ID: 961051023

View in Genome Browser
Species Human (GRCh38)
Location 3:123747241-123747263
Sequence ACCCCCTGTCACAAGATTTA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 79
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 72}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961051023_961051028 21 Left 961051023 3:123747241-123747263 CCTTAAATCTTGTGACAGGGGGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 961051028 3:123747285-123747307 AGTCTAGGTGACCTGCTGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 100
961051023_961051025 6 Left 961051023 3:123747241-123747263 CCTTAAATCTTGTGACAGGGGGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 961051025 3:123747270-123747292 CCCTTCTGCTGTCACAGTCTAGG 0: 1
1: 0
2: 2
3: 22
4: 247
961051023_961051027 17 Left 961051023 3:123747241-123747263 CCTTAAATCTTGTGACAGGGGGT 0: 1
1: 0
2: 0
3: 6
4: 72
Right 961051027 3:123747281-123747303 TCACAGTCTAGGTGACCTGCTGG 0: 1
1: 0
2: 0
3: 13
4: 130

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961051023 Original CRISPR ACCCCCTGTCACAAGATTTA AGG (reversed) Intronic
902672904 1:17987378-17987400 ACCCCTTGTCATTGGATTTAGGG + Intergenic
904487667 1:30838129-30838151 ACCCCGTATCACTTGATTTATGG + Intergenic
1064467062 10:15594255-15594277 ATCTCCTGTCCCAAGATTTCAGG - Intronic
1071404667 10:85318469-85318491 ACCCCCGAGCACATGATTTAAGG + Intergenic
1078786390 11:14498951-14498973 AATCCTTGACACAAGATTTAAGG + Exonic
1078883483 11:15476730-15476752 AGCCCCAGTGACAAGATATAGGG - Intergenic
1085735113 11:79032160-79032182 AACCCCTGTCATCAGTTTTAAGG - Intronic
1087864663 11:103209042-103209064 ACTCTCTGTCACAAGAATTATGG + Intronic
1088697955 11:112384692-112384714 ACACCCAGTCATTAGATTTAGGG - Intergenic
1090742962 11:129682750-129682772 ACAGCCTGACATAAGATTTAGGG - Intergenic
1092892895 12:12985953-12985975 AACCCAGGGCACAAGATTTAAGG + Intronic
1094168529 12:27466731-27466753 ACCCCCTCTCACAAGATTCTAGG - Intergenic
1104182553 12:126396593-126396615 ACCAAATGTCACAATATTTATGG - Intergenic
1106120765 13:26858545-26858567 ACCCCTTGTCACCAGATGTCTGG + Intergenic
1108538593 13:51413367-51413389 AACCCCTGTAAGAAGAATTAGGG + Intronic
1112062608 13:95756000-95756022 AGCCTCTGTCCCGAGATTTAGGG + Intronic
1112385676 13:98937673-98937695 AGCCCCAGTCTCAATATTTATGG + Intronic
1112555034 13:100459171-100459193 ACCACCAGTCATCAGATTTAAGG + Intronic
1119887013 14:78151784-78151806 TCCCTGTTTCACAAGATTTATGG - Intergenic
1121032166 14:90667456-90667478 ACCCCCTCTCACCAAATTGATGG - Intronic
1122739873 14:103866143-103866165 AGCCCATGTCACACCATTTATGG + Intergenic
1123185952 14:106517181-106517203 AGCCCCTTTCACAATATTTGAGG - Intergenic
1131686070 15:94768985-94769007 ATCCCCTTTCAATAGATTTACGG - Intergenic
1134086912 16:11363563-11363585 ATCACCTGTCACAAGGTTCAAGG + Intronic
1138174579 16:54884954-54884976 ACCCCCTATCACCAGGTTCATGG - Intergenic
1142418027 16:89953725-89953747 AGCCCCTGTCTCAGGACTTAGGG - Intronic
1143325481 17:6095604-6095626 AGCCCCTGTCATCAGATTCACGG - Intronic
1145066728 17:19766443-19766465 CCCCCCTGTCACTAGATGTTGGG - Intergenic
1146236055 17:31163850-31163872 ACCCTTTATCACAAGATTTTAGG + Intronic
1156349365 18:36290199-36290221 AACCACTGTCACACAATTTAGGG - Intergenic
1159036810 18:63285513-63285535 TTCCCCTGTCACAAGATTGTGGG - Intronic
1166438448 19:42789464-42789486 ACCCTCTCTAACAAGATTGACGG - Intronic
1166473471 19:43100198-43100220 ACCCTCTCTAACAAGATTGATGG - Intronic
1168003790 19:53469320-53469342 ACCCCATGTCACAGGATATGGGG - Intronic
929373089 2:41250509-41250531 AACCCCTGTCACTGGATTTAGGG + Intergenic
933832775 2:86224267-86224289 ACCCCTTGTGACAACATTTCAGG + Intronic
935565445 2:104601377-104601399 TCACCCTGGCAGAAGATTTAGGG - Intergenic
938866215 2:135423476-135423498 ACCACCAGTCACTGGATTTAGGG + Intronic
943206403 2:184902737-184902759 AACATCAGTCACAAGATTTATGG - Intronic
945064386 2:205936258-205936280 ACCACCAGTCACAAGATGTGGGG - Intergenic
1175264833 20:57696202-57696224 ACCGCCTGTCACTTGGTTTAAGG - Intronic
1178132271 21:29587422-29587444 ACCCCCTGTCTCCAGATATTTGG - Exonic
1181883503 22:26000120-26000142 ACCCCCTGTCCCAACACATAAGG - Intronic
1184023990 22:41840294-41840316 AGTTTCTGTCACAAGATTTAGGG - Intronic
1185057778 22:48589954-48589976 ATCCCCTGTGACAAGATCTTCGG - Intronic
961051023 3:123747241-123747263 ACCCCCTGTCACAAGATTTAAGG - Intronic
961654843 3:128435521-128435543 AGCCTCTGTCACCAGATTTTGGG + Intergenic
962106446 3:132395476-132395498 ACCCCCAGTGGCAAAATTTATGG - Intergenic
970915553 4:21329620-21329642 ACCCACTGTCAGCAGAATTAAGG - Intronic
979769174 4:124501445-124501467 GCAACCTGTCTCAAGATTTAAGG - Intergenic
979814595 4:125084825-125084847 ACCTCCTTTCAGAAGACTTAAGG - Intergenic
984149678 4:176111214-176111236 ATCCCATGTTGCAAGATTTATGG - Intronic
991547254 5:67796133-67796155 ACCCCCCGCCCCAAGATTTAGGG - Intergenic
998497110 5:142600630-142600652 ACTCCATGTAACAAGATTTCTGG + Intronic
998919660 5:147054016-147054038 ACCCACTATCACCAGATTTCAGG - Intronic
999305723 5:150518249-150518271 TCCCCCTGCCAGAAGAGTTAAGG + Intronic
1002056211 5:176599254-176599276 TCCCCCTTTCCCAAGATTTCAGG + Exonic
1007919227 6:45591166-45591188 ACCCCAGGTCACAAAATGTATGG - Intronic
1010320517 6:74504009-74504031 ACTCACTGTCACAAGAGCTAAGG + Intergenic
1010388132 6:75305838-75305860 ACCCACCGTCCCAAGATTTCAGG + Intronic
1010904887 6:81475561-81475583 ACCTGCAGTGACAAGATTTATGG - Intergenic
1010934982 6:81850163-81850185 ACCACCAGTCACAGGATTTAGGG + Intergenic
1011510235 6:88092959-88092981 ATCCTCTGTCACAATTTTTATGG - Intergenic
1012009138 6:93757884-93757906 ATCCCAAGTCATAAGATTTATGG - Intergenic
1013681648 6:112530708-112530730 AGCCCATAGCACAAGATTTAAGG + Intergenic
1023114855 7:36852809-36852831 AACCTCTGTGACAACATTTAAGG - Intergenic
1031379348 7:121066613-121066635 ACCCCCTCTCACAAGCTTACAGG + Intronic
1032391865 7:131560446-131560468 ATCCCCAGTCACAACATCTAGGG + Intergenic
1038259263 8:25978992-25979014 CCTCCGTGTCACAAGATTAAGGG - Intronic
1039759932 8:40563745-40563767 ACCCTCTGTCACAAAATTCATGG - Intronic
1040588606 8:48767623-48767645 ACCCTCTGCCTCAAGATTTCTGG - Intergenic
1040918354 8:52587286-52587308 TCCCCCTTTCCCCAGATTTATGG + Intergenic
1040978449 8:53220065-53220087 ACTCCCTGTCAAAATATTTGTGG + Intergenic
1041014981 8:53584178-53584200 ACCCCTTGTCACATGCTTTTTGG - Intergenic
1043467275 8:80523723-80523745 ACCCAATGTCATAAAATTTAGGG - Exonic
1047666095 8:127092594-127092616 ACACCTTGTCACAGGATTTGGGG - Intergenic
1051572128 9:18570889-18570911 AACACCTGTTACAAGTTTTATGG - Intronic
1056706297 9:88955090-88955112 TCCCCCTGTCTCCACATTTATGG + Intergenic
1057110283 9:92463268-92463290 ACCCCCTGTGGCAAGATGAAAGG - Intronic