ID: 961053757

View in Genome Browser
Species Human (GRCh38)
Location 3:123768844-123768866
Sequence ACTGCTGGCAGAGCCAAGCG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 201
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961053756_961053757 -9 Left 961053756 3:123768830-123768852 CCTTAGAAATATGCACTGCTGGC 0: 1
1: 2
2: 0
3: 13
4: 133
Right 961053757 3:123768844-123768866 ACTGCTGGCAGAGCCAAGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 189
961053750_961053757 21 Left 961053750 3:123768800-123768822 CCATACACTGTCTGGTGAACAGG 0: 1
1: 0
2: 2
3: 9
4: 95
Right 961053757 3:123768844-123768866 ACTGCTGGCAGAGCCAAGCGAGG 0: 1
1: 0
2: 0
3: 11
4: 189

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961053757 Original CRISPR ACTGCTGGCAGAGCCAAGCG AGG Intronic
900083997 1:878201-878223 ACAGCTGGCAGAGGCCAGCTAGG - Intergenic
903028080 1:20443594-20443616 ACTCCTGGTAGAGACAAGAGAGG - Intergenic
903884303 1:26532012-26532034 ACTGCTGGCAGCTCCTAGCCAGG + Intronic
905127100 1:35723350-35723372 ACAGATGTCAGAGCCAAGAGAGG + Intronic
905442748 1:38005438-38005460 CCTGCGGGCCGGGCCAAGCGGGG + Exonic
910767513 1:90797155-90797177 TCTGCTGGAAGAGCCAAGGCAGG - Intergenic
910988184 1:93026954-93026976 ACTCCAGGCAGATCCAAACGAGG + Intergenic
911126106 1:94342502-94342524 TCTGCTGGCTGAGCCCAGCTGGG - Intergenic
911410583 1:97501337-97501359 ACTATAGGCAGAGCCAATCGGGG - Intronic
920956151 1:210621871-210621893 ACTGCTGCCAGACGCAAGTGTGG - Intronic
920988042 1:210908850-210908872 CCTGCTTGCAGAGCCAACCCTGG - Intronic
923358478 1:233183895-233183917 GCTTCTGGAAGAGCCAAGCAGGG + Intronic
1062763244 10:43739-43761 ACAGCTGGCAGAGGCCAGCTAGG + Intergenic
1063977993 10:11432263-11432285 GCTGCTTGGAAAGCCAAGCGGGG + Intergenic
1064271732 10:13871754-13871776 ACTGCTGGGGATGCCAAGCGTGG + Intronic
1067061622 10:43080781-43080803 TCTGCTGGCACAGCCATGCCTGG - Intronic
1070367879 10:75753600-75753622 AATGCTGACAGAGGCAAGGGAGG + Intronic
1072744213 10:97928591-97928613 ACAACTGGCAGAGCCCAGCAGGG + Intronic
1073439187 10:103542551-103542573 ATTACTGGTAGAGCCAAGTGTGG - Intronic
1074962556 10:118461210-118461232 ACTTCTGGCAGAGCTCAGCATGG + Intergenic
1076834473 10:133014229-133014251 GCTGGAGGCAGGGCCAAGCGTGG - Intergenic
1076946616 10:133656180-133656202 CCTGCTGGCAGAGCCCAACATGG - Intergenic
1076946633 10:133656248-133656270 CCTGCTGGCAGAGCCCAACATGG - Intergenic
1077241395 11:1512369-1512391 ACTGCTGGCACAGCCACACACGG + Intergenic
1080622562 11:33998735-33998757 ACTGCTGGCCAAGCCGAGCTTGG + Intergenic
1081867465 11:46367479-46367501 GCAGCTGGGAGAGCCAAGCCTGG + Intronic
1083296478 11:61718138-61718160 GCTGCTGGCAGAGGCAGGCCTGG + Intronic
1083893896 11:65610859-65610881 GCAGCTGGCAGAGCCAGGAGCGG - Intronic
1085012162 11:73148596-73148618 GCTACAGGCAGAGCCAATCGTGG + Intergenic
1089613393 11:119681910-119681932 ACTGCTAGCAGGGCCAGGGGAGG + Intronic
1090523384 11:127503187-127503209 ACTGCAGGCAGAGACCAGCAGGG + Intergenic
1091378159 12:39564-39586 CCTGAGGGCAGAGCCAAGGGCGG + Intergenic
1092096659 12:5848484-5848506 AATGGTGGCAGAGCCAATAGTGG + Intronic
1092768794 12:11877980-11878002 ACTGCCTGCAGAGCCACGCAGGG + Intronic
1094346671 12:29477425-29477447 ATTGCTGGCAGAGACCAGTGAGG - Exonic
1098754782 12:74347512-74347534 ACTGCTGGCAGAGCCACAGTGGG + Intergenic
1101491621 12:105214943-105214965 ACACCTGGCAGAGCCCAGAGGGG + Intronic
1102946349 12:116992324-116992346 ACTGCTGGCAAACCCAGGTGTGG - Intronic
1105009436 12:132745570-132745592 ACTGATGGCAGAGCCCACCATGG - Intronic
1106504050 13:30355973-30355995 ACTGCAGGAAGAGCCAGGCCTGG + Intergenic
1107812261 13:44211857-44211879 ACAGGTGTCAGAGCCAGGCGTGG - Intergenic
1110581796 13:77137872-77137894 ACAGATGGGAGAGCCAGGCGAGG - Intronic
1112773212 13:102814476-102814498 ACTGTTGGCAGAGCCTATCAAGG + Intronic
1114453504 14:22841354-22841376 CCTGCTGCCGGAGCCAAGCTGGG + Intronic
1117081387 14:52155783-52155805 ACTGCCGGCAAAGCCGAGCCGGG - Intergenic
1117450350 14:55844089-55844111 CTTGCTGGCAGAGCCAAGGGAGG + Intergenic
1121546762 14:94768861-94768883 AGTGCGGGGAGAGCCAAGCAGGG + Intronic
1202924212 14_KI270724v1_random:8847-8869 CCTGCTGGCAGAGCCCAACATGG + Intergenic
1126495733 15:49288765-49288787 ACTGCTTTCAAAGCCAAGCCTGG - Intronic
1128692014 15:69731810-69731832 ATTGCTGACAGAGCCAGGAGTGG - Intergenic
1129168940 15:73796260-73796282 ACTGCTGGCAGAGCGAGGCCTGG - Intergenic
1132149089 15:99447181-99447203 CCAGCGGGCAGAGCCAAGTGGGG + Intergenic
1133133329 16:3691897-3691919 GTTGCCGGCAGAGCCCAGCGAGG + Intronic
1135994194 16:27236047-27236069 CCTGCTGGCAGGGCCAGGGGAGG - Intronic
1136665446 16:31807962-31807984 ACAGCAGGCAGAGCCCAGCCTGG + Intergenic
1138451581 16:57096399-57096421 ACTGATGGGAGAGCCGGGCGTGG + Intronic
1139887494 16:70219649-70219671 ACTGCTGACAGGGCCAAATGAGG + Intergenic
1140322273 16:73964575-73964597 ACTGAGGGCAGGGACAAGCGTGG - Intergenic
1140426307 16:74864645-74864667 TCTTCTGGCAGAGCCATGCATGG - Intergenic
1141631747 16:85291648-85291670 GCTGCTGACAGAGCCCAGCTGGG + Intergenic
1141941493 16:87278962-87278984 ACTGCTGCCCGAGCCCAGTGAGG - Intronic
1142670886 17:1486906-1486928 GGTGCCCGCAGAGCCAAGCGAGG - Intronic
1144787676 17:17840808-17840830 ACTGCTGTGGGAGCCAAGCTGGG + Intergenic
1145241721 17:21244074-21244096 GCAGGTGGCAGGGCCAAGCGGGG - Intronic
1145265836 17:21379246-21379268 ACAGTTGGCAGTACCAAGCGTGG + Intronic
1147765615 17:42833702-42833724 ACTGCTGGGGGATCAAAGCGAGG - Intronic
1148219938 17:45854102-45854124 ACTGCAGGCAGGGCCAAGCCTGG - Intergenic
1148523617 17:48307409-48307431 TCTGCTGGTAGATCCAAGTGTGG - Intronic
1148842083 17:50505520-50505542 GCTGGTGGCAGAGCCCAGCCAGG + Intergenic
1149422069 17:56520868-56520890 GCAACTGGCAGAGCCAAGCCTGG + Intergenic
1149784084 17:59421038-59421060 ACTGCTGGCAGCACAAAGTGGGG - Intergenic
1150719667 17:67603637-67603659 ACTGTAGGTAGAGCCAGGCGCGG + Intronic
1151313061 17:73305958-73305980 ACTGCTGGCAGAGACTACAGAGG - Intronic
1151660778 17:75516881-75516903 GCTGCTGGCAGAGCAGCGCGTGG + Exonic
1152206233 17:78976156-78976178 CCTGCAGGCAGAGACCAGCGAGG + Exonic
1152567787 17:81107881-81107903 AGTGCTGGGAGAGCCAAGGAGGG + Intronic
1152843820 17:82587096-82587118 CCGGCTGGCAGTGCCGAGCGTGG - Exonic
1152956153 18:44070-44092 ACAGCTGGCAGAGGCCAGCTAGG + Intergenic
1154087850 18:11324586-11324608 AATGCTTTCAGAGCCAAGAGAGG - Intergenic
1156893999 18:42223307-42223329 CCTGGTGGCAGAGCCTAGCAAGG - Intergenic
1165438842 19:35812388-35812410 ACTGCTGGCAGTGCCCACTGAGG - Exonic
1166816855 19:45551511-45551533 GCTGCAGGCAGAGCCAAGGAAGG + Intronic
1168698016 19:58416690-58416712 ACTGCTGAAAGGGCCAGGCGTGG - Intronic
925305722 2:2846892-2846914 CCTGGAGGCAGAGCCAGGCGAGG + Intergenic
926418674 2:12675729-12675751 TCTGCTGGCAGAGCAGAGGGTGG - Intergenic
927642682 2:24855425-24855447 ACTGCGGGAAGAGCCGAGCAGGG + Intronic
928035839 2:27822309-27822331 ACTGGTGGCAGTGACAAGGGTGG + Intronic
928127309 2:28625638-28625660 ACTGGAGGAAGAGCCCAGCGTGG - Intronic
928172271 2:29011380-29011402 ACTGCTGGGGGAGCCCAGGGTGG - Intronic
928190111 2:29157207-29157229 GCTGCTGACAGATCCAAGCAGGG - Exonic
928232180 2:29507896-29507918 ACTGCCGGCAGAGCCACGCTGGG - Intronic
928786956 2:34899654-34899676 ACTGAAGGCAGAGGCAAGAGGGG - Intergenic
929328226 2:40645293-40645315 ACTGCAGGCTGAGCCGGGCGCGG + Intergenic
929520664 2:42647539-42647561 ACTGCTGGCAGTGGGAGGCGGGG - Intronic
931744179 2:65277547-65277569 TCTGCGGGCAGAGCCAACCATGG + Intergenic
936465876 2:112749826-112749848 CCTGCTGGCAGAGCTGAGCAGGG - Intronic
936610987 2:114001695-114001717 AATGCTGGCACAGCCAGGTGCGG - Intergenic
940117853 2:150229029-150229051 ACAGATTGCAGAGCCAAGCTAGG - Intergenic
940347590 2:152643439-152643461 ACTGCTCGCACCGCCAAGCGTGG + Intronic
946193096 2:218017825-218017847 GCAGCTGGCAGAGCCAGGAGGGG - Intergenic
946363447 2:219233726-219233748 CCTGCTGGCAGGGCCAAGCTGGG + Exonic
946692593 2:222320195-222320217 ACCGCTGGCTGGGCCAGGCGGGG + Intergenic
948112366 2:235466325-235466347 ATTGCAGGAAGAGCCAGGCGCGG - Intergenic
948634578 2:239327159-239327181 GCTGCCAGCAGAGCCAGGCGAGG - Intronic
1171152577 20:22840467-22840489 ACTGGTAGCAGAGCCCAGTGTGG - Intergenic
1173494211 20:43507431-43507453 ACAGCTAGCAGAGCGCAGCGGGG - Intergenic
1173645054 20:44628133-44628155 AGTGCTGGGAGAGCCCAGCGTGG + Intronic
1175418387 20:58816342-58816364 TCTGCTGACAGCGCCCAGCGCGG + Intergenic
1178702009 21:34841610-34841632 ACTGCTGCCGGAGCAAAGAGGGG - Intronic
1179218477 21:39386643-39386665 ACTGCTGGCAGGGACTAGCACGG + Intronic
1179783990 21:43719480-43719502 GCTGCGGGCAGAGCCTGGCGCGG + Intronic
1179910358 21:44444179-44444201 GCTGCTGGCAAAGCCAGGCCTGG + Intergenic
1180047832 21:45318029-45318051 ACTCCAGGCTGAGCCAGGCGTGG - Intergenic
1184420657 22:44381139-44381161 GTTGGTGGCAGAGCCAAGGGTGG + Intergenic
950698529 3:14723233-14723255 AAAGCTGGCAGAGCCCAGCAAGG + Intronic
953079395 3:39601455-39601477 ATGGCTGCCAGAGCCAAGCCTGG + Intergenic
954371037 3:50169699-50169721 CCTGCTGCCAGAGCCGGGCGTGG + Intronic
954685207 3:52366546-52366568 ACTGTAAGCAGAGCCAAGCTTGG + Exonic
954782502 3:53071887-53071909 ACTGCAGGCACAGCCCAGTGAGG + Intronic
957080838 3:75634229-75634251 CCTGCTGGCAGAGCCCAACGTGG + Intergenic
957080856 3:75634297-75634319 CCTGCTGGCAGAGCCCAACATGG + Intergenic
959171056 3:102844025-102844047 ATTGCTGACATAGCCAAGCATGG - Intergenic
959849788 3:111072236-111072258 ACGGCTGGCAGAGCCGGCCGCGG - Intronic
961053757 3:123768844-123768866 ACTGCTGGCAGAGCCAAGCGAGG + Intronic
961468503 3:127096611-127096633 ACTGCAGGCCCAGCCAGGCGTGG + Intergenic
961964539 3:130888566-130888588 AGTGCTGGCTGAGCCCAGCATGG + Intronic
967346026 3:188456649-188456671 ACTGATGGCAGAGTCAACCTCGG + Intronic
968000608 3:195203481-195203503 ACTGCTGTCAGTCCCAAGCCTGG - Intronic
968358181 3:198124169-198124191 ACAGCTGGCAGAGGCCAGCTAGG - Intergenic
968508484 4:983526-983548 ACTCCTGGGGGAGCCCAGCGAGG - Intronic
968596502 4:1488821-1488843 ACTGTTGGAGGAGCCAGGCGTGG - Intergenic
970885157 4:20979686-20979708 AGTGCAAGCAGAGCCAGGCGCGG - Intronic
975974567 4:80080153-80080175 ACTGCAAGAAGAGCCAAGAGTGG - Intronic
977105979 4:92885290-92885312 ACTGCTGACAGAGCTAAGCCTGG + Intronic
981226600 4:142302331-142302353 ACTAATGGCAGAGCAAAGCAAGG - Intronic
981752117 4:148102621-148102643 AGAGCTGGTAGAGCCAAGCTGGG - Intronic
985450035 4:190056841-190056863 CCTGCTGGCAGAGCCCAACATGG - Intergenic
985450052 4:190056910-190056932 CCTGCTGGCAGAGCCCAACATGG - Intergenic
985450070 4:190056979-190057001 CCTGCTGGCAGAGCCCAACATGG - Intergenic
985450087 4:190057047-190057069 GCTGCTGGCAGAGCCCAACATGG - Intergenic
986690199 5:10307771-10307793 CCTCCTGGGAGAGCCAAGCCCGG + Exonic
992479145 5:77133341-77133363 AGTGTTGGCAGATCCAAGCTGGG - Intergenic
994072763 5:95620599-95620621 ACTGCTGGGCGAGCCCCGCGCGG + Exonic
995850476 5:116540311-116540333 ACTGATGGCAGAGCCTAGTTTGG - Intronic
997232897 5:132257151-132257173 ACAGCAGGCAGCGCCGAGCGTGG - Intronic
997440243 5:133904151-133904173 GGTGCTGGGAGAGCCTAGCGTGG - Intergenic
997783330 5:136682438-136682460 ACTCCTGGCAGTACCAAGGGGGG + Intergenic
999242304 5:150135005-150135027 ACTCCTGGCAGATCCCACCGTGG - Exonic
1000329790 5:160197556-160197578 TCTGCCGGCAGAGCCTAGGGAGG + Intronic
1002323940 5:178393303-178393325 AATGCTGGATGAGCCAAGCCAGG + Intronic
1003571925 6:7261587-7261609 AGTGCTGGAACAGCCCAGCGAGG + Intergenic
1003633528 6:7810422-7810444 GCTGGTGGCAGAGCCAATCCCGG + Intronic
1004788954 6:19002121-19002143 AATGCTGGCAGTGCCCAGCAGGG - Intergenic
1007114867 6:39336282-39336304 GCTGCTGGCAGGGCCAGGCAAGG - Exonic
1012026993 6:94008432-94008454 GGTGCTGGCTGAGCCCAGCGTGG - Intergenic
1012945070 6:105456671-105456693 ACTGCAAGCAGAGCCAAAGGTGG - Intergenic
1016451017 6:144182361-144182383 AAGGCTGGCTGAGCCAAGAGAGG + Intronic
1017823811 6:158067307-158067329 ACTGAAGGCAGGGCCAGGCGCGG - Intronic
1019641341 7:2105412-2105434 GCAGCAGGCAGAGCAAAGCGTGG + Intronic
1019764116 7:2837069-2837091 AGTGCTGGCAGGGCCAAGCAGGG + Intronic
1019995313 7:4720580-4720602 GATGCTGGCAGAGCCAGGCCGGG + Intronic
1020116186 7:5477854-5477876 ACTGCTGGCACCGCCAAGGCCGG + Intronic
1020223129 7:6256782-6256804 ACTACTGGGGGAGCCAAGGGAGG + Intronic
1022484316 7:30766056-30766078 CCTGCTGCCAGAACCAAACGGGG + Intronic
1026837063 7:73646548-73646570 TCTGCTGGCTGAGCCAGGCCAGG - Intergenic
1028505491 7:91566009-91566031 CCTCCTGGCAGAGCCTAGGGTGG - Intergenic
1029971424 7:104793184-104793206 AATGCTAGCAGGGCCAGGCGCGG - Intronic
1030318988 7:108144892-108144914 AATGATGGCAGAGCCCAGCCTGG - Intergenic
1033619079 7:143046178-143046200 ACTGCTGGCAGAGTTGAGAGTGG - Intergenic
1033997090 7:147363930-147363952 ACTGTTGACAGAAACAAGCGAGG - Intronic
1035688176 8:1540697-1540719 ACTGCGGACAGAGCCCAGCGTGG + Intronic
1037887261 8:22601626-22601648 TCTGCTGGCTGAGCCCAGCCTGG + Intronic
1040074612 8:43216520-43216542 ACAGCAGGCAGAGCTAAGCCTGG + Intergenic
1046960124 8:120102580-120102602 ACTGCTGGCACACACAAGTGCGG - Intronic
1049681018 8:143918294-143918316 CCAGCTGTCAGAGCCCAGCGAGG - Exonic
1052048148 9:23819117-23819139 AAGGCTGGAAGAGCCAAGAGCGG + Intronic
1052394781 9:27925777-27925799 ACTGCTGGTAGAGACACGAGAGG - Intergenic
1053533201 9:38901704-38901726 ACTGCTGTGTGAGCAAAGCGTGG - Intergenic
1054205427 9:62126133-62126155 ACTGCTGTGTGAGCAAAGCGTGG - Intergenic
1054632934 9:67462237-67462259 ACTGCTGTGTGAGCAAAGCGTGG + Intergenic
1055642105 9:78327249-78327271 ATTGCTGTCATGGCCAAGCGCGG - Intronic
1056926746 9:90840778-90840800 ACTGCTGTGAGAGGCAAGCCAGG + Intronic
1057329200 9:94096824-94096846 ACTGCTGGCACATCCCAGCTTGG - Intronic
1057412882 9:94833525-94833547 ACTTCAGGCACAGCCAGGCGCGG - Intronic
1059164578 9:112066071-112066093 ACGGCCGGCCGAGCCAAGTGTGG + Intronic
1061023008 9:128028717-128028739 ACTGCTCACAGAGCCAAAAGTGG - Intergenic
1061054306 9:128214255-128214277 ACTGATGGCTGAACCAATCGTGG - Intronic
1061624225 9:131831669-131831691 TCTGCTGTCACAGCCAAACGTGG - Intergenic
1061811559 9:133165118-133165140 ACTGCTGGATGGGCCAAGGGAGG - Intergenic
1061844735 9:133380874-133380896 ACAGTTGCCAGAGCCAAGAGAGG - Intronic
1062044230 9:134417754-134417776 GCTGCTGGCAGAGCCAGCCCTGG - Intronic
1062441614 9:136572224-136572246 AATGCTGGCAGAGCCCACCAAGG - Intergenic
1062556756 9:137116251-137116273 ACCCCTGGCAGAGCCATGCTGGG - Intergenic
1062618129 9:137407273-137407295 GCTGCAGGCAGAGCCCAGCCCGG + Intronic
1062742051 9:138180707-138180729 ACAGCTGGCAGAGGCCAGCTAGG - Intergenic
1185989855 X:4881520-4881542 ACTGCTGTCTGAGCCAACTGTGG + Intergenic
1189083506 X:37997454-37997476 ACAGCAGGGAGAGCCAAGCAGGG - Intronic
1192400166 X:70826925-70826947 ACAGCTGGCACAGCAAAGGGAGG + Intronic
1193087106 X:77456564-77456586 AGTGCTTGCAGAGACAACCGTGG - Intronic
1200088923 X:153625464-153625486 GCCCCTGGCAGAGCCAAGGGAGG + Intergenic
1200766316 Y:7083605-7083627 CCTGCTGGGAGAGCCCAGGGAGG - Intronic