGCCCTTGAGG + Intergenic
1006638342 6:35475697-35475719 TGAGGTCGGCCTGGGCATGGGGG + Exonic
1011601304 6:89062597-89062619 GGAGGATCGCTTAGGCCTGGGGG + Intergenic
1013013157 6:106137785-106137807 AGAGGTGCCACTGGGCCTGGTGG + Intergenic
1017736174 6:157366764-157366786 GGAGGTCCGCCCAGGGCTTGGGG - Intergenic
1022441659 7:30438009-30438031 AGAGGTGCGCAGAGTCCTGGAGG + Intronic
1026698158 7:72614343-72614365 AGAGGTCAGACTGGGCATGGTGG + Intronic
1028986130 7:97009876-97009898 ACAGGGCCGCCGAGCCCTGGAGG - Exonic
1029598298 7:101549167-101549189 ACAGGTCCCCCTGGGCCTCGAGG + Exonic
1030039739 7:105439060-105439082 AAAGGACCGGGTAGGCCTGGTGG - Intergenic
1032757643 7:134906215-134906237 AGAAGTCCGGCCAGGCATGGTGG - Intronic
1036656205 8:10679034-10679056 AGGGCTCAGCCTGGGCCTGGAGG - Intronic
1037722642 8:21458050-21458072 AGAGGAGCCCCTAGGCCTGAAGG + Intergenic
1037886145 8:22597449-22597471 AGGGGTGCGCCATGGCCTGGAGG + Intronic
1038308284 8:26424194-26424216 ACATGTTCGCCCAGGCCTGGAGG - Intronic
1040504562 8:48035481-48035503 AGGGGTGTGCCTGGGCCTGGAGG + Intronic
1044577970 8:93792147-93792169 AGAGGGCCGGCTGGGCATGGTGG - Intronic
1049096703 8:140552421-140552443 ACAGGCACTCCTAGGCCTGGGGG + Intronic
1049257566 8:141621980-141622002 AGAGACCCACCTAGGCCAGGAGG - Intergenic
1049569212 8:143360567-143360589 AGAGCTCCCTCTCGGCCTGGAGG - Intergenic
1055096606 9:72420834-72420856 AGAGGTCAGACTAGGGCTGTGGG + Intergenic
1057394052 9:94663782-94663804 ACAGGGCCTCCTAGGCATGGTGG - Intergenic
1060212450 9:121718894-121718916 TGAAGTCCGCCTAGGACTGGGGG - Intronic
1060396285 9:123319116-123319138 GGAGGGCAGCCTGGGCCTGGAGG + Intergenic
1060479876 9:124011841-124011863 AGAGGGTCGCCTTGGGCTGGGGG + Exonic
1060552819 9:124493662-124493684 AGAGCTCTGCGTAGGCCCGGGGG - Intronic
1060744173 9:126119250-126119272 AGAGGCCCGGCTGGGCATGGTGG - Intergenic
1062306851 9:135912145-135912167 AGAGGTCCCCCTAGGCTTAAAGG + Intergenic
1062426747 9:136509628-136509650 AGGCGTCCGCCTAGGCCGGCTGG - Intronic
1203771984 EBV:54142-54164 AGAAGTCCCCCGTGGCCTGGAGG + Intergenic
1203365170 Un_KI270442v1:249701-249723 CGAGGTCCTGCTGGGCCTGGAGG - Intergenic
1186801763 X:13099811-13099833 AGAAGTCTGCCTGGGCATGGAGG + Intergenic
1188805980 X:34590486-34590508 AGAGGTGTGCCTAGGCATGGAGG + Intergenic
1189494608 X:41497902-41497924 AGAGTTCCCCCTAGACCTGGTGG - Intergenic
1190245667 X:48688809-48688831 GGAGGGCCCCCTCGGCCTGGGGG - Exonic
1190821861 X:53980923-53980945 AGATGTCTGGCTGGGCCTGGTGG + Intronic
1190907525 X:54742158-54742180 AGAAGTCCGGCCAGGCGTGGTGG - Intergenic
1191754878 X:64582276-64582298 CCAGGTCCCCCTAGGCCTGCTGG - Intergenic
1192358101 X:70422346-70422368 AGAGGTCCCCATGGGCCTTGTGG - Intergenic
1197122344 X:122906957-122906979 AGATGGAAGCCTAGGCCTGGAGG - Intergenic