ID: 961048414

View in Genome Browser
Species Human (GRCh38)
Location 3:123725775-123725797
Sequence ACTGGGATCCTGCTCCCGAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 86
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 82}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961048414_961048421 23 Left 961048414 3:123725775-123725797 CCAGTCGGGAGCAGGATCCCAGT 0: 1
1: 0
2: 1
3: 2
4: 82
Right 961048421 3:123725821-123725843 TGCTTCCTTCTCATACCACCAGG 0: 1
1: 0
2: 1
3: 21
4: 208

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961048414 Original CRISPR ACTGGGATCCTGCTCCCGAC TGG (reversed) Intronic
902704157 1:18192969-18192991 ACTGGAATCCTGGTCCTCACAGG + Intronic
903603032 1:24556064-24556086 CCTGGGATCCCGCCCCCGCCCGG - Intergenic
906155558 1:43612087-43612109 ACTGCGCTCCTGCTCTCGTCTGG - Intronic
912718390 1:111999333-111999355 ACGGGGATGCTGCTCACGAGAGG + Intergenic
1070255289 10:74808643-74808665 ACTGGGCTCCAGCTCTCCACTGG - Intergenic
1073182485 10:101593208-101593230 CCTTGGATCCCGCTCCTGACAGG + Intronic
1075450921 10:122551527-122551549 ACTGGGCTCCTGCTCAGAACCGG + Intergenic
1084794568 11:71496542-71496564 TCTGGGATCCAGATCCTGACAGG + Intronic
1085158227 11:74315940-74315962 ACTGGGATGCTGCTGCCCCCAGG + Intergenic
1088597020 11:111448499-111448521 TGTGGGGTCCTGCTCCGGACAGG - Intronic
1089502684 11:118941491-118941513 CCTGGGATACTGCTCCCTCCTGG + Intronic
1090849891 11:130562759-130562781 ACAGGGATCCACCTCCCGCCTGG - Intergenic
1091700334 12:2654844-2654866 ACCGGGATCCTGCTTCTGACAGG - Intronic
1094717086 12:33023411-33023433 ACTGGTCTCCAGCTCCCAACCGG - Intergenic
1096102624 12:48978830-48978852 TCTGGGATCCGTCTGCCGACAGG + Intronic
1096577941 12:52566213-52566235 ACTGGGAGCCTGATCCCAAGAGG - Exonic
1098088152 12:66870678-66870700 ACTGGGTTCATGCTTCTGACAGG + Intergenic
1104744196 12:131200915-131200937 TCTGGGATCCTCCTCCTCACAGG + Intergenic
1104790183 12:131476308-131476330 TCTGGGATCCTCCTCCTCACAGG - Intergenic
1110706785 13:78607177-78607199 ACTGACATCCTCCTTCCGACCGG + Intergenic
1115444514 14:33474062-33474084 ACTGAGATCCTGCACCCCATAGG + Intronic
1122211976 14:100179171-100179193 GCTGGGGTCCTGCTCCTGCCTGG + Intergenic
1124343392 15:28904344-28904366 CCTGGGATCCAGCTCCAGAAAGG - Intronic
1127921688 15:63499512-63499534 GCTGCGATCCTGCTCCAGCCAGG + Intergenic
1130382037 15:83379443-83379465 ACTCGGATCCCGCACCCCACAGG - Intergenic
1130541317 15:84822542-84822564 GCTGGGATCCAGGTCCCCACTGG + Intronic
1135910409 16:26555592-26555614 AGTGGGGTACTGCTCCCCACTGG - Intergenic
1143180303 17:4980333-4980355 ACTGCTATCCTCCTCCTGACAGG - Exonic
1149007353 17:51819829-51819851 ACTCAAATCCTGCTCCCTACTGG + Intronic
1150451266 17:65270993-65271015 ACGGGGACCCGGCTCCCAACTGG + Intergenic
1150531632 17:65989440-65989462 ACTGTCATCCTGCTCCCTCCTGG - Intronic
1152103041 17:78314077-78314099 ACTGGAAACGTGCTCCCGAGCGG + Intergenic
1156148671 18:34218274-34218296 GCTGGGATCCTGCTCCCTACGGG - Intronic
1156311779 18:35929737-35929759 ACTGGGATCTTGCTGCCTTCAGG - Intergenic
1161155924 19:2731906-2731928 ACAGGGACGCTGCTCCCGAGAGG - Intronic
1161297271 19:3526405-3526427 ACTGGGAGCCAGCTCCCGGGTGG - Intronic
1163287399 19:16357286-16357308 CCTAGTATCCTGCTCCCCACAGG - Intronic
1168102024 19:54146353-54146375 TCTGGGAACCTGCTCTCCACAGG - Intronic
931235572 2:60410147-60410169 ACTGGGAAACTGCTCTCCACTGG + Intergenic
948893255 2:240917019-240917041 ACTGGGCTGCTGCTCCCAAGGGG + Intergenic
1169003288 20:2184148-2184170 ACAGGGACTCTGCTCCCGATTGG + Intergenic
1176239428 20:64069092-64069114 TCTGGGATCCTGTTCCCACCTGG + Intronic
1176340776 21:5693193-5693215 ACTGGCCTCCTGCTCCCCAAAGG - Intergenic
1176473030 21:7125346-7125368 ACTGGCCTCCTGCTCCCCAAAGG - Intergenic
1176504051 21:7631263-7631285 ACTGGCCTCCTGCTCCCCAAAGG + Intergenic
1179123141 21:38567218-38567240 ACTGGGTTCCTGCACCCCTCAGG - Intronic
1179218718 21:39388458-39388480 ACTGGGAAACTCCTCCAGACAGG - Intronic
1179906964 21:44427497-44427519 CCTGGCATCCTGTTCCCCACAGG + Intronic
1180082670 21:45493870-45493892 CCTGGGCTCCTGCACCCCACAGG - Intronic
1180887690 22:19258826-19258848 ACTGGCCTCCTGCTCCCCAAAGG - Intronic
1183619317 22:38963536-38963558 CCTGGGCTCCTTCCCCCGACTGG - Intronic
1183624464 22:38993131-38993153 CCTGGGCTCCTTCCCCCGACTGG - Intergenic
1184865012 22:47197426-47197448 TCCGGGATCCTGCTCCTGCCTGG + Intergenic
1203240041 22_KI270733v1_random:7651-7673 ACTGGCCTCCTGCTCCCCAAAGG - Intergenic
1203324930 22_KI270738v1_random:4646-4668 ACTGGGCTCCAGCACCGGACTGG - Intergenic
955958400 3:64313825-64313847 ACTGGGTTCCTGGTGCTGACTGG - Intronic
956848125 3:73202682-73202704 ACTGGGCCCCTGCTCCAGGCAGG + Intergenic
960592513 3:119379321-119379343 ACTGAGGTCCTGCTCCAGCCTGG - Intronic
961048414 3:123725775-123725797 ACTGGGATCCTGCTCCCGACTGG - Intronic
961478140 3:127161357-127161379 ACTGGGCTCCTGCTCCATCCTGG + Intergenic
967016861 3:185490084-185490106 CCTGTGATCCTGCACCCCACAGG - Exonic
973631419 4:52824377-52824399 ATTGTGATGCTGCTCCCGCCTGG - Intergenic
973766782 4:54170062-54170084 TCTGGGATCCTGGCCCCTACTGG + Intronic
979050357 4:115921998-115922020 ACTGGCATCCTGCTCCACAAAGG - Intergenic
985712599 5:1438017-1438039 ACTGGCATCCTGCGCTTGACAGG + Intronic
985725622 5:1514478-1514500 ACTGGGAGTCTGCTCCGCACTGG + Intronic
987534728 5:19169574-19169596 ACTGGGCTCCTGCTTCCAATTGG - Intergenic
999256468 5:150212365-150212387 GGTGGGATCCTACTCCAGACAGG - Intronic
1001055573 5:168446991-168447013 TCTGGGATCCTGTTTCTGACCGG + Intronic
1001102451 5:168825336-168825358 ACTGGAATCCTGCTTTGGACTGG - Intronic
1002835413 6:861384-861406 ACTGGGATCCTGTTCCCACATGG + Intergenic
1014459886 6:121683544-121683566 ACAGGGCTCCTTCTCCCAACAGG - Intergenic
1015084996 6:129279839-129279861 ACAGGGATACTGCTCTCCACTGG + Intronic
1016036302 6:139386975-139386997 ACTGTGATTTTGCTCCAGACTGG + Intergenic
1021957747 7:25843153-25843175 ACCTGGATCCTGCTCTCGAGGGG - Intergenic
1027826180 7:83119097-83119119 TCTGGGAACCTGCTGCCTACTGG + Intronic
1038151507 8:24945026-24945048 ACTGGGATCCTGCTGACCATAGG + Intergenic
1041499214 8:58521618-58521640 ATTGGTATCGTGCTCCTGACAGG - Intergenic
1044528663 8:93282446-93282468 ACTGGGATTCTTCTCCAGACAGG - Intergenic
1062154731 9:135040479-135040501 GCTGGGCTCCTGCTCACTACTGG - Intergenic
1062155768 9:135047265-135047287 CCTGGGGTGCTGCTCCCCACGGG - Intergenic
1062623928 9:137434560-137434582 ACAGGGGTCCTGCTCCTGATGGG - Exonic
1203422291 Un_GL000195v1:4800-4822 ACTGGCCTCCTGCTCCCCAAAGG + Intergenic
1185990393 X:4888946-4888968 ACTGGGAACCTGCCTCCCACTGG + Intergenic
1192795179 X:74420580-74420602 ACTGAGCTTCGGCTCCCGACTGG + Intergenic
1196671649 X:118374575-118374597 AATGGGATCCTGCTTGCAACTGG - Intronic