ID: 961050012

View in Genome Browser
Species Human (GRCh38)
Location 3:123737979-123738001
Sequence AACAGGGCAGTGAGGATCCT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 274
Summary {0: 1, 1: 0, 2: 3, 3: 30, 4: 240}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961050012 Original CRISPR AACAGGGCAGTGAGGATCCT AGG (reversed) Intronic
900331865 1:2138971-2138993 AACCGGGCAGTGAGGACCAGAGG + Intronic
900372761 1:2339607-2339629 GGCAGGGCAGTGGGGAGCCTTGG - Intronic
900945375 1:5828294-5828316 AACAGGGCTGGGAGGCTGCTGGG + Intergenic
902338721 1:15768638-15768660 CACAGGGCTGAGAGGATACTGGG + Intronic
902695155 1:18135156-18135178 AACAGGTCAGTGAGGCATCTTGG - Intronic
903156915 1:21451667-21451689 AACAGGGCATAGTGGGTCCTGGG + Intronic
905243240 1:36595072-36595094 AAGAGGGAAGTGAGGAGCCTTGG + Intergenic
907326574 1:53642138-53642160 AACAGGGCAGTGTGTTGCCTTGG - Intronic
907594157 1:55704299-55704321 AACAGGGGAGTGACTGTCCTCGG - Intergenic
908454549 1:64290132-64290154 AACAGGGGAGTCAGGGTTCTAGG + Intergenic
910721489 1:90291425-90291447 GAGATGGCAGTGGGGATCCTGGG - Intergenic
915635914 1:157186454-157186476 AACAGGGCAGGGAGGAACCATGG - Intergenic
916691445 1:167193852-167193874 AACAGGGCAGTGCTCAGCCTAGG - Intergenic
917046917 1:170871085-170871107 AACAGAGCAGTGAGGAGCACTGG + Intergenic
920764436 1:208818222-208818244 AACATGGCAGAGAAGATTCTAGG - Intergenic
920845861 1:209592527-209592549 AACAGGGCAGTGAGGAATCATGG - Intronic
922417895 1:225438580-225438602 AAGAGGGCTGAGAGGAGCCTGGG - Intergenic
1062932847 10:1363929-1363951 AACAGACCAGTCAGGAGCCTGGG + Intronic
1064426861 10:15237077-15237099 AAGAGGGCCTTGAGGCTCCTGGG + Intronic
1064927529 10:20585570-20585592 ATGAGGGCAGTAAGCATCCTGGG - Intergenic
1067443176 10:46323909-46323931 CACAGGATATTGAGGATCCTGGG - Intronic
1069772380 10:70907936-70907958 AGAAGGGCTGTGAGGAGCCTGGG - Intergenic
1069917336 10:71795739-71795761 AGCAGGGCAGGGAGGATGGTGGG - Intronic
1070790650 10:79187376-79187398 AGCTGGGCAGTGAGGTTGCTGGG - Intronic
1070840335 10:79482392-79482414 AACAGAGCAGAGAGAATGCTGGG + Intergenic
1071441473 10:85701269-85701291 AGCAGAGCTGTGAGGAACCTAGG - Intronic
1071445066 10:85738003-85738025 AGCAGGACAGTCAGGATCCCCGG + Intronic
1072784525 10:98270613-98270635 CACAGGGCTGTGTGGATGCTGGG + Intergenic
1073185871 10:101614720-101614742 AACAGAGCCTTGAGGGTCCTGGG - Intronic
1073700911 10:105925667-105925689 GGCAGGGGAGTGAAGATCCTTGG - Intergenic
1075023259 10:118966625-118966647 ATCTAGGCAGTGGGGATCCTGGG - Intergenic
1076132038 10:128019853-128019875 ATCTGGGCAGTGAGGATGGTTGG + Intronic
1077328063 11:1972165-1972187 GACAGGGCAGTAAGTATCCGGGG + Intronic
1078337727 11:10477097-10477119 AACTCGGCAGTGAGGATACCTGG + Intronic
1079931750 11:26572224-26572246 AGCAGGTCAGTCAGGTTCCTGGG - Intronic
1080122519 11:28693683-28693705 AAGAGGGTGGTGAGGATTCTGGG + Intergenic
1080663394 11:34315263-34315285 ACCAGGGCACTGAGGTTCCTGGG + Intronic
1083641487 11:64148145-64148167 AGCAGGGCCCTGGGGATCCTTGG - Intronic
1084564734 11:69922401-69922423 AGCAGGGCAGTGAGTGTCCCAGG + Intergenic
1084603947 11:70162002-70162024 CCCTGGGCAGTGAGGACCCTGGG + Intronic
1086325224 11:85691995-85692017 AAGTGGGTGGTGAGGATCCTGGG - Intergenic
1087553663 11:99686895-99686917 AGCTGTGGAGTGAGGATCCTGGG - Intronic
1087821589 11:102718599-102718621 AACAGCTCAGTGTGGATCCCAGG + Intronic
1089579793 11:119474557-119474579 AAAAGGCAAGTGAGGATTCTAGG - Intergenic
1089633186 11:119796181-119796203 ACCAGGGCAGTGAGGCACCAAGG + Intergenic
1090853053 11:130587362-130587384 AACATGGCGGTTAGGATCCATGG + Intergenic
1202811042 11_KI270721v1_random:27345-27367 GACAGGGCAGTAAGTATCCGGGG + Intergenic
1094835194 12:34318957-34318979 ACCAGGGATGTGAGGATCCCTGG + Intergenic
1094871282 12:34600516-34600538 CACAGGGCCCAGAGGATCCTGGG + Intergenic
1095255547 12:40031598-40031620 ACCAAGGCAGAGAGGATGCTCGG + Intronic
1095399450 12:41797730-41797752 AAAATGGGAGTGAGGATTCTGGG + Intergenic
1096760800 12:53840376-53840398 AAGATGGGAGTGAGTATCCTTGG - Intergenic
1098377175 12:69829294-69829316 AAGAGGGCAGTGGGGATGCAGGG + Intronic
1100172525 12:91991910-91991932 TACAGGGCAGGCTGGATCCTGGG + Intronic
1102416988 12:112772364-112772386 AACAGAGCATTTAGAATCCTTGG + Intronic
1102993933 12:117333884-117333906 AACTGAACAGTGAGCATCCTGGG - Intronic
1103327268 12:120129890-120129912 AACAAGGCAGACAGGATCCCTGG - Intronic
1103981646 12:124740777-124740799 AAGAGGGCAGAGAGAAGCCTTGG + Intergenic
1105252384 13:18711122-18711144 AAGATGGCAGTGGGGATCCTGGG + Intergenic
1106652128 13:31702982-31703004 AACATGGCAGAGAGCATTCTAGG - Intergenic
1108169393 13:47725556-47725578 AACAGCACTGTGAGGACCCTGGG + Intergenic
1108960952 13:56228574-56228596 AATAGTGCAGTGATGAACCTAGG - Intergenic
1112227377 13:97553083-97553105 AAGAGGCCAGAGAGGTTCCTGGG + Intergenic
1114438259 14:22726142-22726164 CACATGGCAGTGTGGAGCCTGGG + Intergenic
1115241386 14:31253735-31253757 AAGAGGGCAGTTAGGTCCCTAGG - Intergenic
1117984587 14:61374719-61374741 TACAGAGCAGTGAGGGCCCTAGG + Intronic
1118488524 14:66236357-66236379 AACAGGCCATTGAGAATCATTGG + Intergenic
1119140925 14:72266377-72266399 AATACAGCAGAGAGGATCCTGGG - Intronic
1122244667 14:100394008-100394030 CACAGGGCTGTGAGGATCAGAGG + Intronic
1123934398 15:25187140-25187162 GACAGGGCCGGCAGGATCCTGGG - Intergenic
1125592062 15:40860852-40860874 AGCTGGGCAGTGGAGATCCTGGG + Intergenic
1127466809 15:59252224-59252246 CACAGGGCAGTGAGCACTCTTGG + Intronic
1128028940 15:64462106-64462128 AAAATGGCACTGAGGAGCCTGGG - Intronic
1128407192 15:67354748-67354770 AATTGGGAAGTGAGGAGCCTAGG + Intronic
1128550962 15:68597728-68597750 ACAAGGGCAGAGAGGAACCTCGG + Intronic
1128613218 15:69090143-69090165 AAGTGGGCAGTGAGGACCCTAGG - Intergenic
1128680381 15:69647259-69647281 AGCAGGGCAGTGGGGATTCCTGG - Intergenic
1128752172 15:70157621-70157643 AACAGGGCAGAGAGGCTAGTTGG - Intergenic
1128772198 15:70290940-70290962 AGCTGGGCAGTGAAGATACTCGG - Intergenic
1129116039 15:73365962-73365984 TACTGGGCCCTGAGGATCCTGGG - Intronic
1129593402 15:76938387-76938409 ATCAGGGAATTGAGTATCCTTGG + Intronic
1131130363 15:89895416-89895438 ATCAGGGCAGTGTGGTTCCAGGG - Exonic
1133921180 16:10154520-10154542 TTCAGGGCACTGAGGATGCTGGG - Intronic
1134045971 16:11101333-11101355 AAGAGGGCAGTGAGGACTGTTGG - Intronic
1135101168 16:19607265-19607287 AAGACAGAAGTGAGGATCCTTGG - Intronic
1135382113 16:22003995-22004017 ATCAGGGCAGGGAGGAACATTGG + Intergenic
1136221936 16:28834707-28834729 AGGAGGGCAGTGAGGATCCAGGG + Intronic
1136355942 16:29744867-29744889 CACAGGGCAGTGAGGGCCATGGG + Exonic
1136513425 16:30753340-30753362 GACAGGGCAGGGAGGAGCCGAGG + Intronic
1137466940 16:48718361-48718383 AACAGGGTGGAGAGGAGCCTTGG - Intergenic
1137524953 16:49226839-49226861 AACAGAGGAAAGAGGATCCTGGG - Intergenic
1137577278 16:49608594-49608616 GACAAAGCGGTGAGGATCCTGGG + Intronic
1138224274 16:55279224-55279246 AGCTGGGCAGTGAGGCTTCTGGG - Intergenic
1141888945 16:86913636-86913658 ATCAGGACAGTGGTGATCCTTGG - Intergenic
1143140328 17:4738958-4738980 AACAGCGGAGTGGGGACCCTGGG - Intronic
1143179869 17:4977833-4977855 AAAAGGGCAGAGATGAACCTTGG + Intronic
1146055603 17:29579259-29579281 AACAGGTGATTGAGGAACCTGGG - Intronic
1146679653 17:34797905-34797927 GATAGAGCAGTGAGGATCCTGGG - Intergenic
1147237133 17:39066200-39066222 AACAGGGCAGTGAGTAAACCCGG + Exonic
1147603630 17:41761206-41761228 CACAGGGCACAGAGGATTCTGGG - Intronic
1148079644 17:44960547-44960569 AAAGGGGCAGAGAGGATCCCTGG + Intronic
1148749501 17:49936397-49936419 CAGAGGGCAGTGAGGAGGCTGGG - Intergenic
1150730697 17:67690729-67690751 AACAGGGAAAAGAGGAACCTGGG - Intronic
1152350520 17:79781751-79781773 GACATGGCAGTGAGCTTCCTTGG - Exonic
1152585565 17:81188053-81188075 GACAGGGCAGTGCGGGTCCCCGG - Intergenic
1203173773 17_GL000205v2_random:175853-175875 AAGAGGGGAGGGAGGATCCTGGG + Intergenic
1153020224 18:622198-622220 AAGGGGACAGTGAGGATGCTGGG - Intronic
1155275636 18:24184818-24184840 CACAGGGCAGTGAGAATGCAGGG - Intronic
1155651115 18:28143268-28143290 GACATTGCAGAGAGGATCCTGGG - Intronic
1156482392 18:37444506-37444528 AGCAGGGCAGTGGGAATCTTTGG - Intronic
1156493399 18:37510255-37510277 AACTGTGCACTGAGGATTCTGGG - Intronic
1157615361 18:48984104-48984126 AACAGGCCAGTGAGCAGCCTGGG + Intergenic
1158104311 18:53868064-53868086 AGGAGGCCAGTGAGGATCTTTGG - Intergenic
1161709478 19:5839803-5839825 AACAGGGCAGTCGTGATACTTGG - Intergenic
1162043389 19:7983845-7983867 CCCAGGGCAGTGACCATCCTAGG - Intronic
1162786516 19:13038360-13038382 AACAGGCCACTGCGGCTCCTGGG + Intronic
1162798960 19:13100819-13100841 AACAGGTCAGTGGGGATCTGGGG - Exonic
1162946418 19:14046591-14046613 AACAGAGCACTGAGGTTCCCAGG - Exonic
1164427583 19:28155790-28155812 AAGAGGGGAGTGAGGTCCCTTGG + Intergenic
1164526057 19:29014526-29014548 AGGAGGACAGTGAGGTTCCTGGG - Intergenic
1164578471 19:29419586-29419608 CACAGTGCAGGGAGGACCCTGGG + Intergenic
1164776918 19:30859843-30859865 AACAGGCCAGTGAGTATGCAGGG + Intergenic
1165694968 19:37894124-37894146 AACAGAGCAGAGAGTTTCCTTGG + Exonic
1165790087 19:38486080-38486102 GACAAGGCACTGAGGATGCTGGG + Exonic
925455817 2:4015744-4015766 AACAGGGCAGGGAGGACACAGGG + Intergenic
927096000 2:19748001-19748023 GGCAGGGCAGTGAGAAGCCTGGG - Intergenic
927199758 2:20571026-20571048 GACAGGGCAGTGAGGACACTGGG + Intronic
928976071 2:37087745-37087767 CAGAGGGCAGTGAGGAGCCATGG + Intronic
929878515 2:45816755-45816777 AACAGGGCAGTGAGAAGGCTGGG - Intronic
932587016 2:73036690-73036712 AAAAGGGCAGAGCGGAGCCTGGG + Intronic
935373531 2:102372256-102372278 AACAAGCCAGTGAGGATACTTGG - Intronic
935415088 2:102806890-102806912 ACCAGGGCAGTCAGAATCCAGGG + Intronic
936474670 2:112829674-112829696 AACAGGGCTGTGAGAGTTCTTGG - Intergenic
936508995 2:113130600-113130622 AACTGGGTAGTGTGCATCCTGGG + Intronic
936509010 2:113130686-113130708 AACTGGGTAGTGTGCATCCTGGG + Intronic
936509025 2:113130772-113130794 AACTGGGTAGTGTGCATCCTGGG + Intronic
937121232 2:119441193-119441215 AGCAGGGCAGTCAGGAACCTGGG + Intronic
937322246 2:120967861-120967883 AACAGGGCAGGGAGGACACGAGG - Intronic
937726094 2:125168267-125168289 AGGAGGGCTGTGGGGATCCTGGG + Intergenic
938124961 2:128664754-128664776 AGGAGGGCAGTGAGGAAGCTGGG + Intergenic
938244330 2:129765449-129765471 TACAGGGCAGTAAGGCTCTTTGG + Intergenic
938711604 2:133980095-133980117 AAGAGGGCAGTTAGGATTGTCGG - Intergenic
938978327 2:136501120-136501142 CACTGGGCAGTCAAGATCCTGGG - Intergenic
941136433 2:161723133-161723155 CACAGGGCTGTGAGGACTCTCGG - Intronic
942514870 2:176741578-176741600 AACAGGGGAGCAAGGATCCTAGG + Intergenic
944479788 2:200144740-200144762 CACAGAGCAGTGAGGGCCCTAGG + Intergenic
945046539 2:205786959-205786981 AATGGGGCAGTGAGCATCATGGG + Intronic
946030391 2:216699173-216699195 AACAGTGCAGTGCCGATGCTGGG - Intergenic
946923116 2:224599592-224599614 AGCAGGGCAGTCAGGAACATGGG - Intergenic
947739311 2:232477899-232477921 GACAGCCCAGTGTGGATCCTAGG + Intergenic
947796357 2:232896494-232896516 AACAGAGCAGTGAGGAGCCTGGG + Intronic
947909028 2:233789696-233789718 CACAGGGCTGTGGGCATCCTGGG - Intronic
948954075 2:241273227-241273249 TACAGCGCAGTGAGGCTCCCAGG + Intronic
1168926760 20:1588036-1588058 CACAGGGGAGGGAGGATCATGGG + Intronic
1169832219 20:9838015-9838037 AACTGAGCAGTGATGATCCCTGG + Intronic
1170818545 20:19736073-19736095 GACAGGGCAGTGAGGAGTTTTGG + Intergenic
1171200990 20:23242092-23242114 GAGAGGGCAGAGAGGAGCCTTGG + Intergenic
1171386557 20:24773283-24773305 CACAGCGCAGTGTGGATCCTTGG - Intergenic
1173830720 20:46085454-46085476 AACAGAGCAGAGAGGAGACTAGG + Intronic
1174417093 20:50374677-50374699 AACAGCGCAGCCAGGATCCAAGG + Intergenic
1174860671 20:54088185-54088207 GTCAGGGCTGTGAGCATCCTCGG - Intergenic
1174863851 20:54116595-54116617 AACAGGGCGGGGAGGCCCCTGGG + Intergenic
1175515464 20:59567223-59567245 CCCAGGGCAGTGTGGCTCCTTGG + Intergenic
1176329762 21:5537499-5537521 AAGAGGGGAGGGAGGATCCTGGG + Intergenic
1176397995 21:6283452-6283474 AAGAGGGGAGGGAGGATCCTGGG - Intergenic
1176439162 21:6705652-6705674 AAGAGGGGAGGGAGGATCCTGGG + Intergenic
1176463424 21:7032721-7032743 AAGAGGGGAGGGAGGATCCTGGG + Intergenic
1176486985 21:7414500-7414522 AAGAGGGGAGGGAGGATCCTGGG + Intergenic
1176837912 21:13811009-13811031 AAGATGGCAGTGGGGATCCTGGG + Intergenic
1176990938 21:15495745-15495767 CACAGGGAAGTGAGGATCCCTGG + Intergenic
1178172142 21:30053362-30053384 AAGATGGCAGAGAGGATGCTAGG - Intergenic
1179233996 21:39529087-39529109 GTGAGGGCTGTGAGGATCCTGGG + Intergenic
1179488076 21:41723394-41723416 CACAGGGCAGCGAGTATGCTTGG - Intergenic
1179659629 21:42865942-42865964 AACAGGGCACTGAGGACACCAGG + Intronic
1180087715 21:45515518-45515540 CACAGGGCAGGGGGAATCCTAGG + Exonic
1181202759 22:21227456-21227478 AACAGGGCAGGGAGGAGGCAGGG - Exonic
1182215253 22:28711292-28711314 AATATGGCAGTGAGTATCCCTGG - Intronic
1183464928 22:37974884-37974906 AACAGAGCACTCAGGAGCCTGGG - Intronic
1184274174 22:43400705-43400727 AACAAAGCACTGAGGATGCTGGG + Intergenic
950127999 3:10522418-10522440 CACAGGGAAGAGAGGATCCCAGG - Intronic
950450636 3:13063169-13063191 AACAGGGCAGTGGGGAAGCCAGG - Intronic
954152765 3:48665954-48665976 AACAGGGCAGGGAGTTTCCGTGG - Intergenic
955225967 3:57060640-57060662 GGCAGGGCAGTCAGGACCCTGGG - Exonic
955636084 3:61030950-61030972 AACAGAGGAGTATGGATCCTGGG + Intronic
956619837 3:71210805-71210827 GACAGGACAGTGAGGATACCAGG - Intronic
961050012 3:123737979-123738001 AACAGGGCAGTGAGGATCCTAGG - Intronic
961166428 3:124766835-124766857 CACAGGGCAGTGAGGACACTGGG + Intronic
962681834 3:137808402-137808424 AAAAGGCCAGTGGGGAACCTTGG - Intergenic
963044022 3:141089340-141089362 AACAGTGCAGTAAGGACCCCAGG + Intronic
965851112 3:173025932-173025954 TACAGGGGAGTGAGAATACTGGG + Intronic
966164821 3:177005949-177005971 CACATGGCAGTGGGGATCCTGGG - Intergenic
966679512 3:182626528-182626550 CTCAGGGCAGTGAGGATCAATGG + Intergenic
968816725 4:2825217-2825239 TACCGGGCAGTGAGGGTCCCTGG + Intronic
970854989 4:20640704-20640726 AACAGGGCAGAGAGGAAGGTTGG - Intergenic
971057967 4:22934966-22934988 ATCATGGCAGTGAGGTTGCTGGG + Intergenic
978197582 4:105989233-105989255 CACAGGGCTATGAGAATCCTGGG + Intronic
978555408 4:109974162-109974184 ATCAGGGAATTGAGCATCCTTGG + Intronic
978900467 4:113943331-113943353 CTCAGGGCAGTCATGATCCTAGG - Intronic
981550170 4:145936022-145936044 AACAGGGCGGTGAGGTTATTTGG - Intronic
981874745 4:149528644-149528666 AACATGGCAATGAGGATTCTGGG + Intergenic
983051487 4:163052846-163052868 TACAGTACAGTTAGGATCCTAGG - Intergenic
984493183 4:180462122-180462144 AACAGGGAAGGGTGGATCCATGG - Intergenic
986145126 5:5070942-5070964 AGCAGGGCAGTGAGGCTCAGGGG - Intergenic
986387378 5:7247875-7247897 AAAAGGTCACTGTGGATCCTGGG + Intergenic
987465723 5:18269688-18269710 AGCTGGGCAGAGAGGATTCTTGG + Intergenic
990303434 5:54472252-54472274 AACAGGGCAGAGAAGATCAGAGG - Intergenic
991007843 5:61847416-61847438 AACATGGCAATGAGGATACCAGG + Intergenic
996949003 5:129102364-129102386 CCCAGGGCAGTGAGGATTTTAGG + Intronic
998278604 5:140783041-140783063 GCCAAGGCAGTCAGGATCCTGGG - Intergenic
999357289 5:150947171-150947193 AAGAGGGAAGTGGGGAGCCTGGG + Intergenic
1004203710 6:13573155-13573177 CAAAGGGCAGTGAGGATCCCGGG + Intergenic
1006301623 6:33196458-33196480 ACCAGGGCGTTGAGGGTCCTGGG - Exonic
1006781775 6:36637133-36637155 AACAGGGCAGAGAGGAGGCATGG - Intergenic
1007939836 6:45770052-45770074 AAGAGGCCAGTGAGGATGCAGGG + Intergenic
1012625817 6:101402377-101402399 AACAGGACAGAGACGCTCCTGGG - Intronic
1013738588 6:113257114-113257136 ATCAGGACAGTGGGTATCCTTGG + Intergenic
1013827219 6:114228688-114228710 AACAGGTCAGGGAGACTCCTGGG + Exonic
1014585709 6:123195138-123195160 AACAAGGCAGGGTGGATGCTAGG + Intergenic
1016199077 6:141385701-141385723 AACATGGCAGTGAATTTCCTTGG - Intergenic
1019311371 7:362933-362955 AACATGGCAGTGAGGCTCAACGG - Intergenic
1019709207 7:2510681-2510703 AACTGGGCAGTGGGGAGCCAAGG + Intergenic
1019916320 7:4135004-4135026 AGCGGGGCAGTGAGGACCCGGGG - Intronic
1022253231 7:28629437-28629459 AACAGAGCAGAGAGGATCTGGGG + Intronic
1022839349 7:34148123-34148145 ATCAGGGAAGGGCGGATCCTTGG - Intronic
1024509927 7:50195924-50195946 GTCAGGGCCGTGAGGATCCCAGG - Intergenic
1024567303 7:50692218-50692240 ATCAGGGCCTTGAGCATCCTTGG + Intronic
1028276221 7:88861016-88861038 ACCAAGGCAGTCAGCATCCTGGG - Intronic
1028696212 7:93716254-93716276 AGCTGGGCAATGAGGATCCAGGG - Intronic
1029213429 7:98927801-98927823 AACAGCAGAATGAGGATCCTGGG - Intronic
1031923193 7:127615902-127615924 ATCAGGACGGTGAGGAGCCTGGG - Intronic
1033619881 7:143052569-143052591 AACAGGTCTGAGAGCATCCTGGG - Exonic
1034936169 7:155202441-155202463 CACCGGGCAGACAGGATCCTGGG - Intergenic
1035637674 8:1159056-1159078 AACAGAGCAGTGTGGCTCCTGGG - Intergenic
1037837518 8:22223019-22223041 CTCAGGGCAGTGAGGACCTTGGG - Intronic
1038692901 8:29779499-29779521 GCCAGGCCAGTCAGGATCCTGGG + Intergenic
1039600058 8:38828974-38828996 AACATGCCAATGAGGAACCTGGG + Intronic
1039829527 8:41201881-41201903 CACAGGGCTATGAGGATGCTAGG + Intergenic
1040828152 8:51646236-51646258 AAAAGGCCAGTGAGGATGCAGGG + Intronic
1040976451 8:53198847-53198869 AACAGAGCAGAGAGGAGCCCAGG + Intergenic
1041633768 8:60119022-60119044 AAGAGGGCATTTAGGATACTTGG + Intergenic
1042468139 8:69152146-69152168 AACTGGGCAGTCAGGTGCCTAGG - Intergenic
1044955201 8:97472703-97472725 AACAGGGCCGGGAAGATTCTCGG + Intergenic
1046836437 8:118806695-118806717 AAGAGGACAGTGAGAATCCATGG - Intergenic
1047338471 8:123957810-123957832 AACAGGGCAGGGAGGAATCAGGG + Intronic
1047501762 8:125447032-125447054 AACACAGCCGAGAGGATCCTAGG + Intergenic
1048498810 8:134957607-134957629 CACAGGCCAGGGAGGCTCCTGGG + Intergenic
1049399947 8:142420647-142420669 AAGAGGGCACTGAGGAAGCTTGG + Intergenic
1050916534 9:11142370-11142392 AATAGGGTACTGAGGATCATAGG - Intergenic
1051969590 9:22871981-22872003 AACATGGCAGTGAGTTCCCTGGG + Intergenic
1055856179 9:80691364-80691386 AACAGGGCAGTGGGGATCTTGGG - Intergenic
1057498968 9:95581828-95581850 AAAAGGGAAGTGAGGAGACTAGG - Intergenic
1057765144 9:97910084-97910106 AGCAGGGCAGTGAGGGGCCATGG + Exonic
1058896079 9:109401712-109401734 GACAGCGCAGTGCAGATCCTGGG - Intronic
1059326514 9:113507196-113507218 CACAGGGCAGAGAGGATAATGGG - Intronic
1060818370 9:126647707-126647729 CACAGGGCAGTGTGGAGCCCTGG + Intronic
1061318467 9:129812804-129812826 CACAGGGATCTGAGGATCCTAGG - Intergenic
1061851609 9:133419191-133419213 AACAGGGAAGTGAGGCTCCTAGG + Intronic
1203432333 Un_GL000195v1:102827-102849 AAGAGGGGAGGGAGGATCCTGGG - Intergenic
1188011965 X:25066364-25066386 AACACTGCAGTGAGCAGCCTAGG - Intergenic
1188651132 X:32632774-32632796 AACAGGGCAGCTGGGACCCTGGG + Intronic
1188878902 X:35468223-35468245 AACAGAGCAGACAGGAGCCTGGG + Intergenic
1189938561 X:46096564-46096586 AACATGGCAGAGTGAATCCTGGG - Intergenic
1190247931 X:48702750-48702772 GACAGGGCTGAGAGGATCCCTGG - Intronic
1190909469 X:54758211-54758233 AACAGGCCAGTGAGGAGACCAGG - Exonic
1191800998 X:65079285-65079307 TTCAGGGCAGTGAGGTCCCTCGG - Intergenic
1194739726 X:97558355-97558377 GACAGTGTAGTGAGGATCCAAGG + Intronic
1197709045 X:129653406-129653428 GGCAGGGCAGTGAGTTTCCTGGG - Intronic
1198933354 X:141882178-141882200 AAGAGGGCAGTCAGGGTCCTAGG + Intronic
1199026201 X:142941926-142941948 GACATGGCAGTGAGCTTCCTGGG + Intergenic
1199169112 X:144715575-144715597 CACAGGGAAGTGAGAATCCCAGG - Intergenic
1199740735 X:150733921-150733943 AACAGGGCAGGGAGGAAGATGGG + Intronic
1199813872 X:151379277-151379299 AACTGGGCAGTGAGGACCTGAGG + Intergenic
1201770647 Y:17614347-17614369 ACCAGGGCAGAGAGGGTCGTAGG - Intergenic
1201830908 Y:18291639-18291661 ACCAGGGCAGAGAGGGTCGTAGG + Intergenic