ID: 961053750

View in Genome Browser
Species Human (GRCh38)
Location 3:123768800-123768822
Sequence CCTGTTCACCAGACAGTGTA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 107
Summary {0: 1, 1: 0, 2: 2, 3: 9, 4: 95}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961053750_961053755 6 Left 961053750 3:123768800-123768822 CCATACACTGTCTGGTGAACAGG 0: 1
1: 0
2: 2
3: 9
4: 95
Right 961053755 3:123768829-123768851 GCCTTAGAAATATGCACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 113
961053750_961053757 21 Left 961053750 3:123768800-123768822 CCATACACTGTCTGGTGAACAGG 0: 1
1: 0
2: 2
3: 9
4: 95
Right 961053757 3:123768844-123768866 ACTGCTGGCAGAGCCAAGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961053750 Original CRISPR CCTGTTCACCAGACAGTGTA TGG (reversed) Intronic
905947544 1:41916763-41916785 CCTGCTGAGCAGCCAGTGTAGGG - Intronic
915322779 1:155064877-155064899 CCTGTTCTCCAGAGAGTCTGTGG - Intronic
918569470 1:185971768-185971790 AGTGTTCACCAGACAGTTCAGGG - Intronic
1065968582 10:30787984-30788006 GCTGTTTCCCAGACAGTGCAAGG - Intergenic
1066686958 10:37990750-37990772 CCTCTTCAGAAGACAGTGTGGGG - Intergenic
1067767805 10:49100934-49100956 CCTCTTCAACAGACAGTGTAGGG + Intronic
1077541653 11:3149345-3149367 CCTGGCCACCAGATAGGGTAGGG - Intronic
1078008207 11:7548416-7548438 CCTGTTCTCCACAGCGTGTATGG + Intronic
1082689752 11:56285600-56285622 CCTGTTCCCCAAAAAATGTATGG + Intergenic
1088384878 11:109242539-109242561 CTTTTTCACCACACACTGTATGG - Intergenic
1089362857 11:117902484-117902506 CCTGTTCCCCAGGCAGAGAAGGG + Intronic
1091532965 12:1377220-1377242 ACTGTTCACTAGAGAGTGGACGG - Intronic
1092263449 12:6964153-6964175 CATCTTTACCAGACAGTGTTAGG - Intergenic
1092535386 12:9381741-9381763 CCTATTCACCAGACATGCTAGGG + Intergenic
1104288388 12:127446451-127446473 CCTGTGCACCAGAGAGTGCAAGG + Intergenic
1105662959 13:22519627-22519649 TCTGTTAAGCAGATAGTGTAAGG - Intergenic
1105974724 13:25463563-25463585 CCTGCTCCCCTGACAATGTAAGG + Intronic
1107795806 13:44050373-44050395 TCAGTTCAACACACAGTGTAAGG - Intergenic
1110858355 13:80321251-80321273 CCTGTTCAGGAGACAGTGAATGG - Intergenic
1111269022 13:85855317-85855339 CCTGTTGAGGAGACAGTGCAGGG - Intergenic
1112320037 13:98397414-98397436 ACTGTTCACCAGAGTGTGAATGG - Intronic
1116632994 14:47357405-47357427 CAAATTCACTAGACAGTGTAGGG + Intronic
1117982726 14:61357930-61357952 TCTGGTCACCAGGCAGTGCAAGG - Intronic
1118265178 14:64288058-64288080 CCTGTTCACCACCCAGGATATGG - Intronic
1119310567 14:73642988-73643010 CCTGTTCACCAGAGAATGTGTGG - Intergenic
1119635327 14:76268759-76268781 CGTGTTCACCTCACAGTGCAAGG + Intergenic
1127524374 15:59777617-59777639 AATGTTCACCAGGCTGTGTAGGG - Intergenic
1128640022 15:69329095-69329117 CTTGTTCACCAGGCACTGCAAGG + Intronic
1130301499 15:82682408-82682430 CATGATCACAATACAGTGTAAGG - Intronic
1134827291 16:17294823-17294845 CCTGGTGTCCAGACAGTGCATGG + Intronic
1145002524 17:19315202-19315224 CCTGTTCACCAGCCAAAGGAGGG - Intronic
1147150656 17:38511721-38511743 CCTGTTCCCCAGACAGTTTTTGG + Exonic
1148992730 17:51680568-51680590 CCTGTTCCCCAGGGAGTGTTTGG + Intronic
1152342776 17:79734338-79734360 CCTGCTCACCAGCCGGTGGAAGG - Intronic
1154295033 18:13140165-13140187 CCTGTTCACCAACCACTGGAAGG - Intergenic
1155521366 18:26672206-26672228 ACTGTTCAACAGAAAGTGTGTGG - Intergenic
1159091162 18:63851028-63851050 CCTGTTCAGCACACAGATTAAGG - Intergenic
1159651271 18:70981961-70981983 CTGGTTCCCCAGACAGGGTACGG - Intergenic
1160691817 19:463815-463837 CCTGTTTCCCACACAGTGAACGG - Exonic
925295721 2:2775387-2775409 GCTGATCCCCAGACAGTGTATGG + Intergenic
927403164 2:22737409-22737431 TCTCTTCAACAGACAGTGTTGGG + Intergenic
927693047 2:25221916-25221938 CCTCTTCTCTAGACAGTGGAGGG - Intergenic
927951565 2:27173400-27173422 CCCCTTCCCCAGACAGTGGAGGG + Intergenic
931078982 2:58747669-58747691 CATGTTCACTAGACAGATTATGG + Intergenic
934550558 2:95258787-95258809 CCTCATCACCAGAAACTGTAGGG + Intronic
935185226 2:100725576-100725598 CCTGTTCACAGGACAGTGCCAGG + Intergenic
936289663 2:111211774-111211796 GCTGTTCTCCTGACAGTGAATGG + Intergenic
939906948 2:147928316-147928338 TCTTTTCACCAAACAGTGTGTGG + Exonic
942320549 2:174732198-174732220 CCTTGTCACCAGAAACTGTAGGG + Intergenic
1171980268 20:31623121-31623143 CCTGTTAGCCAGACAGTGTGAGG + Intergenic
1174341305 20:49897984-49898006 TCTCTTCACCAGATAGTGTTGGG + Intergenic
1175673539 20:60927627-60927649 CCTGTTCAGCTGACAGATTAAGG + Intergenic
1177748842 21:25255017-25255039 GCTGTTCAACATTCAGTGTATGG + Intergenic
1178744147 21:35231260-35231282 CTTGTTCACCAGGAAGTTTAAGG + Intronic
1178962126 21:37074311-37074333 CCTGTTCAGGAGACAGAATAGGG + Intronic
1180713273 22:17854509-17854531 CCTGTTCACCAGGCAGTTCTCGG - Intronic
1181176092 22:21036972-21036994 CCTTGTCACCAGAAACTGTAGGG - Intergenic
1182636727 22:31733613-31733635 CCTGTTCACCGAACACTTTAAGG - Intronic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
949312361 3:2714135-2714157 CCTGTTGGCCAGGCAGTGTTGGG + Intronic
955751887 3:62191757-62191779 CATGTTCACCAGACAGTGTGAGG - Intronic
956125603 3:66008355-66008377 TCGGTTCACCAGATGGTGTAGGG - Intronic
960680506 3:120242903-120242925 CTTGGTCACCACACAGGGTAAGG + Intronic
961053750 3:123768800-123768822 CCTGTTCACCAGACAGTGTATGG - Intronic
962500338 3:135984969-135984991 CCTGTTCTCGTGACAGTGAATGG - Intronic
974085687 4:57258431-57258453 CCTGTTCAATAAACAGTGTTGGG - Intergenic
974472767 4:62339402-62339424 CATGTTCAGCAGACAGTGAGGGG - Intergenic
975058325 4:69963819-69963841 CCTGGTCCCTAGACAGTGTCTGG - Intergenic
977369335 4:96115316-96115338 GCTGTTCACCTGACAGTGAATGG - Intergenic
977912851 4:102557882-102557904 CCTTTTTACCAGATACTGTAGGG + Intronic
978337630 4:107686808-107686830 CCTGTTCACTAGCCAGAGTTGGG - Intronic
985788316 5:1911446-1911468 CATGTTCAGCAGTCAGTGTCTGG + Intergenic
997681081 5:135751116-135751138 CTAGTTCACCAGCCAGTGCACGG - Intergenic
999394112 5:151215636-151215658 GTTCTTCAGCAGACAGTGTAAGG + Intronic
999894522 5:156015558-156015580 CCTGTTTACCAGACAGAAAAAGG + Intronic
1003254289 6:4460632-4460654 TCTGATCACCAGGCAGTCTAAGG - Intergenic
1010389896 6:75324846-75324868 CCTGTTCAACAGACGGTGCTGGG + Intronic
1010415592 6:75607885-75607907 CTAGTTCAACAGACAGTGTTAGG - Intronic
1011045342 6:83075752-83075774 CCTCTTCACCAGATAGTGTTGGG + Intronic
1012047286 6:94293965-94293987 TCTATTAACCAGAAAGTGTATGG + Intergenic
1013354938 6:109338202-109338224 CTTATTCACCAGTCAGTGTCTGG + Intergenic
1016349895 6:143155757-143155779 CCTCTTCACCAGACTATGTGTGG - Intronic
1031654930 7:124343149-124343171 CCTCTTCACCACACACTGTGGGG + Intergenic
1036103322 8:5811836-5811858 CATATTCAGCAGACAGTGCAAGG + Intergenic
1037329596 8:17731290-17731312 CCTGCTCACTAGGCAGTGTGAGG - Intronic
1041436694 8:57849485-57849507 CGTGTCCTCAAGACAGTGTAGGG - Intergenic
1042166348 8:65949570-65949592 TCTGTTCAGTAGACAGGGTATGG - Intergenic
1043790088 8:84454808-84454830 CCTGTTCCCAACACAGTGCAAGG + Intronic
1045231034 8:100307958-100307980 ACTGTCAACCAGACAGTGTTGGG - Intronic
1048333039 8:133484127-133484149 TCTGTTCACCACCCAGTGAATGG - Intronic
1055746430 9:79450579-79450601 CCTGTTCAGCTGACAGAGCAAGG + Intergenic
1057682341 9:97200718-97200740 GGTGTTCACAAGACAGTGTGTGG - Intergenic
1058545314 9:106054876-106054898 CCTGTGCACCAGTCAGTTTTTGG + Intergenic
1058655676 9:107218438-107218460 CCTGTTCACCAGAGAGCTCAAGG + Intergenic
1060783605 9:126431915-126431937 CCTGTGCACCAGGCATTGTCTGG + Intronic
1060789109 9:126473866-126473888 CCTGTTCACCACCTTGTGTATGG + Intronic
1190413096 X:50156329-50156351 CGTGGTCACCAGACAGTGGTGGG + Intergenic
1190469664 X:50765713-50765735 TCTGTTTGCCAGACAGTTTACGG - Intronic
1191722373 X:64243932-64243954 CCTGTTCAACAAACAGTGCTAGG - Intergenic
1192200368 X:69062721-69062743 CCTGTTCACCACACAGGCTGGGG - Intergenic
1194283677 X:91983638-91983660 ACTGTTCTCCTGACAGTGAATGG - Intronic
1195285592 X:103379523-103379545 CCTTTTCTCCAGACAGTTTCTGG + Intergenic
1196078559 X:111605792-111605814 CCTGTTCACCAAAGAGGGAATGG + Intergenic
1199893299 X:152109557-152109579 CCTCTACCCTAGACAGTGTATGG + Intergenic
1199896289 X:152130687-152130709 CCTCTACCCCAGACAGTGTCTGG + Intergenic
1200601248 Y:5208202-5208224 ACTGTTCTCCGGACAGTGAATGG - Intronic
1200957941 Y:8970368-8970390 CCTGTGCACCAGAGAGTGTCTGG - Intergenic