ID: 961046375

View in Genome Browser
Species Human (GRCh38)
Location 3:123711515-123711537
Sequence CCTGCCTCACAGGAGCTGAA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 1, 2: 1, 3: 25, 4: 270}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961046370_961046375 -7 Left 961046370 3:123711499-123711521 CCTCATGCTTAGAATCCCTGCCT 0: 1
1: 0
2: 1
3: 15
4: 262
Right 961046375 3:123711515-123711537 CCTGCCTCACAGGAGCTGAAGGG 0: 1
1: 1
2: 1
3: 25
4: 270
961046369_961046375 -2 Left 961046369 3:123711494-123711516 CCTTTCCTCATGCTTAGAATCCC 0: 1
1: 0
2: 1
3: 31
4: 706
Right 961046375 3:123711515-123711537 CCTGCCTCACAGGAGCTGAAGGG 0: 1
1: 1
2: 1
3: 25
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961046375 Original CRISPR CCTGCCTCACAGGAGCTGAA GGG Intronic
900697857 1:4023329-4023351 CCTGGGTCACGGGAGCTGCAGGG - Intergenic
900727649 1:4228290-4228312 CCTGCCACACAGGAACTCAAGGG - Intergenic
901081580 1:6586874-6586896 CCTCCCTCACAGTAGCTGTCAGG + Intronic
901643700 1:10705637-10705659 CCTGCCCCACATGGGCTGAGGGG + Intronic
901741573 1:11345343-11345365 CCAGCCTCACAGGACCTGCGGGG + Intergenic
902332738 1:15738501-15738523 CCTACCACACAGGGGCTAAAAGG - Intronic
903131094 1:21280014-21280036 CCTCCCTTTCAGGACCTGAATGG - Intronic
904251004 1:29224277-29224299 CCAGCCAGACAGGAGCTGCATGG - Intronic
905205167 1:36339285-36339307 CCAGCACCACAGCAGCTGAAGGG - Intergenic
905489582 1:38333082-38333104 CCTACCTGAAAGCAGCTGAAGGG - Intergenic
906254570 1:44338253-44338275 CCTGACTCACAGGAACTGTGAGG - Intronic
908646826 1:66287515-66287537 CCTGCTTTAAAGGAGCTGAGAGG + Intronic
908835073 1:68221436-68221458 CCAGACACACAGGAGCTAAAAGG + Intronic
909356299 1:74713905-74713927 TCTGCCTCTCAGGAGCTTAGAGG - Intronic
912480761 1:109980798-109980820 CCTGGCCGACAGGAGGTGAAAGG + Intergenic
913496542 1:119433120-119433142 CATGCCTTACAAGAGCTGGACGG - Intergenic
914690160 1:150018771-150018793 CATCCCTGAAAGGAGCTGAAAGG + Intergenic
915681351 1:157584702-157584724 CTTGCCTCAAGGGAGTTGAAGGG + Intronic
915736687 1:158089723-158089745 ACTGCCTCACTGGAGATGATGGG - Exonic
917636910 1:176945935-176945957 GCTGCCGGACAGGTGCTGAAAGG - Exonic
917884508 1:179370057-179370079 TCTCCCTCACAGGAGCTGGAAGG + Exonic
919858539 1:201722267-201722289 GGTGGCTCCCAGGAGCTGAAGGG - Intronic
920434184 1:205937677-205937699 CCCGCCTCACGGGCGGTGAAGGG - Intronic
1062804904 10:411300-411322 CCTGCCTCACAGCAGCTCTCTGG - Intronic
1063626666 10:7696697-7696719 CCTGCCTCACTGCACCTCAAAGG + Intergenic
1064112913 10:12553893-12553915 TCTGCCACATAGGAGCTGCAAGG - Intronic
1064958162 10:20934284-20934306 CAAGCATCTCAGGAGCTGAAGGG + Intronic
1067317650 10:45183422-45183444 CCTGACTCACAGGTGCCAAATGG + Intergenic
1068030363 10:51698405-51698427 CCTTCCTCACATGAGATGAGGGG - Exonic
1069043197 10:63716148-63716170 CCTGCTTCAAAGGAGAAGAAAGG - Intergenic
1070087010 10:73247288-73247310 CCTGCGTCACAAGCACTGAAGGG + Exonic
1070167437 10:73909505-73909527 CCTGCCTCCCAAAAGCTGAAAGG + Intronic
1072631703 10:97151112-97151134 CCTGCCTCTTAGGAGGTGACAGG - Intronic
1076264789 10:129101179-129101201 CCTGCCTCCCAGGAGATTAGAGG - Intergenic
1076298900 10:129409646-129409668 CTTGCCTCACAGCAGCAAAATGG + Intergenic
1077413370 11:2413674-2413696 CCTGGCCCACGTGAGCTGAAGGG + Intronic
1077610344 11:3639988-3640010 ACTGCCTCGCAGCAGCTGCAGGG + Exonic
1077764631 11:5144683-5144705 CCGGCCGCACAGGAGCCCAAGGG - Intergenic
1079712402 11:23702345-23702367 GCTGCATCACAGCAGGTGAAGGG + Intergenic
1079796798 11:24813811-24813833 CCTGCCTCCCAGGTGAAGAAGGG - Intronic
1081637525 11:44730309-44730331 CCTGCACCCCAGGAACTGAAAGG - Intronic
1081639778 11:44744889-44744911 CCTGCCTGAGTGCAGCTGAAGGG + Intronic
1081645848 11:44789890-44789912 CCAGGCTCAGAGGAGCTGGAAGG + Intronic
1081669415 11:44934799-44934821 CCTGCCTTCCAGGAGCCAAAGGG + Exonic
1082975819 11:59070644-59070666 CCTGACTCAGAGGAGCACAACGG + Intergenic
1083289373 11:61681150-61681172 CCTTCCTCACGGGCGATGAAGGG + Intronic
1084866459 11:72062143-72062165 CCTGCCGTATAGGAACTGAATGG - Intronic
1086542229 11:87926735-87926757 CTTTCCTCACAGGACCTGACCGG + Intergenic
1088365452 11:109035657-109035679 TCTGCCTAACAGCAGATGAAAGG + Intergenic
1089270752 11:117300039-117300061 CCTGCCTCGCAGGAGAGGAAGGG - Intronic
1090387417 11:126365041-126365063 CCTGCCCAGGAGGAGCTGAAGGG - Intronic
1090389983 11:126382239-126382261 CCTGCCCAGGAGGAGCTGAAGGG - Intronic
1093638670 12:21501116-21501138 CCTGCTTCACAGTAGCGGAAGGG - Intronic
1095970341 12:47897457-47897479 CCTGCCTGCCCGGAGCTGACAGG + Intronic
1096305026 12:50466885-50466907 CCTGTGTCACAGAAGCTGAAAGG - Intronic
1096453941 12:51769971-51769993 CCTGCTTCACAGAAGGTGAAAGG + Exonic
1097260392 12:57716522-57716544 GCTGCCTCAGAGGAGCAGGATGG + Intronic
1101839163 12:108315562-108315584 CCTGCCTCACAGGACCCTTATGG - Intronic
1102879769 12:116475335-116475357 CCTTCCTCCAAGGAGCTCAAAGG + Intergenic
1103700069 12:122844637-122844659 CCTGCCTCTTGGGAGCTGGATGG + Intronic
1104655142 12:130568789-130568811 CCCACCTCACAGGAGCTGGCTGG - Intronic
1104858676 12:131913735-131913757 TCTGCCCCACAGGAGCTCACTGG + Exonic
1104988052 12:132608397-132608419 CCTCCCTCACAGGAAGTCAAAGG + Intronic
1106876190 13:34076603-34076625 CCATACTCACAGGAGATGAATGG - Intergenic
1107885125 13:44868791-44868813 GCTGCCTCACAGTATCTCAAAGG - Intergenic
1109354070 13:61218115-61218137 CCTGCCACACAGCAGCAAAAAGG + Intergenic
1112297544 13:98201441-98201463 CCTGCCTCAAAGAAACAGAACGG + Intronic
1112508097 13:99987554-99987576 CCTTCCCCGCAGGAGCTGATCGG + Intergenic
1112605150 13:100897219-100897241 AGGGCCTCACAGCAGCTGAAGGG - Intergenic
1113229455 13:108195945-108195967 CCTGCCGCACTGCAGCTGAAAGG + Intergenic
1114730552 14:24988430-24988452 GCTGCTTCACAGCAGCAGAAGGG + Intronic
1117063979 14:51990113-51990135 ACTGCCTGCCAGGAGCTAAAGGG + Intronic
1117724901 14:58663500-58663522 GCTAACTCACAGGAGCTGAGTGG + Intergenic
1117752565 14:58939049-58939071 CCTGCTCCACAGGAGCAGGATGG - Intergenic
1121255856 14:92529657-92529679 TTTGCAGCACAGGAGCTGAAGGG - Intronic
1121967309 14:98322429-98322451 CCTGACTCCTAAGAGCTGAATGG - Intergenic
1122066324 14:99176313-99176335 CCTGCCTGACAGGGGCTGCAGGG + Intronic
1125068884 15:35527897-35527919 CCTCTCTCACAGGAGTTTAAAGG + Intronic
1125101241 15:35915013-35915035 CCTGCTTCACAGAAGCTTATAGG + Intergenic
1125451996 15:39818556-39818578 GTGGCCTCACAGGAGCTGACTGG - Intronic
1126784216 15:52163544-52163566 CCTGACTCCCAGGAGCTGGCAGG - Intronic
1128096975 15:64964324-64964346 CCTAACTCACAGCAGCAGAAGGG - Intronic
1128831720 15:70775333-70775355 ACTGACTCACAAGAGCTGACTGG - Intergenic
1129249771 15:74302496-74302518 CCTGCCTCTCAGGATCAGATGGG + Intronic
1130042839 15:80419288-80419310 CCTGCCTCAGTGGACCTGAAGGG - Intronic
1130081489 15:80737817-80737839 CCTGAGCCACAGGAGCAGAAGGG + Intronic
1131091431 15:89627450-89627472 CCAGCCTTACAGCAGCTCAAGGG - Exonic
1131848480 15:96513154-96513176 CCAGCCTCACGGTAGCTCAAAGG + Intergenic
1132101560 15:99026985-99027007 CATGCCACTAAGGAGCTGAACGG + Intergenic
1132483532 16:178162-178184 CCAGCCTCAGGGGAGCTGAGTGG - Intergenic
1132501973 16:288504-288526 CCAGCCTCTCAGGAGTTGCAGGG + Intronic
1132593264 16:735766-735788 CCTGCCTCACTGGGAATGAAGGG + Intronic
1132660811 16:1060731-1060753 CCTCCCTCACAGGAGTCGGAGGG + Intergenic
1135549269 16:23385747-23385769 CCTGCCACAGGGTAGCTGAATGG + Intergenic
1135930345 16:26731006-26731028 ACTGCCTTAGAGGAGCAGAAAGG - Intergenic
1135981608 16:27152067-27152089 GCTGGCTCACTGGAGCTGGATGG + Intergenic
1138563229 16:57814535-57814557 CCTGCCTCATAGGTGCTGTAAGG - Intronic
1140101017 16:71916747-71916769 GCTGCCTAACAGTTGCTGAAAGG + Intronic
1140514275 16:75530886-75530908 CCTGGCTCACAGGATCTGGGGGG + Exonic
1141689706 16:85589160-85589182 GCTTCCTAGCAGGAGCTGAAAGG + Intergenic
1141892980 16:86939599-86939621 CCTGCCACATACAAGCTGAATGG - Intergenic
1142671392 17:1488919-1488941 CCTGGCCTATAGGAGCTGAAGGG - Intronic
1143331154 17:6136751-6136773 ACTGCCCCACAGGAGCTCACAGG - Intergenic
1144968146 17:19090481-19090503 CCAGCCTCCCAGGAGATAAAGGG - Intergenic
1144979771 17:19161582-19161604 CCAGCCTCCCAGGAGATAAAGGG + Intergenic
1144988451 17:19216650-19216672 CCAGCCTCCCAGGAGATAAAGGG - Intronic
1146160190 17:30555407-30555429 TCTGCCTCCCGGGAGCTGACAGG - Intergenic
1146271917 17:31490208-31490230 CCTGCCTACCAGGAGGGGAAGGG - Intronic
1146378510 17:32311390-32311412 CCTGCCTCCCAGCAGCCGAGGGG - Intronic
1146952262 17:36915015-36915037 GCTGCCTCTCAGCAGCTGTAGGG + Intergenic
1147326291 17:39671346-39671368 CCTGCCCCACAGGAATAGAATGG - Exonic
1147364098 17:39949081-39949103 CCTGCCTCACAGGGGCCTATGGG + Intergenic
1147644420 17:42025336-42025358 GCAGCCTCTCAGGAGCTGACAGG + Exonic
1148913102 17:50953866-50953888 CCTGCCTCCCTGGAGCTTGAAGG - Intergenic
1149008029 17:51826096-51826118 CAGGCCTCCCAGGAGCTGAAAGG - Intronic
1150228745 17:63538398-63538420 CCCGCCTTGCAGGTGCTGAAGGG + Exonic
1150929344 17:69567335-69567357 GCGGCCTCACTGGTGCTGAATGG + Intergenic
1151187347 17:72373990-72374012 CCTGGCTCCCAGGAGCTGGCAGG - Intergenic
1151338633 17:73455773-73455795 TGTGTCCCACAGGAGCTGAAAGG + Intronic
1151729239 17:75901146-75901168 CCTGGCTCATAGGAGGTGAGCGG + Intronic
1151949596 17:77343230-77343252 CTTGCCTCGCAGGAGGTGGATGG - Intronic
1154046909 18:10914908-10914930 CCTACCTGAAAGGAGCTTAAAGG - Intronic
1154174753 18:12078120-12078142 CCTACCTGAAAGGAGCTTAAAGG + Intergenic
1154508055 18:15061692-15061714 CCTGCATTGCAGTAGCTGAAGGG + Intergenic
1155333973 18:24746295-24746317 CCATCCTCACAGGAGCAAAAGGG + Intergenic
1156031488 18:32718422-32718444 CCTACCTCACAGAAGGTGCATGG - Intronic
1156305306 18:35873615-35873637 CCTGCCTCTCAGCAGCTGTTAGG - Intergenic
1156587504 18:38447553-38447575 CCTGCCTGACAAGAACTCAAAGG + Intergenic
1157290007 18:46403040-46403062 CCTGCCTGAGAGCAGCTGAAAGG - Intronic
1158086207 18:53654501-53654523 CCTTACTCAGTGGAGCTGAATGG - Intergenic
1161720211 19:5898112-5898134 CCTCCTTCACGGGAGGTGAAGGG + Intronic
1163404937 19:17116313-17116335 CCTTCCTCACTGTAGCTGACAGG + Intronic
1163899773 19:20091095-20091117 CCTTCCCCACAGGGTCTGAAAGG - Intronic
1164506765 19:28867380-28867402 CCTGCCTCTAATGAGCTGTATGG + Intergenic
1165142825 19:33712693-33712715 ACTGTCTCACAGGAGCCTAAGGG + Intronic
1165804040 19:38569570-38569592 CCTGCTTTACAGAAGATGAAAGG - Intronic
1166128915 19:40733661-40733683 CCTGCAGCACAAGAGCTGGAGGG + Intronic
1166547417 19:43641527-43641549 CCTGCTTCACAGGGGTTGATGGG - Intergenic
1167133057 19:47600330-47600352 CCTGCCTCCCAGAAGCTGTCAGG + Intergenic
1167810843 19:51828883-51828905 CCTGCCCTCCAGGAGCTGCAGGG - Intergenic
925511349 2:4629146-4629168 TCTGCTTGACAGGAGATGAAAGG + Intergenic
925857901 2:8148366-8148388 CCTGACTTACAGAAGCAGAAAGG + Intergenic
926696237 2:15771649-15771671 CCTGCCTCACAGCAGCCTAGTGG + Intergenic
928259947 2:29757457-29757479 CCTTCCTTACAGGACATGAAAGG - Intronic
928722875 2:34140873-34140895 GCAGCCTGAAAGGAGCTGAATGG + Intergenic
929791220 2:45024471-45024493 CCTGCCTCTCCGGAGCTGGTTGG + Intergenic
931105377 2:59049403-59049425 ACTGCCTGATAGGATCTGAAAGG + Intergenic
933511432 2:83246038-83246060 TCGGGCTCACAGGAGCTGACGGG + Intergenic
933713672 2:85345143-85345165 TCAGACTCTCAGGAGCTGAAGGG - Intronic
933840559 2:86282891-86282913 CCTGCCTCTCAGGACCTGAACGG + Intronic
934167287 2:89305813-89305835 TCTGCCTCACAGGGGCTTCAGGG + Intergenic
934199988 2:89876631-89876653 TCTGCCTCACAGGGGCTTCAGGG - Intergenic
937779819 2:125824195-125824217 CCTGGGACACAGGAGATGAAAGG - Intergenic
939872700 2:147542606-147542628 CTTGCCTCACAGAAGTGGAAAGG + Intergenic
940798263 2:158103859-158103881 CTTGCCTCACAAGAGAAGAAAGG + Intronic
942149338 2:173058994-173059016 CCTGCCTCACAAAAGCTGGGGGG + Intergenic
943800009 2:192045766-192045788 CCTGCCACCCAGGAGCTGGCTGG - Intronic
943909250 2:193542271-193542293 CCTGCCTCACAGGAGCCCTTGGG + Intergenic
945917384 2:215718227-215718249 CCTTCCTCCCAGGATCCGAAAGG + Intergenic
946326760 2:218988647-218988669 CCTGTCTCACAGGGGCTGTTGGG - Intergenic
947508260 2:230726804-230726826 CCTTCCCTACAGAAGCTGAAAGG + Intronic
947833588 2:233159325-233159347 ACTGCCTCACACGAGCTGCATGG - Intronic
948358025 2:237395950-237395972 CCTGGCTCACAGCTGCAGAAGGG - Intronic
948544951 2:238720899-238720921 AATGCCTCTCAAGAGCTGAATGG + Intergenic
948627051 2:239275788-239275810 CCTGCCTTCCAGGAGCTCACAGG + Intronic
948655857 2:239476357-239476379 CCAGCATCAGAGGAGCTGGAAGG + Intergenic
948829017 2:240588478-240588500 GCGGCCTCACAGAAGCTGAGTGG + Intronic
1169601788 20:7269440-7269462 CCTGCCTCACTCAATCTGAAAGG + Intergenic
1170695706 20:18656536-18656558 CCAGCCTCCCAAGAACTGAATGG - Intronic
1171487111 20:25493327-25493349 GCTGCCTCTCAGGACCTGAGGGG - Intronic
1172825665 20:37782176-37782198 CCTGCCTCCAAGAAGCTCAAAGG + Intronic
1172901305 20:38336851-38336873 CCTGCCTCATGGCAGCTCAAGGG - Intronic
1175761908 20:61566968-61566990 CCTGCCTCGGGGGAGCTGATGGG + Intronic
1175802356 20:61808078-61808100 CCTGCCACACAGAAGCAGCATGG + Intronic
1176257891 20:64162106-64162128 GCCGCCTCCCAGGGGCTGAAGGG + Intronic
1176790024 21:13310107-13310129 CCTGCATTGCAGTAGCTGAAGGG - Intergenic
1177516465 21:22158195-22158217 TCTGCCTCACAGAATTTGAACGG - Intergenic
1179429763 21:41312828-41312850 CCAGCCTCTCAGGAGCTGAGGGG + Intronic
1179961364 21:44768520-44768542 CCTGCCTCACAGGATTACAAAGG + Intergenic
1179963488 21:44785562-44785584 CTTGCCTCACAGAAGTCGAACGG - Intronic
1180090009 21:45529137-45529159 GCGGCCACACAGGAGCAGAAGGG + Intronic
1180912824 22:19464804-19464826 CCTGCCCCACAGAAGCTGACAGG - Intronic
1184085956 22:42264451-42264473 CCTGGCTCAAAAGAGCTTAAGGG - Intronic
1184239235 22:43203190-43203212 CCGGCCTCACAGAAACAGAAGGG + Exonic
1184248978 22:43249621-43249643 CCAGGCTCAAAGGAGCTGGAAGG - Intronic
1184276806 22:43413265-43413287 GCTGGCTCACGGGAGTTGAATGG + Intronic
1184384279 22:44165494-44165516 CCTGCCTCACAGCAACAAAAGGG - Intronic
949243594 3:1899706-1899728 ACTGCAACACAGGAGCTAAAAGG - Intergenic
949310308 3:2689896-2689918 CCTACCTCACAGGATATGACTGG - Intronic
952338826 3:32428211-32428233 CCTGCCTGAGAGGTGCTGAGAGG + Intronic
952503825 3:33989419-33989441 CCTCCCACAAAGGAGCTCAAAGG + Intergenic
952979498 3:38723422-38723444 ACTGCTTCACAGAAGGTGAAGGG - Exonic
953295430 3:41710916-41710938 TAAGTCTCACAGGAGCTGAAGGG + Intronic
953368922 3:42370887-42370909 CCTTCCTCATACGATCTGAATGG + Intergenic
953589291 3:44235912-44235934 CTTGCCTCTCAGGAGCAAAACGG + Intergenic
953797714 3:45997985-45998007 CCTGCCTTAAAGCAGGTGAAAGG + Intergenic
954407186 3:50351759-50351781 GCTGCCTCTCAGGAGGTGTAAGG + Intronic
954541923 3:51399071-51399093 CCTGCCTGGGAGGCGCTGAAGGG + Intronic
954648305 3:52144633-52144655 CCTGTCTCACAGGAGGTGTTGGG - Intronic
954659130 3:52217355-52217377 GCTGCCTCACAGGAGCTTTCAGG + Intergenic
954788008 3:53109127-53109149 CCTGACTCAAAGCAGCTGGAGGG - Intronic
955045107 3:55352265-55352287 TCTGCCTCAAAGGAACTGGAAGG - Intergenic
955443077 3:58977977-58977999 CCTTCCTCTCAGGAACTGAATGG + Intronic
956730259 3:72190002-72190024 CGTGCCTCTTAGGAGCTCAAGGG - Intergenic
957041661 3:75340722-75340744 CCCGCCTCACAGGAGCTGAAGGG + Intergenic
959169698 3:102830227-102830249 CCTGTCTCCCAGGAGCTGTTGGG - Intergenic
961046375 3:123711515-123711537 CCTGCCTCACAGGAGCTGAAGGG + Intronic
961484932 3:127209884-127209906 GCAGCCCCACAGGAGCTGAGAGG + Intergenic
964502406 3:157362934-157362956 CCTGGAACACAGTAGCTGAATGG + Intronic
964629277 3:158792165-158792187 CCTTCCTCACAAGAAGTGAAGGG - Intronic
966373277 3:179270672-179270694 GCTGCCTCTCAGCAGCTGATGGG - Intergenic
966900770 3:184482467-184482489 CCTGCCGGATAGGAGCTGGATGG + Intronic
966925078 3:184639469-184639491 CCAGCAGCCCAGGAGCTGAAGGG + Intronic
968652629 4:1766276-1766298 CCTGCCACCCAGGAGATGAAAGG + Intergenic
968802701 4:2753805-2753827 CCTGACTCACTAGAGCAGAAGGG - Intronic
969348187 4:6582100-6582122 CCCGCCTCAGAGGTGCTGAGAGG + Intronic
970155693 4:13139810-13139832 CCTCCTTCACAGGAGCACAAGGG + Intergenic
970810248 4:20084739-20084761 CCTGCCCCACAGGAGCTTTTAGG - Intergenic
972281077 4:37602690-37602712 CCTGTCTCACAGGAGTTTTAAGG - Intronic
982079282 4:151771933-151771955 CCTGCCTGAGAGAGGCTGAAGGG - Intergenic
984948981 4:184992572-184992594 GCAGCCACACAGAAGCTGAACGG - Intergenic
985043918 4:185921007-185921029 TCTGCCTCTCAGGTGCTGAGGGG - Intronic
985047818 4:185958007-185958029 CCTGGCTCCCAGGAGTTGAGTGG - Intergenic
985179097 4:187237227-187237249 TCTCCCTCACAGTAACTGAATGG - Intergenic
986030819 5:3890980-3891002 CCTGCACCCCAGGACCTGAAGGG - Intergenic
986726600 5:10602596-10602618 CCTGCCTCAGAGCAGCTGGCTGG + Intronic
987962085 5:24823838-24823860 CCTGCCTCCCTGGGGCTGAGTGG - Intergenic
988640253 5:33033871-33033893 GCTGCCTAACATGAGCTGATGGG + Intergenic
991606760 5:68410056-68410078 CATGTCACACAGGGGCTGAATGG - Intergenic
993527327 5:88981939-88981961 GTTGCCTCACATCAGCTGAAGGG - Intergenic
993727079 5:91380769-91380791 CCGGCCTTACAGGTGCTGGATGG - Intronic
993974937 5:94467760-94467782 TCTGCCTGACTGGAGGTGAAGGG - Intronic
995192231 5:109330011-109330033 TATGACTCACAGAAGCTGAATGG - Intergenic
995417389 5:111925987-111926009 CCTGCCTCTCAGCAGCTGTTAGG + Intronic
996089624 5:119338247-119338269 CCTGCCTGACAGGAGCAAAAAGG - Intronic
997413637 5:133708564-133708586 CCTGCCTCACAGGCTGTGTATGG + Intergenic
999525725 5:152404210-152404232 CTTGCCTCAAATGAGATGAATGG - Intronic
999743907 5:154577074-154577096 CCTGCCTCAGCAGAGCTGGAAGG - Intergenic
1000743597 5:165001517-165001539 CCTGCCATCCAGGAGCTGATGGG - Intergenic
1003394755 6:5743413-5743435 CCTTCCTGACAGCAGCTGAAAGG + Intronic
1007066098 6:38991685-38991707 CCTGAGTAACAGGAGCTGAGTGG - Intronic
1007615902 6:43179715-43179737 CCAGCTACTCAGGAGCTGAAGGG - Exonic
1007888797 6:45264641-45264663 CCTGCCTCACAAGAAGTGCAGGG - Intronic
1009548064 6:65047812-65047834 TCTGCCACCCAGGAGCTGAGTGG + Intronic
1010925138 6:81735601-81735623 CCTGCATCCCAGGAGTTGGAAGG - Intronic
1012609718 6:101201563-101201585 CCTACCACACATGAGCTGAGGGG - Intergenic
1016192388 6:141287130-141287152 CCTGCCTTACAAAGGCTGAAAGG - Intergenic
1016764092 6:147773137-147773159 CCAGCAACACAGAAGCTGAAGGG - Intergenic
1016910781 6:149196551-149196573 CCTGGCTCAGAAGAGCTGACAGG + Intergenic
1018034326 6:159868350-159868372 CCTGATTCACACTAGCTGAAAGG + Intergenic
1018826096 6:167408819-167408841 CCTGCCTCACAGCATCGGACAGG - Intergenic
1021622103 7:22559226-22559248 CCTGCCTTAACGGAGCTGGAAGG - Intronic
1022382359 7:29872459-29872481 CCTGCCGCACAGGAGAGGAGAGG + Intronic
1024658346 7:51471331-51471353 CCTCCCTCACAGGCGCAGATTGG + Intergenic
1026409338 7:70103354-70103376 TCTGCCTCACAGGTTCTGAGAGG + Intronic
1026847470 7:73705983-73706005 CCTGCCTGAGAGAAGCTGGATGG + Intronic
1027128074 7:75571379-75571401 CCTGCCTGAAGGGAGCTGAGAGG - Intronic
1029221586 7:98994812-98994834 CCTGTCTTTCAGAAGCTGAAAGG + Exonic
1029418095 7:100456229-100456251 CCTGCCTCTCTGGTGCTGAAGGG - Intergenic
1030837139 7:114302845-114302867 ACAGCCTCTCAGGAGTTGAAAGG + Intronic
1031844187 7:126784603-126784625 CCTTCTTCACAGAAGCTGAAAGG + Intronic
1032261989 7:130345879-130345901 CCTACCTCACAGGGTTTGAAGGG - Exonic
1032275593 7:130452528-130452550 CCTGCCTTCAAGGAGCTGATAGG - Intergenic
1033705267 7:143880664-143880686 CCTGGCTCACTGGACCTAAAAGG + Intronic
1038525150 8:28266880-28266902 CCTGGCTCACAGCAGATGATTGG + Intergenic
1042012625 8:64264841-64264863 CTTGCCTCATAGGAGATTAAAGG - Intergenic
1044856554 8:96481844-96481866 CCTACCTCACAGACGCTGCATGG - Intergenic
1046061102 8:109140431-109140453 CCCTCCTCACAGTAGATGAAAGG - Intergenic
1049564628 8:143331763-143331785 CCTGCCTCCGAGGAGCTGGGTGG + Intronic
1049752212 8:144290666-144290688 CCTGGCTCCCATGGGCTGAATGG - Intronic
1051193036 9:14534626-14534648 CCAGCCTCACAGAAGGGGAAGGG - Intergenic
1051249660 9:15146556-15146578 CTTGTCTCACAGGCGCTGAGGGG - Intergenic
1053480489 9:38413104-38413126 CCTGCCTCACAGTTACTGGAGGG + Intronic
1055202521 9:73684306-73684328 GCCACCACACAGGAGCTGAAGGG + Intergenic
1056071078 9:82987547-82987569 CATGCCACACAGGAGCAGATGGG + Intronic
1056831689 9:89922406-89922428 CCTGCCTCACTGGAGCTTGGTGG + Intergenic
1057266649 9:93621925-93621947 GGTGCACCACAGGAGCTGAAGGG - Intronic
1058055490 9:100444507-100444529 ACAACCTCACAGAAGCTGAATGG - Intronic
1060150558 9:121285641-121285663 CCTGCCACTGAGGAGCTGAGTGG - Intronic
1060428343 9:123525593-123525615 CCTGCTCTACAGGAGCTAAAGGG + Intronic
1060526059 9:124321957-124321979 CCTGCCTCACAGAAGGAGCAGGG + Intronic
1061803829 9:133127408-133127430 CCTGCCCAACAGGAGGTGACAGG - Intronic
1061853089 9:133427553-133427575 TCTGCATCACAGGAGCAGAAGGG - Intronic
1061868889 9:133509700-133509722 CCAGCCTCACACGAGCTGCCGGG + Intergenic
1062162200 9:135086923-135086945 CCTGGACCTCAGGAGCTGAAGGG - Intronic
1062581867 9:137232367-137232389 CCTCCCTCGCAGGAGCAGGAGGG - Intronic
1185553631 X:1003293-1003315 CCTGCAGCACATGAGCAGAAAGG - Intergenic
1186438348 X:9563376-9563398 CCTTCCTCACAGGAACTCAAGGG - Intronic
1186817991 X:13256742-13256764 CCTGCCTAGCAACAGCTGAAGGG - Intergenic
1188110479 X:26192369-26192391 CCTGCGTAACAGTAGCTGCAGGG - Intergenic
1189335433 X:40168278-40168300 TCTGCCTCCCAGGAGCTGTCCGG - Intronic
1195402911 X:104480896-104480918 CCTGACTGACAGCAGCAGAAAGG - Intergenic
1196832016 X:119783204-119783226 CCTGCCTCTCAGTAGGTCAAGGG + Intergenic
1197287106 X:124608579-124608601 GCTGCTTCCCAAGAGCTGAATGG + Intronic
1197856392 X:130918012-130918034 CCTGCCTCACAGAAGTTGGAAGG - Intergenic
1198010756 X:132551238-132551260 CATGCCTCTTAGGAGCTGAGGGG + Intergenic
1198637540 X:138715888-138715910 CAGGCCTCAGAGGAGCTGTAAGG + Intronic
1200793701 Y:7321596-7321618 CCTGCCCCTCAGCAGCTGAGTGG - Intergenic