ID: 961053755

View in Genome Browser
Species Human (GRCh38)
Location 3:123768829-123768851
Sequence GCCTTAGAAATATGCACTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 122
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 113}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961053750_961053755 6 Left 961053750 3:123768800-123768822 CCATACACTGTCTGGTGAACAGG 0: 1
1: 0
2: 2
3: 9
4: 95
Right 961053755 3:123768829-123768851 GCCTTAGAAATATGCACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 113
961053748_961053755 24 Left 961053748 3:123768782-123768804 CCTTTCGAAACATCTTCACCATA 0: 1
1: 0
2: 0
3: 9
4: 97
Right 961053755 3:123768829-123768851 GCCTTAGAAATATGCACTGCTGG 0: 1
1: 0
2: 0
3: 8
4: 113

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961053755 Original CRISPR GCCTTAGAAATATGCACTGC TGG Intronic
901715625 1:11151441-11151463 GACTTAGAAATCTTCACTCCTGG + Intronic
902398102 1:16143310-16143332 GCATGTGAAATATGCACTCCAGG + Intronic
905749929 1:40453257-40453279 GTATTAAAAATATGCACTACAGG - Intronic
906315176 1:44782325-44782347 GGCTTAGAAATATTCACTATTGG + Intergenic
909416355 1:75410330-75410352 GCCTTATAAATAGGCATGGCAGG - Intronic
912378515 1:109232806-109232828 ACATTAGAAATATCCGCTGCAGG + Intronic
914808819 1:151011502-151011524 TCCTTAGAAATTTGCAGTCCTGG + Intronic
917035001 1:170738901-170738923 GCCAAAGAAACATTCACTGCTGG + Exonic
921786399 1:219235806-219235828 TCCTTACAAAAATGCACTGAAGG - Intergenic
923718680 1:236448693-236448715 GCCTAAGAAATTTGCATAGCAGG - Intronic
924813384 1:247422649-247422671 GCTTTAAAAATATGGACTTCAGG - Intronic
1063634711 10:7770846-7770868 GCCTTAGATTGATGAACTGCTGG + Intronic
1064182073 10:13126578-13126600 TCCTTAGAAATACGAAGTGCTGG - Intronic
1067361078 10:45579711-45579733 GCCTTAAAAATATCCACACCAGG + Intronic
1072913604 10:99523543-99523565 GCCTTGAAAATAAACACTGCCGG - Intergenic
1075816250 10:125266805-125266827 GCCCTGGAAATATGAAGTGCTGG + Intergenic
1083052041 11:59786066-59786088 GCCTTAGAAATATGCAGAAATGG + Intronic
1086358375 11:86030466-86030488 GCCTTAGAAAAATGCAGCCCGGG - Intronic
1086699914 11:89889512-89889534 TCCCAGGAAATATGCACTGCAGG - Intergenic
1086706256 11:89955004-89955026 TCCCAGGAAATATGCACTGCAGG + Intergenic
1088087498 11:105998724-105998746 GCCTTGGAAATATGAACAGTTGG - Intronic
1089356256 11:117855818-117855840 GCCTGAGAAATCATCACTGCTGG + Intronic
1089966392 11:122657108-122657130 ACCTAAGAAATCTGCACGGCAGG - Intronic
1091135443 11:133184547-133184569 GCCTTAGAAGTGTGCTCCGCTGG + Intronic
1093573177 12:20693013-20693035 GGCTTAGAAACATGGACTGTAGG + Intergenic
1098141773 12:67457373-67457395 GTTTTAGAAGTATGCAGTGCTGG + Intergenic
1098681152 12:73356512-73356534 GCCTGAGAAATATTCACAGTTGG - Intergenic
1101432732 12:104640437-104640459 CACTTAGTAATATGCACTTCAGG - Intronic
1104168064 12:126253110-126253132 CACTTAGCAATATGCACTGAAGG - Intergenic
1104399130 12:128461263-128461285 GACATAGAACTGTGCACTGCAGG + Intronic
1105072643 12:133244796-133244818 TCCATAGAAATATGCTCTGCTGG - Intergenic
1108649324 13:52460153-52460175 ACATTAAGAATATGCACTGCTGG - Intronic
1109323981 13:60845639-60845661 TCTTTAGAAATATGCAATGGAGG + Intergenic
1110935931 13:81289062-81289084 AGTTTAGAAATATGAACTGCAGG - Intergenic
1111966930 13:94870551-94870573 GGTTTAGAAATATGCACTCCTGG + Intergenic
1112802689 13:103130129-103130151 GCCTCAGAAATATGCATTCCAGG - Intergenic
1112995102 13:105564745-105564767 GCCTTATAAATATGGAATGTTGG - Intergenic
1117273268 14:54166712-54166734 ACCTTAGCCTTATGCACTGCTGG - Intergenic
1120751962 14:88205840-88205862 GCTGTAGAAAAATGCACTACGGG - Intronic
1121488381 14:94339351-94339373 CACTTAGAAATATGCACTTAAGG + Intergenic
1131337000 15:91558705-91558727 TCATTTGAAAAATGCACTGCTGG - Intergenic
1134759899 16:16705082-16705104 GTCTTAGAAAAATGAAATGCAGG + Intergenic
1134986173 16:18654123-18654145 GTCTTAGAAAAATGAAATGCAGG - Intergenic
1135951691 16:26920186-26920208 GATTTAGAAGTATGCACTGGTGG - Intergenic
1135957127 16:26965206-26965228 GCCTTAAAAACATGAAGTGCTGG + Intergenic
1137779819 16:51088573-51088595 GCCTCAGATATCTGCTCTGCAGG + Intergenic
1138077235 16:54054610-54054632 GCCTTACAAATCTGGACTACCGG - Intronic
1139026238 16:62821879-62821901 GCATAATAAATATGCACTGTTGG + Intergenic
1142229533 16:88893328-88893350 CCCTGAGCAATATGCGCTGCAGG + Intronic
1143192467 17:5050020-5050042 GACTTAGAAAGCTTCACTGCAGG + Intronic
1144148027 17:12416902-12416924 GCCTTATAATTATGCAATTCTGG - Intergenic
1146938357 17:36826394-36826416 GCCTTTGAAATCTGGACTCCTGG + Intergenic
1148023290 17:44568005-44568027 GACTTAGTAATATGCATTTCAGG + Intergenic
1152395978 17:80033677-80033699 GGCGTAGAAAGATGGACTGCTGG - Intronic
1155087908 18:22475474-22475496 GCCTTACAAAAATGGGCTGCAGG - Intergenic
1157426564 18:47589177-47589199 GCCTTGGAAAGCAGCACTGCTGG + Intergenic
1164901224 19:31926340-31926362 GCCTCAGAAATAGAAACTGCTGG + Intergenic
927233234 2:20845955-20845977 GCCTTTGAAATATGTCCTACAGG + Intergenic
930232241 2:48854943-48854965 GCCTTTGAATGAAGCACTGCAGG + Intergenic
931714808 2:65020778-65020800 GCCTTAGAAGCATGCTCTCCAGG + Intronic
932960068 2:76403192-76403214 GCCTTCCAAATATTGACTGCAGG + Intergenic
933047857 2:77560612-77560634 GCCTTAAAAATGTGCATTTCAGG + Intronic
934930723 2:98420491-98420513 GCCTTACAAATATCCCCAGCTGG - Intergenic
936684642 2:114813512-114813534 GCCTAAGAAATAGGTATTGCTGG + Intronic
942905651 2:181177526-181177548 GACTCAGAAATCTGCTCTGCTGG - Intergenic
946512491 2:220374158-220374180 GCATTTGAAATATGCCTTGCTGG - Intergenic
1177595012 21:23227335-23227357 TCCTTAGAAATTTACATTGCAGG + Intergenic
1177723818 21:24941979-24942001 GCCTAAGAAAGATTCACTCCTGG + Intergenic
1178576742 21:33799486-33799508 GCTTTACAGATCTGCACTGCTGG + Intronic
1182067175 22:27438887-27438909 GACTTCGAGATAAGCACTGCAGG + Intergenic
1182157731 22:28091560-28091582 GTATTAGAAATGGGCACTGCCGG - Intronic
950783355 3:15411306-15411328 GCTTTAGAAATTTGCTCTGAAGG + Exonic
952443930 3:33361885-33361907 GTCTTAAAAATATGCACTTTGGG + Intronic
953728172 3:45419365-45419387 CCCTTTGAGATGTGCACTGCTGG - Intronic
955195884 3:56804390-56804412 GCCTGAGAAGTAGGAACTGCTGG - Intronic
955624157 3:60898944-60898966 GCCTTAGAAATTTTTACTTCAGG + Intronic
956142849 3:66163068-66163090 CACAAAGAAATATGCACTGCAGG - Intronic
956939750 3:74144252-74144274 GGCTTACAAATATCCCCTGCTGG + Intergenic
958929917 3:100197848-100197870 GCAGTAGGAATATGAACTGCTGG - Intergenic
961053755 3:123768829-123768851 GCCTTAGAAATATGCACTGCTGG + Intronic
961424004 3:126830737-126830759 GCCTTAGGAAGAGGCAGTGCTGG + Intronic
964487577 3:157201696-157201718 GACTTAGGAATATCCACAGCAGG - Intergenic
967707804 3:192672747-192672769 GCCATAGAAATATGCAGCTCAGG + Intronic
968986557 4:3878670-3878692 GCATTGGAAAAAAGCACTGCTGG + Intergenic
972283422 4:37624727-37624749 GCCTTAGAAATAACCATTCCCGG - Intronic
975856862 4:78633700-78633722 GCCTGAGGAATAAGGACTGCTGG + Intergenic
979094815 4:116534200-116534222 GATTCAGAAATATGCACTACAGG - Intergenic
981004993 4:139865720-139865742 GCCTTAGACATGCGCACTGAGGG + Intronic
982092661 4:151893872-151893894 GCCTGAGAAATATGAACTCCAGG - Intergenic
983111778 4:163759349-163759371 GCCTTAGATATATTCAATACTGG + Intronic
985014784 4:185622969-185622991 GTCTTGGAAAGAGGCACTGCGGG + Exonic
988540269 5:32102236-32102258 GACAGAGAAATGTGCACTGCAGG + Intronic
990803082 5:59627793-59627815 GCCTTAGGGATAAGCAGTGCTGG - Intronic
996352435 5:122560345-122560367 TGCTTAGAAATATAGACTGCAGG - Intergenic
998469381 5:142371510-142371532 CCCTTAGACATCTGCACTCCTGG - Intergenic
998593495 5:143502522-143502544 GCCTTAGACATCAGAACTGCAGG + Intergenic
999420564 5:151438686-151438708 TCCTTTGACATATGCTCTGCAGG + Intronic
1000982635 5:167832932-167832954 GGCTTAGAAATTGGCTCTGCAGG - Intronic
1001081501 5:168671112-168671134 ACCTGAGAAATAGGCACTACTGG - Intronic
1004515709 6:16320819-16320841 GCCTTAGAAACAGGAACGGCGGG + Intronic
1004853176 6:19721755-19721777 TCCTTAGCAATATGCGCTGCTGG - Intergenic
1007900526 6:45407346-45407368 GCCTCAGATATATGTAATGCAGG + Intronic
1008975509 6:57420845-57420867 GCCATAGAAATATTCACTTGTGG + Intronic
1015027946 6:128559575-128559597 GCTTTAAAAACAGGCACTGCTGG - Intergenic
1015597554 6:134880204-134880226 CCCTTAGAAATCTCCACTGGTGG + Intergenic
1022771177 7:33474645-33474667 ACCTTAGAAATAAGGAATGCTGG + Intronic
1023618189 7:42042308-42042330 GCCTTAAAAATATGCACAGGTGG - Intronic
1032354019 7:131192838-131192860 GCTTTAAAAATATACACAGCAGG - Intronic
1035493221 7:159298234-159298256 TCCATAGAAATATGCTCTGCTGG - Intergenic
1041256727 8:55985141-55985163 CCATTAGAAAGCTGCACTGCTGG + Intronic
1044516537 8:93145429-93145451 GCCATAGAAAGATGCAAGGCTGG - Intronic
1045103510 8:98868401-98868423 ACCTAAGAAACATGCACTGAGGG - Intronic
1045611122 8:103843365-103843387 GCCTTGCTAATATGCACTCCAGG + Intronic
1053587466 9:39475034-39475056 GCCCTGTAAGTATGCACTGCAGG - Intergenic
1054578834 9:66890202-66890224 GCCCTGTAAGTATGCACTGCAGG + Intronic
1056198748 9:84254086-84254108 GCCTTTGAAACATGCATTTCAGG + Intergenic
1058283025 9:103142313-103142335 GTCTTAGAAATATGCATTTAAGG + Intergenic
1059775394 9:117469566-117469588 GCCTTAGAAATCAGCACTCCTGG - Intergenic
1187126558 X:16459810-16459832 GCCCTAGAAATTTCCACAGCTGG + Intergenic
1194493834 X:94584779-94584801 TCCTAAGATATATGCATTGCTGG - Intergenic
1196221559 X:113117236-113117258 GCTTTAGAAAGATGGACTGTGGG - Intergenic
1199160012 X:144597564-144597586 GCCCTAAAAATATGAAATGCAGG - Intergenic