ID: 961049501

View in Genome Browser
Species Human (GRCh38)
Location 3:123734470-123734492
Sequence ACGGAGGCACTAGTAGAGAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 1, 3: 2, 4: 99}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961049501_961049505 -3 Left 961049501 3:123734470-123734492 CCCTTCTCTACTAGTGCCTCCGT 0: 1
1: 0
2: 1
3: 2
4: 99
Right 961049505 3:123734490-123734512 CGTAGTTCAACCTCTGCCACCGG 0: 1
1: 0
2: 0
3: 5
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961049501 Original CRISPR ACGGAGGCACTAGTAGAGAA GGG (reversed) Intronic
900392344 1:2439148-2439170 ACTGAGGCACAAAGAGAGAAAGG - Intronic
901216661 1:7559053-7559075 AAGGAGCCACCAGGAGAGAAAGG + Intronic
902497910 1:16887188-16887210 AAGGAGGGACCAGTAGGGAAGGG + Intronic
903109608 1:21119739-21119761 ACGGAGGCTATAAAAGAGAAAGG + Intronic
908336648 1:63132315-63132337 ACAGAGGCAGTAGAAGAAAACGG + Intergenic
909150413 1:71995407-71995429 AGGGAGCCACTATCAGAGAAAGG + Intronic
912438487 1:109679611-109679633 ACTAAGCCACCAGTAGAGAATGG - Intronic
912996475 1:114536754-114536776 AGGGAGGCCCTGGGAGAGAAGGG + Intergenic
915739347 1:158106664-158106686 AAGGAGGCGCTAGCAGAGACGGG + Intergenic
919943356 1:202303461-202303483 ATGGAGCCAGTAGTAGAGACAGG - Intronic
920754566 1:208716787-208716809 ACTGAGGCACTCTTTGAGAAAGG - Intergenic
921233550 1:213099100-213099122 AAGGATACACAAGTAGAGAATGG + Intronic
924287829 1:242506559-242506581 ACCCAGGCACTGGTAGAGAGGGG + Intronic
1065818846 10:29506826-29506848 ACAGAGGCCCTAGGAGGGAAGGG + Intronic
1067368665 10:45661398-45661420 ATGGAGGGGCTAGTGGAGAAAGG - Intronic
1070527401 10:77307100-77307122 ACTGAGGCAGTAGTAGAGCTTGG - Intronic
1070670141 10:78372065-78372087 ACTGAGGCCCAAGAAGAGAAAGG - Intergenic
1076484277 10:130805805-130805827 AGGGAGGCACCAGCAGAGATAGG + Intergenic
1083381964 11:62276518-62276540 CAGGAGGCAGGAGTAGAGAAGGG - Intergenic
1086371725 11:86162101-86162123 ACGTGGGCAGTAGTAGAGAGTGG + Intergenic
1087058988 11:93960226-93960248 ACGGAGGCACTTGGAGAGAAGGG + Intergenic
1090555214 11:127867286-127867308 ACGCAGGCACAAACAGAGAAGGG + Intergenic
1090819326 11:130326820-130326842 AATGAGGCACTAGTAGAAGAGGG - Intergenic
1098699036 12:73599097-73599119 TAGGAGGCAGTAGCAGAGAAAGG + Intergenic
1099532341 12:83799852-83799874 ACGTAGGCACCACTAGACAACGG + Intergenic
1105869713 13:24493875-24493897 AGGGAGGATCTAGTAGAGAAAGG - Intronic
1109137323 13:58669935-58669957 ACAGAGGCAATAGTACAGACAGG + Intergenic
1111104097 13:83623222-83623244 ATGGAGGCATTAGTAGAGCAAGG + Intergenic
1115838529 14:37438538-37438560 AGGGAGGCATGAGTAGAGGAAGG - Intronic
1117390810 14:55260667-55260689 ATGGAGGAAATAGTTGAGAAAGG + Intergenic
1123114799 14:105889833-105889855 ACAGAGGCACTGGGAGGGAATGG + Intergenic
1128149508 15:65354423-65354445 ACGGAGGCGGTGGTAGAAAAAGG - Intronic
1130772187 15:86935627-86935649 ACAGAGCCACCAGTAGAGCATGG - Intronic
1130953574 15:88611155-88611177 GGGGAGGCACCAGTAGAGAGGGG + Intergenic
1148324360 17:46774474-46774496 ATGGAGGCCCTGGTAGACAAAGG - Intronic
1148474117 17:47915975-47915997 ATGGAGAAACCAGTAGAGAAGGG + Intronic
1149155268 17:53621766-53621788 AAGGAGGCACGGGAAGAGAATGG + Intergenic
1151028675 17:70709465-70709487 AAGGACGCTCTAGAAGAGAATGG - Intergenic
1154026912 18:10716551-10716573 AAGGAGGCACAGGAAGAGAACGG + Intronic
1156018674 18:32575367-32575389 ACTGTGGGACTAGTAAAGAAAGG - Intergenic
1158756263 18:60329384-60329406 AAGGAAGCACTGGTGGAGAAAGG - Intergenic
1159049518 18:63406394-63406416 ACGAAGACACTAGTATAGCAAGG + Intronic
1162718540 19:12648341-12648363 TCGGAGCCACTAATGGAGAACGG - Exonic
925741664 2:7010234-7010256 GTGGAGGCACTGGGAGAGAAAGG + Intronic
927275225 2:21256857-21256879 ACGGACTCTCTACTAGAGAAGGG + Intergenic
928133064 2:28667322-28667344 AAGGAGGCACTGGGAGAGGAGGG - Intergenic
928217439 2:29373695-29373717 AGCTAGGCACTGGTAGAGAAAGG + Intronic
933329923 2:80880348-80880370 GCAGAGGCACTGGTAGAGAGAGG + Intergenic
935094879 2:99934741-99934763 ACAGAGGCACTAATAGAAGACGG - Intronic
936283746 2:111164759-111164781 AGAGAGGCAATAGTAGGGAAGGG - Exonic
937170359 2:119859839-119859861 CCGTGGACACTAGTAGAGAAGGG + Intronic
939887237 2:147694263-147694285 ACAGAGGCACTAGGAGTGCAGGG - Intergenic
944800367 2:203232634-203232656 ACAGAGGCACTGCAAGAGAAAGG - Intergenic
945375277 2:209072625-209072647 AAGGAAGCACTACCAGAGAAAGG + Intergenic
1173346099 20:42201540-42201562 ACTGAGGCACTAGTATATTATGG - Intronic
1175878498 20:62242923-62242945 ACGGAGGCAGCTGTAGAGGAAGG + Intronic
1179291426 21:40021274-40021296 ACAGAGTCACAAATAGAGAAGGG + Intronic
1181875147 22:25934888-25934910 ACGGAACCACGAGTAGTGAAAGG - Intronic
1183818892 22:40327962-40327984 AAAGAAGCACTAATAGAGAAAGG + Exonic
953012296 3:39038921-39038943 ATGGAATCGCTAGTAGAGAAAGG - Intergenic
958579680 3:96001773-96001795 AGAGAGGCAATAGAAGAGAAAGG - Intergenic
961049501 3:123734470-123734492 ACGGAGGCACTAGTAGAGAAGGG - Intronic
962129221 3:132654749-132654771 ACATAGGCATTAATAGAGAAGGG - Intronic
962418884 3:135209832-135209854 GGAGAGGCACTAGTAGAGACAGG + Intronic
966932390 3:184684366-184684388 GTGGAGGCACTAGTAGGGTAGGG - Intronic
968431213 4:560217-560239 GTGGAGCCACTAGCAGAGAAGGG + Intergenic
969717030 4:8872700-8872722 ACGGAGGCACAACGAGGGAAGGG - Intergenic
975924037 4:79427361-79427383 AGGGAGGCACTAGTGGAAGATGG - Intergenic
979045685 4:115859825-115859847 TCTAAGGCACTAGAAGAGAAAGG + Intergenic
989366308 5:40659558-40659580 AAGGGGGCAAGAGTAGAGAAGGG + Intergenic
989952633 5:50317764-50317786 ATGGAAGAAATAGTAGAGAAAGG + Intergenic
998540669 5:142978466-142978488 ACCGAAGCACCAGTATAGAATGG + Intronic
1002346194 5:178548654-178548676 CCAGAGGCTCTAGTAAAGAATGG - Intronic
1004477284 6:15985511-15985533 ACTAAGGCACTAGTACACAATGG + Intergenic
1007576594 6:42929231-42929253 ACGGAGGCTCTGGGAGAGAGAGG - Exonic
1008336105 6:50306684-50306706 ACAGATGAACTAGAAGAGAAGGG - Intergenic
1009937340 6:70249436-70249458 TGGGAGACACTGGTAGAGAAAGG + Intronic
1011003353 6:82616366-82616388 AGGGAGCAACTATTAGAGAAAGG + Intergenic
1013043044 6:106455828-106455850 ACACATGCACTAGTAGAAAATGG - Intergenic
1013761911 6:113528744-113528766 TCAGAGGCACTAGGAGAGGATGG + Intergenic
1015597075 6:134875950-134875972 AGGGAGGTATTAGTAGAGGAGGG - Intergenic
1023219285 7:37902050-37902072 ACTGAGCCAGTACTAGAGAATGG - Intronic
1025871083 7:65434876-65434898 TCGGAGCCACTAGTGTAGAAAGG - Intergenic
1026390280 7:69894312-69894334 ACACAAGCACTAGGAGAGAAAGG - Intronic
1026994912 7:74609311-74609333 ACGTAGGCGCTAGGATAGAACGG - Intergenic
1031873230 7:127109973-127109995 CCGGAGGCACTAGCAGAACATGG + Intronic
1033625104 7:143103296-143103318 CTGGAGGCTCTAGGAGAGAATGG + Intergenic
1035124141 7:156595610-156595632 ATGGCAGCACTAGAAGAGAAAGG + Intergenic
1037306127 8:17505470-17505492 ACCATGGCACTAGTTGAGAAGGG - Intronic
1041359307 8:57034294-57034316 ATGGTGGCCATAGTAGAGAAAGG - Intergenic
1041364769 8:57090591-57090613 TTGGAGGAACTAGTAAAGAAAGG + Intergenic
1041856535 8:62462206-62462228 ATGGAAGCATTAGAAGAGAAAGG - Intronic
1042282122 8:67065697-67065719 GCAGTGGCATTAGTAGAGAAGGG + Intronic
1047647833 8:126887260-126887282 ACAGAGGCACAAGTAGAGGGAGG - Intergenic
1050848694 9:10257351-10257373 GAGGAGGTACTGGTAGAGAAAGG + Intronic
1051290376 9:15539363-15539385 AAGGAAGCACTATTACAGAAAGG - Intergenic
1062552403 9:137095601-137095623 ACTGAGGCCATAGGAGAGAATGG + Intronic
1186358314 X:8811063-8811085 ACGGAGGCACAGGTTGATAAAGG + Intergenic
1190441249 X:50476525-50476547 AGGGAGGAACGAATAGAGAAAGG + Intergenic
1190916719 X:54816641-54816663 AGGGAGGCCCCAGTAGAGGATGG + Intergenic
1192317812 X:70066153-70066175 AGGGAGGCACTGGCAGAGGAAGG + Intergenic
1197144856 X:123160055-123160077 ACGGAAGCATTTGTTGAGAAAGG + Intergenic
1199551337 X:149064767-149064789 CCAGAGGGAATAGTAGAGAAAGG + Intergenic