ID: 961056044

View in Genome Browser
Species Human (GRCh38)
Location 3:123789579-123789601
Sequence TCATTTCCACCTTTAGACCC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 207
Summary {0: 1, 1: 0, 2: 2, 3: 22, 4: 182}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961056044_961056047 25 Left 961056044 3:123789579-123789601 CCTGGGTCTAAAGGTGGAAATGA 0: 1
1: 0
2: 2
3: 22
4: 182
Right 961056047 3:123789627-123789649 ATATAGTCTCCTCAAGCTTTGGG 0: 1
1: 0
2: 0
3: 7
4: 128
961056044_961056046 24 Left 961056044 3:123789579-123789601 CCTGGGTCTAAAGGTGGAAATGA 0: 1
1: 0
2: 2
3: 22
4: 182
Right 961056046 3:123789626-123789648 AATATAGTCTCCTCAAGCTTTGG 0: 1
1: 0
2: 1
3: 6
4: 112
961056044_961056048 29 Left 961056044 3:123789579-123789601 CCTGGGTCTAAAGGTGGAAATGA 0: 1
1: 0
2: 2
3: 22
4: 182
Right 961056048 3:123789631-123789653 AGTCTCCTCAAGCTTTGGGCTGG 0: 1
1: 0
2: 0
3: 12
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961056044 Original CRISPR TCATTTCCACCTTTAGACCC AGG (reversed) Intronic
907689533 1:56648221-56648243 TCATTTCTACCCTCAGTCCCAGG + Intronic
914648324 1:149674918-149674940 TCATTTCCATATTTTGAACCTGG + Intergenic
916139757 1:161685389-161685411 TACTTTCCACATTTAAACCCAGG + Intergenic
919132925 1:193473746-193473768 TCATTTACATCTTTATATCCTGG - Intergenic
919754613 1:201059026-201059048 CCACTTCCACCTTCAGACACAGG - Intronic
921677343 1:217990900-217990922 TCAGTTCTGCCCTTAGACCCAGG - Intergenic
922007972 1:221551363-221551385 CCACTTCCACCTTTAAACACGGG - Intergenic
922876272 1:228942196-228942218 CCACTTCCACCTTTAAACACGGG + Intergenic
923407669 1:233678839-233678861 TCATTTCCACCTTGAATTCCTGG - Intergenic
924195033 1:241597692-241597714 TCATTTCCAACTCTATGCCCAGG + Intronic
1063037607 10:2302529-2302551 GCCTTTCCACCTTGAGACCAAGG - Intergenic
1065254223 10:23849239-23849261 ACATTTCCAACATTAGTCCCTGG - Intronic
1067340725 10:45401151-45401173 TCATTTCCTGCTTTGGCCCCTGG + Intronic
1067729355 10:48798880-48798902 TCTTTTCCAGCTTCAGATCCAGG - Intronic
1068862216 10:61858936-61858958 TCACTCCCACCTGTAGGCCCTGG - Intergenic
1069030694 10:63593001-63593023 TCATTTCCTCTTTTAGAAACAGG + Intronic
1069816535 10:71199050-71199072 TCAATTCAACCTTTAGACGATGG + Intergenic
1070424229 10:76269797-76269819 TTATTTCCACCTTTATAAGCAGG - Intronic
1071385412 10:85114616-85114638 TCATTTCCTCCTTTAGGCATTGG - Intergenic
1072377641 10:94834805-94834827 CCACTTCCACCTTTAAACACGGG - Intronic
1073978005 10:109122078-109122100 TAATTTCTACCTTCAGACACTGG + Intergenic
1074833189 10:117264040-117264062 TCATTTCCACCTTTGCTTCCGGG + Intronic
1074916824 10:117964792-117964814 TCTTTCCCAAGTTTAGACCCTGG - Intergenic
1076767914 10:132646660-132646682 TCGTCTCCACCTCCAGACCCTGG + Intronic
1080231598 11:30022339-30022361 TCCTTTCCACCTTTACACACAGG + Intergenic
1080569322 11:33542107-33542129 TCTTGTCCCCCTTTAGGCCCCGG - Intronic
1085968692 11:81560499-81560521 TCATTTCCACCTTTATTTTCTGG - Intergenic
1086348679 11:85923513-85923535 CCCTCTCCCCCTTTAGACCCAGG + Intergenic
1086694286 11:89825198-89825220 TCAGTTACACTTTTAGGCCCAGG - Intergenic
1086711860 11:90019313-90019335 TCAGTTACACTTTTAGGCCCAGG + Intergenic
1088662001 11:112056346-112056368 TTATTTTCACCTTCAGCCCCTGG + Intronic
1090657708 11:128858737-128858759 TGATCTCCTCCTTTAGACACTGG - Intronic
1092592660 12:9965960-9965982 TCATTGCCACCTTTTCCCCCAGG - Intronic
1093117333 12:15226937-15226959 TCAGATCCACCCTTAGTCCCAGG - Intronic
1093798846 12:23347024-23347046 TCATTTCCCCCTGTAGATCTTGG + Intergenic
1096597967 12:52709227-52709249 TGATATCCACCTCCAGACCCTGG - Intergenic
1097116117 12:56698495-56698517 TCATTTCCACCTTGACCTCCTGG - Intergenic
1097840806 12:64319654-64319676 CCACTTCCACCTTTAAACACGGG + Intronic
1098639912 12:72825945-72825967 CCACTTCCACCTTTAAACACAGG - Intergenic
1099869882 12:88333559-88333581 TCTCTTCCACCTTGAGAGCCAGG - Intergenic
1100243889 12:92737245-92737267 TGATTTCCTGCTTCAGACCCTGG - Intronic
1103546873 12:121708481-121708503 GCAGTTCCAGCATTAGACCCTGG + Intergenic
1103670473 12:122610430-122610452 CCATTTCAACCTCTAGACCCAGG - Intronic
1104185183 12:126423703-126423725 TCATTTCCAGCTCTAGCCCTAGG - Intergenic
1105798591 13:23881840-23881862 TCATTTTCACCCTCAGATCCTGG - Intronic
1105886934 13:24650348-24650370 TCAGTTCCAGCTGTGGACCCAGG - Intergenic
1108249906 13:48553965-48553987 TCATTTCCCCACTTAGAACCAGG - Intergenic
1111382691 13:87479161-87479183 TCATTAGCAACTTCAGACCCAGG - Intergenic
1112609490 13:100942127-100942149 CCATTTCCAGCTTGAGACACAGG - Intergenic
1112900240 13:104349618-104349640 TCATTACCACTTTTAGAGTCTGG - Intergenic
1116799287 14:49426477-49426499 ACTTTTCCACCTTTGGACACAGG - Intergenic
1119605739 14:76014837-76014859 TCAGCTTCACCTTTGGACCCTGG + Intronic
1119761013 14:77151855-77151877 TCTTTTCCACCTTTAGGCCCTGG - Intronic
1120063493 14:80012958-80012980 TCATTTCTAACGTTAGAACCTGG + Intergenic
1123125415 14:105942559-105942581 CCACTTCCACCTTTAAACACGGG + Intergenic
1124213906 15:27790599-27790621 TCCTTTCCACTTTCAGCCCCTGG - Intronic
1126725308 15:51625386-51625408 TCAGTTCCACCTTCAGCCCCAGG - Intergenic
1126975670 15:54176609-54176631 TCATATCCACCTTAAAACCAGGG + Intronic
1127899929 15:63333506-63333528 TCATTTCCACCTTCAGTCGCTGG - Intronic
1127974975 15:63990530-63990552 TCATTTCCACCTTGATAGACTGG - Intronic
1128413532 15:67422866-67422888 TCATTTCGCCCTTTAGACAGAGG - Intronic
1131279490 15:91009177-91009199 TCATTTCCAACTCTAAGCCCTGG + Intronic
1133017967 16:2953631-2953653 CGATTTCCACTTTTAGAGCCAGG - Intergenic
1135951131 16:26915301-26915323 TCATTTCCACCTTTAAAAAAGGG - Intergenic
1138079617 16:54077560-54077582 TGATTGCCACCTTAAGACACGGG + Intronic
1140202064 16:72902880-72902902 TCCTGTCCAACTTTAGCCCCCGG - Intronic
1142167572 16:88600758-88600780 TGACTTCCACCCTTCGACCCAGG - Intronic
1144802304 17:17938133-17938155 TCATTTCTACCTGTAGTCCTGGG - Intronic
1144821233 17:18076133-18076155 TCATTCCCACTTTTTGACCTTGG + Intergenic
1145925228 17:28642018-28642040 TAATGCCCACCTTTAGACACAGG + Exonic
1146603017 17:34234891-34234913 CCATTCCCACCCTTAGTCCCTGG + Intergenic
1146811811 17:35909933-35909955 ACATTTCAACCTTTAGACCTAGG - Intergenic
1147232739 17:39030908-39030930 ACATTTCAACCTTTAGACCTGGG + Intergenic
1147768262 17:42851185-42851207 TCCTTCCCACCCTTAGTCCCAGG + Exonic
1151647601 17:75444006-75444028 TCATTTCCAACTCTACAACCTGG - Intronic
1155684774 18:28535151-28535173 TAATTTTCATCTTTAGAACCTGG + Intergenic
1157259296 18:46164798-46164820 CCGCTTCCACCTTTAGACACGGG + Intergenic
1157484245 18:48075698-48075720 TCATTTCTACCTTTCTACCTGGG - Intronic
1158442606 18:57490318-57490340 TCTTTTCTCACTTTAGACCCTGG + Exonic
1159132614 18:64296852-64296874 TCATTTCCCCCTCTAGCCCTTGG + Intergenic
1159194782 18:65098996-65099018 TCATTTCTACTTTCAGAACCTGG - Intergenic
1160934540 19:1587418-1587440 TCATTTTTACTTTTAGATCCAGG + Intronic
1162146553 19:8615844-8615866 TCTTTGCAACCTTTAGAACCCGG + Intergenic
1167522000 19:49960720-49960742 TCATTTCCACCTCTCGACTCTGG + Exonic
1167523382 19:49970005-49970027 TCATTTCCACCTCTCGACTCTGG - Intergenic
1167756682 19:51417250-51417272 TCATTTCCACCTCTCGACTCTGG + Exonic
1168414183 19:56158557-56158579 TCCTTTCCACCTGTGGCCCCAGG - Exonic
925656875 2:6158616-6158638 TTATTTCCACCTTTGGAAGCAGG + Intergenic
926118757 2:10229601-10229623 TCATTTCCACGTCCAGGCCCTGG + Intergenic
928319082 2:30268960-30268982 CCACATCCACCTTTAGACACAGG + Intronic
928319978 2:30275503-30275525 TCATTTCCACCTTTTGGCTGTGG + Intronic
928786515 2:34893218-34893240 TCATTTAAACCTTTGGTCCCTGG - Intergenic
929160596 2:38828261-38828283 TCATCACCCTCTTTAGACCCTGG - Intronic
929244889 2:39690482-39690504 TCAATTCCACCTTAGGACACTGG - Intronic
930955685 2:57199593-57199615 TCATTTCCTCTTTTATAGCCAGG - Intergenic
933556383 2:83835742-83835764 CCACTTCCACCTTTAAACACGGG - Intergenic
935449102 2:103189332-103189354 TCTTTTCCTCCTTTAAACACGGG - Intergenic
936557457 2:113508913-113508935 TAATATCCATCTTTAGCCCCTGG + Intergenic
937763122 2:125629205-125629227 ACATTTTCACCTTTAGGCCAAGG + Intergenic
940399453 2:153230763-153230785 TCTATTCCACCTTTTGACACTGG + Intergenic
942311735 2:174662852-174662874 TCATGTCCTCATATAGACCCAGG - Intronic
942994953 2:182249523-182249545 TCAGTACCACCTTTAGCCCCAGG - Intronic
945428065 2:209732173-209732195 TCATTTCCTCCTTTATATTCAGG - Exonic
946342523 2:219080086-219080108 TAGGTTCCACATTTAGACCCAGG - Intronic
1170974133 20:21145612-21145634 TCAGTTCCTCTTTTAGTCCCAGG - Exonic
1172897419 20:38310177-38310199 CCATTTCCTCCCTCAGACCCTGG - Intronic
1172941088 20:38655241-38655263 TCATTTCCACCCTTTGTCCAAGG - Intergenic
1173670235 20:44793764-44793786 TCATTTCTACCTTTAGACCTGGG - Intronic
1174069072 20:47887411-47887433 TCATTCCCAACGTTAGACCCTGG + Intergenic
1175060972 20:56242659-56242681 CCATTTCCACCTCTAATCCCAGG + Intergenic
1175951439 20:62585665-62585687 TCATTTCCAGCATGTGACCCTGG + Intergenic
1177896661 21:26861338-26861360 CCACTTCCACCTTTAAACACAGG + Intergenic
1178994542 21:37386763-37386785 TCATTTCCCCCTTTAGTCACTGG + Intronic
1179178685 21:39027091-39027113 GCATGTCCACCTTTGGAGCCAGG + Intergenic
1180355445 22:11835731-11835753 ACATTTCCACCTTGTTACCCAGG - Intergenic
1181538191 22:23557774-23557796 TCCTTTCCACCCTTAAACTCGGG + Intergenic
1181886250 22:26024536-26024558 ACATTGCCACCTTGACACCCAGG + Intronic
1181923741 22:26341414-26341436 CCTTTTCAACCTTTAAACCCTGG + Intronic
1182938009 22:34244900-34244922 TCATTCCCGCCTCTAGCCCCGGG - Intergenic
1185136554 22:49076675-49076697 TCATTTCCACCTGTAGATGTTGG + Intergenic
950528679 3:13539958-13539980 TCATTTCCATCTGTCGGCCCTGG - Intergenic
951326115 3:21303457-21303479 CCACTTCCACCTTTAAACACAGG - Intergenic
953325642 3:42010410-42010432 ACATTTCCACCTTGGGTCCCTGG + Intergenic
954129784 3:48554546-48554568 TCAGTTCCACACTTAGAGCCTGG + Intronic
954810982 3:53247674-53247696 TCATTTCCACCCTGACATCCTGG - Intronic
955315766 3:57937649-57937671 TCAAGTCCACCTTCAGACCAGGG - Intergenic
955465731 3:59235425-59235447 TAATTTCCACCTTGTGTCCCAGG - Intergenic
955883585 3:63573976-63573998 TCTTTTCCACCCTTAGAATCTGG + Intronic
956220829 3:66901357-66901379 TACTTTCCACCTTAAGACACTGG - Intergenic
956324359 3:68034969-68034991 TAATTTCCACCTGAAGATCCTGG + Intronic
961056044 3:123789579-123789601 TCATTTCCACCTTTAGACCCAGG - Intronic
962495933 3:135938649-135938671 CCACTTCCACCTTTAAACACGGG + Intergenic
963126467 3:141821271-141821293 CCACTTCCACCTTTAAACACAGG + Intergenic
963665095 3:148174063-148174085 TCGTTTCCAACCTTTGACCCTGG + Intergenic
963809001 3:149756698-149756720 CCACTTCCACCTTTAAACACGGG - Intergenic
965827483 3:172745402-172745424 TCCTTTCCATCTTTGTACCCTGG - Intergenic
966139500 3:176739335-176739357 CCATTTCCATCTTTACAACCAGG - Intergenic
966638182 3:182158621-182158643 TCACTTCCTCCTGGAGACCCTGG + Intergenic
968024309 3:195426326-195426348 TCATCTCCACCTGGAAACCCAGG - Intronic
969240849 4:5896323-5896345 GCATTTCCAACTTTATACCCTGG - Intergenic
969995477 4:11307968-11307990 TCACTTCCACCTGTGGACACTGG + Intergenic
971980313 4:33742627-33742649 CCATTTCTACCTTTAAACACAGG + Intergenic
972766813 4:42158878-42158900 TCACTTCCACCTTTAAACATGGG - Intergenic
973790732 4:54375801-54375823 GCACTTTCACCTGTAGACCCAGG + Intergenic
980892339 4:138829354-138829376 TCACTTTCTCCTTAAGACCCAGG + Intergenic
981627520 4:146776288-146776310 TCATTTCAACCTTTTCAGCCTGG + Intronic
981742547 4:148017874-148017896 TCATTTCCACATGTGGTCCCTGG + Intronic
981856883 4:149305487-149305509 TCACTTCCACTTTTAGAGACTGG - Intergenic
984569052 4:181368349-181368371 TCATCTCCATTTCTAGACCCAGG + Intergenic
985132458 4:186752407-186752429 TCATTTACACCTACAGACTCAGG + Intergenic
985382731 4:189412599-189412621 TGCTTTCCACCTTGAGACCCTGG + Intergenic
988619951 5:32812704-32812726 GCATATCCATCTTTAGACCCAGG + Intergenic
989552607 5:42753463-42753485 TCATTTCCACCTTTACTCTCAGG + Intergenic
990617201 5:57520257-57520279 CCACTTCCACCTTTAAACACGGG - Intergenic
992601884 5:78409468-78409490 TCATTTCCAACTTTTCACTCTGG - Intronic
995465125 5:112443758-112443780 CCACTTCCACCTTTAAACACGGG + Intergenic
996519724 5:124413493-124413515 TCATTTCCACCTCTCGGTCCTGG - Intergenic
997073693 5:130646698-130646720 TCAATTCCCCCTTTTGATCCAGG + Intergenic
998496281 5:142592729-142592751 GCATTTTCAACTTTAGAACCGGG - Exonic
999364132 5:151010525-151010547 GCATTTCCAACTTTAAACTCTGG + Intergenic
999728937 5:154461098-154461120 TCACTTCCACATTTGGCCCCTGG + Intergenic
1003026947 6:2563619-2563641 TCAAATCCAGCTTTAGATCCAGG - Intergenic
1006589349 6:35142613-35142635 TCCATTCCACCTTGAGGCCCAGG + Intronic
1010894985 6:81351162-81351184 CCACTTCCACCTTTAAACACAGG + Intergenic
1011882660 6:92050144-92050166 TTATTGCCAGCTTTAGAACCTGG + Intergenic
1013449788 6:110268812-110268834 TCATTTTCAACTGTAGAACCTGG + Intronic
1013601070 6:111705509-111705531 TGATGTGCACCTTTAGTCCCAGG - Intronic
1016705135 6:147098028-147098050 TCATTTCCAGCTCCAGACCCTGG - Intergenic
1016899271 6:149085367-149085389 TCATTTCCACCTTTGGAGGCTGG - Intergenic
1017940789 6:159051050-159051072 TGATTTTCACCTTTTCACCCAGG + Intergenic
1019227962 6:170530730-170530752 TCCTTCCCACGTTTAGACCCAGG + Intergenic
1021403562 7:20237814-20237836 TCAGTCCTGCCTTTAGACCCAGG - Intergenic
1023352723 7:39336309-39336331 TCCCTTCCACCTTCAGAGCCTGG + Intronic
1023658020 7:42446258-42446280 TCATTTCCACCATTTCAGCCTGG + Intergenic
1026939485 7:74279006-74279028 TCATTTTCACCCTGGGACCCTGG + Intergenic
1028261324 7:88669708-88669730 TCATTTCCACCTCTAGCAGCTGG + Intergenic
1028586106 7:92453372-92453394 TTATTTCCAGCTCAAGACCCAGG + Intronic
1029688662 7:102165876-102165898 TGGTTTCCACCGTGAGACCCAGG - Intronic
1029941926 7:104489648-104489670 TCATTCCCACCTTCAGACTCTGG - Intronic
1030489695 7:110216360-110216382 TCAATGACATCTTTAGACCCAGG + Intergenic
1041198656 8:55427834-55427856 TCTTTTTCACCTTTACACACTGG - Intronic
1041812663 8:61928632-61928654 TCATTTTCACCTTTATTCCTAGG - Intergenic
1043386165 8:79749897-79749919 ACTTTCCCACCTTTAGCCCCAGG - Intergenic
1044467357 8:92523264-92523286 TCATTTCCAGCTTGAGACCATGG + Intergenic
1047843921 8:128785473-128785495 TCATTTCCTCCTTTTTATCCAGG - Intergenic
1049097683 8:140558555-140558577 TTATCTCCACCTTTAGACCTGGG + Exonic
1051031748 9:12688989-12689011 TCATCTCCTCCTCTATACCCTGG + Intronic
1051699227 9:19801728-19801750 CCACTTCCACCTTTAAACACAGG - Intergenic
1052269511 9:26613335-26613357 TGATTTGCACCTGTAGTCCCAGG + Intergenic
1055240038 9:74172623-74172645 ACATTACCACCCTTAGACCTAGG - Intergenic
1056558372 9:87708324-87708346 TGGTTTCCACATTTAGATCCTGG + Exonic
1057293090 9:93819469-93819491 TCACCTCCATCTGTAGACCCTGG - Intergenic
1189954318 X:46262319-46262341 CCACTTCCACCTTTAAACACGGG - Intergenic
1190980507 X:55453098-55453120 TCATTTTCAACTTAGGACCCTGG - Exonic
1191743104 X:64456662-64456684 TCAATTACATCTTTAGAACCTGG - Intergenic
1192439219 X:71162557-71162579 TCATTTCCTCCTCTGGAACCTGG + Intronic
1194134658 X:90126133-90126155 TAATTTCCACTTTTAGATTCTGG + Intergenic
1194642269 X:96416630-96416652 TTATTTCCACCTTTATAACAGGG + Intergenic
1194895693 X:99436512-99436534 ACATTTCCAACTTTATAGCCTGG + Intergenic
1196429589 X:115608501-115608523 TCATTACCACCCTAAGACTCTGG - Intronic
1197296179 X:124721820-124721842 TCATTTCAAACTGTAAACCCTGG - Intronic
1198565262 X:137897520-137897542 GCATTTCCTCCTCTATACCCAGG - Intergenic
1198579753 X:138049990-138050012 TCATTTCCACCCTTTCAGCCTGG - Intergenic
1199268824 X:145858821-145858843 CCACATCCACCTTTAGACACGGG - Intergenic
1200480439 Y:3696244-3696266 TAATTTCCACTTTTAGATTCTGG + Intergenic
1200693808 Y:6337736-6337758 TGATTTCCACCTCTAATCCCAGG + Intergenic
1201041469 Y:9836983-9837005 TGATTTCCACCTCTAATCCCAGG - Intergenic