ID: 961054523

View in Genome Browser
Species Human (GRCh38)
Location 3:123776887-123776909
Sequence CAGGATCTACAGGGGCATAG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 137}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961054523 Original CRISPR CAGGATCTACAGGGGCATAG TGG (reversed) Intronic
900679472 1:3908755-3908777 CAGGCTGTACAGGGGCATGGTGG + Intergenic
902225779 1:14995668-14995690 CAGCATCTGCAGGGGCTCAGTGG + Intronic
902244186 1:15108624-15108646 AAGGATTTACAAGGGCAGAGAGG - Intronic
902534252 1:17110100-17110122 CAGGATCTGCAGGGGCACAATGG - Intronic
902728328 1:18351958-18351980 GAGGATCTGCATGGGCCTAGAGG + Intronic
905204630 1:36336280-36336302 CAGGAGCTGAAGGGCCATAGGGG - Intergenic
905865470 1:41374080-41374102 CAGCATCCACAGGGACATATGGG - Intronic
911275648 1:95854449-95854471 CAGGAACCACAGGGGCTTAAAGG - Intergenic
911591885 1:99758025-99758047 CAGTATCTAAAGGGGAAAAGTGG + Intronic
912128088 1:106565319-106565341 CATGGTCTACAGGGGTAGAGAGG + Intergenic
914747345 1:150510028-150510050 CAGGATCCATAGTGGGATAGAGG - Intronic
916217692 1:162411599-162411621 CAGGAAGTACAGGGGTACAGAGG - Intronic
919836870 1:201580959-201580981 CAGCAGCTACAAAGGCATAGAGG + Intergenic
1068752577 10:60612176-60612198 CAGGAGCTGCAGGGGCTGAGTGG + Intronic
1069983685 10:72269654-72269676 CAGGATCTAGTGGGGCCTATGGG - Intergenic
1073494886 10:103881952-103881974 CGTGATCTTCAGGGGCATCGAGG + Intergenic
1076734293 10:132451873-132451895 CAGGATGTTCAGGGCCAGAGGGG + Intergenic
1081659074 11:44876978-44877000 CAGGCTCTGCAGGGGCCTGGGGG - Intronic
1082011510 11:47452864-47452886 CAGGCTCAACAGAGGCAGAGTGG + Intergenic
1084608070 11:70184111-70184133 CAGGATTTCCAGGGGCTCAGGGG - Intronic
1085458076 11:76676680-76676702 GAGGCTCTACAGGGGCAAGGAGG + Intergenic
1085508644 11:77074283-77074305 CAGCATTTACTGGGGCACAGGGG - Intronic
1086052235 11:82606866-82606888 CAGTATGTACAGGAGCACAGAGG + Intergenic
1089409794 11:118231137-118231159 AAGGATCTTCAGTGGAATAGTGG - Intronic
1091958434 12:4669026-4669048 CAGTATATACAGGGGCCCAGAGG + Intronic
1094801158 12:34037455-34037477 CAGGATCTACAGGAGAGTGGAGG - Intergenic
1095114292 12:38333448-38333470 CAGGATCTACAGGAGAGTGGAGG - Intergenic
1095810593 12:46370835-46370857 CAGGATCTACATCTGCATAATGG + Exonic
1096009304 12:48199247-48199269 CAGCATTTACAATGGCATAGAGG - Intergenic
1096076791 12:48810933-48810955 CATGAGCTAGAGGGGCAGAGAGG + Intergenic
1097037554 12:56133778-56133800 CAGGTTCTACAGTGGAATTGGGG + Exonic
1098856900 12:75663261-75663283 CATGATCTACTAGGGCATTGTGG + Intergenic
1099242418 12:80153713-80153735 CAGGATTTGGAGGGGTATAGAGG - Intergenic
1099943312 12:89216296-89216318 CAGGATATATAGGAGCACAGAGG - Intergenic
1101286039 12:103313717-103313739 CAGGAGCTACAGAGGGAGAGAGG - Intronic
1104031796 12:125070065-125070087 CAAGCTCTACAGGGGGATTGAGG + Intronic
1104689589 12:130815348-130815370 CAGGAACTACAGGAGGATGGAGG - Intronic
1104866560 12:131959412-131959434 CAGTATCTACAGGGGAAAGGAGG - Intronic
1108560355 13:51637162-51637184 CAGCATGTGCAGGGACATAGAGG + Intronic
1109139697 13:58699225-58699247 CAGGCTGTACAGTAGCATAGTGG + Intergenic
1109570682 13:64184548-64184570 CAGCATCTACAGAGCCTTAGAGG - Intergenic
1113124761 13:106964953-106964975 CTGGATCTTCAGGGGCAGAGGGG - Intergenic
1113603314 13:111586630-111586652 CAAGTTCTACAGCGGCATGGCGG - Intergenic
1115796048 14:36936756-36936778 CTGGATCTACAAGGACAAAGTGG - Intronic
1116057947 14:39886421-39886443 CTGGATCCACCAGGGCATAGGGG + Intergenic
1117651018 14:57905457-57905479 CAGGATCTGCAGGGGAATCTTGG + Intronic
1119266858 14:73267860-73267882 TAGGGTCTGCAGGGACATAGAGG - Intronic
1119473126 14:74911519-74911541 CAGATTCTACAGGGGCAGTGGGG - Intronic
1120080422 14:80210285-80210307 TAAGATCTTCAGGGGCACAGAGG - Intronic
1122860248 14:104579315-104579337 CAGGACTCACAGGGGCACAGGGG + Intronic
1123753544 15:23378350-23378372 CAGGATTTAGAGGGGCAGGGGGG + Intergenic
1131577337 15:93605156-93605178 CAGGATCTAAACTGGCATAGTGG - Intergenic
1133088526 16:3384819-3384841 CCAGATCTACAGGGCCATGGCGG - Exonic
1134462833 16:14444661-14444683 CAGGATTTAGAGGGGCAGGGGGG - Intronic
1135229606 16:20693318-20693340 CAGGATCTGAAGGGGCAATGAGG - Intronic
1144387560 17:14763566-14763588 CTGGGTCTACGGGGGCAGAGTGG - Intergenic
1145010864 17:19366908-19366930 CAGAAGCTACAGGGGCTGAGAGG + Intronic
1145418989 17:22751912-22751934 CAGGATCTACAAGTGGATATTGG + Intergenic
1145437252 17:23053928-23053950 CAGGATCTACAAGTGGATATTGG + Intergenic
1146095305 17:29924548-29924570 CAGGAACTACTGGGTCCTAGAGG + Intronic
1150720744 17:67612261-67612283 CAGGCTCCACAGGGTCATGGGGG + Intronic
1151205335 17:72502356-72502378 GAGGAGCTACAGGGGAATGGAGG + Intergenic
1163005268 19:14393479-14393501 CAGGATTCACAGGGGCAGATGGG + Intronic
1163860920 19:19742492-19742514 CATGCTCTACAGGGCCCTAGTGG + Intergenic
1168382168 19:55933159-55933181 CAGGTTCTATGGGGGAATAGTGG - Intergenic
932493217 2:72134292-72134314 CGGGATCCCCAGGGGCCTAGGGG + Intronic
933766336 2:85711954-85711976 CAGGGTCTGCAGGCGCACAGCGG - Intergenic
935156569 2:100488531-100488553 CAGCAAATTCAGGGGCATAGAGG - Intergenic
935895903 2:107737239-107737261 AAGAATATACAGGGGCAGAGTGG + Intergenic
948710106 2:239820026-239820048 CAGGGTCTGCAGGGGCAAAGGGG + Intergenic
1170881592 20:20301329-20301351 TAGGAGCAACAGGGGCATATAGG + Intronic
1170947384 20:20903534-20903556 CAAGAGCTACAAGGGCATTGTGG - Intergenic
1171176020 20:23051086-23051108 CAGGATCTACTGGGCCCTGGAGG - Intergenic
1172728692 20:37068570-37068592 CAGGATCACCAGGGGAATACAGG + Intronic
1172880410 20:38196006-38196028 TAGGATCTACAGGTGCACAGAGG + Intergenic
1173713254 20:45178943-45178965 CAGGATCTGCTGTGGCACAGTGG + Intergenic
1177215514 21:18123308-18123330 CCGTATCTACAGGAGCAGAGTGG - Intronic
1179568081 21:42261502-42261524 CAGAATCCACAGGGGCCTGGGGG + Intronic
1180003366 21:45005229-45005251 CAGGCTGTACAGGAGCATAAGGG - Intergenic
1182382620 22:29905216-29905238 CAGGTTCCACAGGGGCATCTGGG - Intronic
1184430631 22:44439915-44439937 CTGGATCTGCAGGGGCTCAGAGG + Intergenic
950721185 3:14883812-14883834 CAGAATCTGCAGGGGCATGAGGG + Intronic
951086005 3:18513674-18513696 CAGGGTCTATGGGTGCATAGAGG - Intergenic
951902213 3:27667934-27667956 CAGGATATACATGGGGAAAGAGG + Intergenic
953085645 3:39664106-39664128 CAGTATCTCCAAGGGCAAAGAGG - Intergenic
954472397 3:50708653-50708675 CAGGGTCCACAAGGGCCTAGGGG + Intronic
954852924 3:53618515-53618537 CAGGATCTAAAGGGCCTCAGAGG - Intronic
955927634 3:64023402-64023424 CAGGTTCTCCAGCGGCATCGCGG + Exonic
955928813 3:64034672-64034694 CAGGATGTACAGGGCCATTTTGG + Intergenic
959948749 3:112154454-112154476 CAAGATCCCCAGGGTCATAGAGG + Intronic
960041860 3:113158046-113158068 CAGGAACTTCAGGGGCTCAGGGG + Intergenic
960260624 3:115564209-115564231 CAGCATCTCCAGGGACATGGTGG - Intergenic
961054523 3:123776887-123776909 CAGGATCTACAGGGGCATAGTGG - Intronic
961534299 3:127560238-127560260 CAGGAAGTACAGGGGAACAGAGG - Intergenic
961664769 3:128488459-128488481 CAGGAACTACAGGGCTCTAGAGG + Intronic
961818387 3:129562938-129562960 CAGGTTCTGCAGGGGGAGAGTGG + Exonic
966420435 3:179729352-179729374 CTGGATCTACAAGGACAGAGAGG + Intronic
969203170 4:5622131-5622153 CATGATCCACAGGAGCAGAGGGG - Intronic
974122165 4:57652442-57652464 CAAGATATACAAAGGCATAGAGG - Intergenic
974333042 4:60504909-60504931 CATGACCTGCAGGGGAATAGGGG - Intergenic
976077538 4:81316648-81316670 CAGGTTCTAAAGAGGCAGAGGGG + Intergenic
979074988 4:116259923-116259945 CTGGAGCTACAGGGGCCAAGTGG + Intergenic
981561926 4:146057465-146057487 CAGCATCTACAAGGGCATATTGG - Intergenic
984591124 4:181618930-181618952 GTGGATCTGCAGGGGCAAAGTGG - Intergenic
986601004 5:9473418-9473440 CAGGGTCTACATGGGCTTATTGG - Intronic
989358812 5:40575687-40575709 CAGCATCCTCAGGAGCATAGAGG + Intergenic
990518047 5:56549158-56549180 CAGTATCTGCAGAGGCAGAGTGG + Intronic
991347230 5:65682408-65682430 GAGGATCTACATGGGCAGAAGGG + Intronic
991417498 5:66407418-66407440 TAGGATCTACAGTGGCATGTGGG - Intergenic
993065831 5:83096069-83096091 CAGGATCTACTGTGGGATGGAGG + Intronic
998116718 5:139543441-139543463 CAGGATCTACGTGGGTATAGAGG - Intronic
998157254 5:139794074-139794096 CAGGATCTTAAAGGGCACAGAGG - Intergenic
998537681 5:142949777-142949799 CAATATGGACAGGGGCATAGTGG + Intronic
1006133086 6:31880319-31880341 CAGGATCCACAGGGTCTTCGGGG - Intronic
1008563002 6:52740309-52740331 CAGAAACCACAGGGGAATAGAGG + Intergenic
1010386988 6:75291478-75291500 CAGTATCTACAGAGGCATTTGGG - Intergenic
1012694761 6:102364973-102364995 CAGTTTCTACATGGGCACAGAGG + Intergenic
1013918585 6:115371561-115371583 CAGGATGTAGAGTGGTATAGTGG + Intergenic
1018310056 6:162499199-162499221 CAAGATTTACAGAGGCATGGAGG - Intronic
1022725411 7:32976878-32976900 CAGGTACAACAGGGGCAGAGGGG - Intronic
1024212400 7:47217312-47217334 AAGGTTCTTCAGGGCCATAGCGG - Intergenic
1025048202 7:55710938-55710960 CAGGTACAACAGGGGCAGAGGGG + Intergenic
1027139696 7:75648405-75648427 CTGAATCTACAGGGGCTTTGAGG - Intronic
1027404192 7:77842354-77842376 CAAGATCTAGCTGGGCATAGTGG - Intronic
1028826902 7:95284015-95284037 CAGGATCTTCAGAGGCAGACTGG + Exonic
1032220069 7:129987886-129987908 CAGGCTGTACAGGGGGATTGAGG + Intergenic
1033445237 7:141415560-141415582 CAGCATCTCCAGGGGCCGAGAGG + Intronic
1034225951 7:149482168-149482190 CAGTAGCTACAGGTGGATAGTGG + Intronic
1034229312 7:149508837-149508859 CAGGATCTACAGTGGAACAGAGG - Intergenic
1037929103 8:22866970-22866992 AAGGATCGGCAGGAGCATAGAGG + Intronic
1039458461 8:37724145-37724167 TAGGAGCTACAGGGGCTCAGAGG - Intergenic
1040816681 8:51515219-51515241 CAGGCTCTTCAGGGGCTCAGTGG + Intronic
1046785276 8:118259120-118259142 CAGGACCTACAGAAGCATAGTGG + Intronic
1048662708 8:136623682-136623704 CAGGATAGACAGGGGCATCTGGG - Intergenic
1049950028 9:634881-634903 CAGGATGTACCAGTGCATAGTGG - Intronic
1051028761 9:12647799-12647821 GAGGATCTAAAGGGGCAAAGAGG + Intergenic
1053474903 9:38375720-38375742 CAGGATCTGCAGGGACTTCGAGG - Intergenic
1057560216 9:96122307-96122329 TAGGATCTTCAGGGGTAAAGAGG - Intergenic
1059383996 9:113950007-113950029 CAGGATCTACGGGGGTTTAATGG - Intronic
1061378972 9:130242928-130242950 CAGGATGTACATGGGCAAGGAGG + Intergenic
1061891547 9:133623886-133623908 CAGCATCTTGAGGGGCAAAGGGG - Intergenic
1062367885 9:136220384-136220406 AAAGATCGACTGGGGCATAGAGG - Intronic
1189012797 X:37063330-37063352 CAGGATCTACTGGGGTGGAGGGG - Intergenic
1189578862 X:42384500-42384522 CTTGCTCTACAGGGGCATAAGGG + Intergenic
1190840166 X:54136409-54136431 CAGGAACTCCAGGGCCAGAGTGG - Intronic
1192926527 X:75759940-75759962 CAGGCTGTGCAGGGCCATAGGGG - Intergenic
1195021773 X:100835439-100835461 CAGGACCTAGAGGGCCACAGGGG - Intronic
1195669146 X:107454540-107454562 CAGGGTGGACTGGGGCATAGGGG - Intergenic
1198644634 X:138792769-138792791 CAGGATGTACAGGGCCAAATTGG - Intronic