ID: 961056486

View in Genome Browser
Species Human (GRCh38)
Location 3:123793373-123793395
Sequence CAGAAAAAGAAGACGCGGTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 143
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 134}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961056486 Original CRISPR CAGAAAAAGAAGACGCGGTC CGG (reversed) Intronic
900856785 1:5191988-5192010 CAGAAAAAGCACACGCTCTCTGG + Intergenic
900902644 1:5527365-5527387 GAGAAAGAGCAGATGCGGTCTGG + Intergenic
901436695 1:9250977-9250999 GAGGAAAGGAAGACGCGATCTGG + Intronic
901503657 1:9670211-9670233 CAGAAACAGAAGTTGTGGTCTGG - Intronic
902831623 1:19017551-19017573 CATAAAAAGAAGAAGAGGCCGGG + Intergenic
903949655 1:26988634-26988656 CTGAAAAAGAATAGGCTGTCAGG - Intergenic
903984882 1:27219510-27219532 TAGAAAAAGAAAACACAGTCGGG - Intergenic
905303269 1:36999783-36999805 AAGAAATAGAAGATGGGGTCAGG - Intronic
913249264 1:116898896-116898918 AAGAAAAAGAAGACCTGGCCGGG + Intergenic
914813240 1:151044967-151044989 CAGAAAAAGACCAGGTGGTCGGG + Intronic
918629580 1:186700338-186700360 CACAAAAAGAAGACATGTTCTGG - Intergenic
921716825 1:218425500-218425522 AAGAAACAGAAGACCAGGTCGGG - Intronic
1062794077 10:329605-329627 CAGAGAAAGAAGAGGCTGTCAGG + Intronic
1063636919 10:7790999-7791021 GAGGAAAAGAAGATGCAGTCGGG + Intronic
1064598895 10:16973469-16973491 TAGAAAAAGAAGTCAGGGTCAGG - Intronic
1065595439 10:27306286-27306308 AAGAAAAAGAAGGCCTGGTCTGG + Intergenic
1066053446 10:31659059-31659081 CAGAAAAAGGACAGGCGGACTGG + Intergenic
1067166149 10:43868026-43868048 CACAAAAAGAAGTCGTGGTGGGG - Intergenic
1070018781 10:72562911-72562933 GAGAAAAAGAAGAAACGTTCTGG - Exonic
1071481722 10:86069780-86069802 CAGGAAATGAAGACGCTGGCTGG - Intronic
1073824704 10:107307031-107307053 CAGAAATAGAAGACAAGGTTAGG - Intergenic
1074503398 10:114045195-114045217 AAGAAGACGAAGAGGCGGTCGGG - Exonic
1076480847 10:130784425-130784447 CACAAAAGGAAGACGGGGGCAGG + Intergenic
1076983211 11:216344-216366 CACAGAAAGCAGACTCGGTCTGG + Exonic
1080503534 11:32892359-32892381 CAGAGAAAGAAATCGCGATCAGG + Intergenic
1080893856 11:36432713-36432735 CAGAAAAAAAAGAAAGGGTCCGG - Intronic
1080994814 11:37586741-37586763 CAGCAAAAGAAGAGGTGGTGGGG - Intergenic
1083463944 11:62832968-62832990 CGGAGAAAGAAGAAGCGGCCTGG - Exonic
1087468482 11:98541280-98541302 CAGAAATAAAAGACACGGGCTGG - Intergenic
1089890083 11:121872134-121872156 CAGAAAAAGAAGAGGAGGCCGGG + Intergenic
1090491217 11:127162591-127162613 CAGAAAAACAAGAGGGGGTAGGG - Intergenic
1090611592 11:128475845-128475867 CAGGAAAAGAAGCCCCGGGCCGG - Intronic
1094057575 12:26282594-26282616 CAGAAAAAGAAACTGAGGTCTGG + Intronic
1094478883 12:30864246-30864268 CAGAAAAAGAAGCTGAGGGCAGG - Intergenic
1096781027 12:53992195-53992217 CAGAAAGAGAAGACGGTCTCTGG + Intronic
1102346629 12:112164916-112164938 AAAAAAAAGAAAAAGCGGTCTGG - Intronic
1107466822 13:40658712-40658734 AAGAAAAGGAAGACGTGGCCGGG + Intronic
1108725915 13:53181236-53181258 CAGAAAAAGAAAACTTGCTCTGG - Intergenic
1110112204 13:71762099-71762121 CAGAAAACTAAGACTCGGTGAGG + Intronic
1111521479 13:89410515-89410537 CAGAAAAAAAAGCTGCTGTCTGG - Intergenic
1111997598 13:95180256-95180278 CATAAAAAGACAACGCGGCCAGG + Intronic
1113492109 13:110700288-110700310 CAGAAAAGAAAGAGGCGCTCGGG + Intronic
1116558507 14:46344949-46344971 GAGAAAAAGAAGACACAGACTGG - Intergenic
1117353552 14:54902833-54902855 CATAAAAAGGAGGCGCGGCCGGG - Exonic
1122010695 14:98744382-98744404 GAGAAAAAGAAGATGAGGACTGG - Intergenic
1122361608 14:101170368-101170390 CAGAAGGAGAAGGAGCGGTCAGG - Intergenic
1126442058 15:48700006-48700028 AAGAAAAAAAAGAAGGGGTCGGG + Intergenic
1127604739 15:60574980-60575002 CAGGAGAAGAAGAGGAGGTCTGG + Intronic
1129170880 15:73807185-73807207 GAGAAAAAGAAGAGGAGGTGAGG + Intergenic
1129716639 15:77855939-77855961 CAGAAAAAGAAGCCTCTTTCAGG + Intergenic
1131235472 15:90693049-90693071 AAAAAAAAGAAGAAGAGGTCGGG - Intergenic
1133692395 16:8229384-8229406 AAGAAAAAGAGGACGCAGCCTGG + Intergenic
1135711385 16:24720391-24720413 CAAAAAAAGAAAAAGAGGTCAGG + Intergenic
1136102109 16:28003955-28003977 CAGAAAAAGAAGAGTCAGTGTGG + Intronic
1137418724 16:48311929-48311951 AAAAAAAAGAAGAAGCTGTCAGG - Intronic
1139483402 16:67243357-67243379 AAGAAAAAAAAGAGGCAGTCCGG - Intronic
1147326693 17:39673051-39673073 CTGAAAAAGAGGACGTGGACAGG + Exonic
1153661516 18:7330369-7330391 CAGCAGAAGAAGAGGAGGTCAGG - Intergenic
1153688147 18:7567066-7567088 CCAAAATAGAAGACGCGGCCGGG + Exonic
1160682286 19:417330-417352 CAGAAAGAGAAGGCGAGGTCAGG + Intronic
1161791133 19:6361024-6361046 TAGAAAACGAAGACGAGGCCGGG + Intergenic
1167345146 19:48940842-48940864 CACAAAAAGGAGACAGGGTCTGG - Intronic
927981044 2:27375431-27375453 CAGAAAAAGCAACCCCGGTCGGG - Intronic
928962070 2:36937371-36937393 AAGAAAAAGAAAAAGAGGTCGGG + Intronic
929277957 2:40045659-40045681 CAGCAAAAGAGGACCAGGTCGGG - Intergenic
929951710 2:46415438-46415460 CATAAAGAAAAGACGCGGTGAGG + Intergenic
930280784 2:49367440-49367462 CAGAACAAGAAGACAGGCTCAGG + Intergenic
931457850 2:62426166-62426188 CAGAAACAGAAGACGTGGGGTGG + Intergenic
932106692 2:68949713-68949735 CAGAAAAAGAACAATTGGTCAGG - Intronic
934042891 2:88144606-88144628 CAGAATAAGAAGACCTGGGCAGG + Intergenic
935300783 2:101692239-101692261 CAGGAAAAGAAGAAGCAGACAGG - Intergenic
937164392 2:119797869-119797891 CAAAAAAAGAAGAAGCGCTTAGG - Intronic
939588804 2:144037768-144037790 CAGAAAAAGAAAACGGACTCTGG + Intronic
939766624 2:146258079-146258101 CAGAGAAAGAAGAAGGGGTTTGG - Intergenic
942614544 2:177776719-177776741 CAGAAATAGAAGACCAGGTGAGG + Intronic
943862566 2:192887569-192887591 CAGAAACAGATGAAGAGGTCAGG - Intergenic
948568228 2:238899834-238899856 CATAAAAAGATGACACGGTTTGG - Intronic
1174067991 20:47879404-47879426 AAGAAAGAGAAGACTCGGCCAGG - Intergenic
1179779105 21:43688085-43688107 CAGAAAAAGAAGGCAGGGCCCGG + Exonic
1180573112 22:16748325-16748347 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1181092736 22:20485351-20485373 CAAAAAAAGAAAATGCAGTCTGG + Intronic
1182072768 22:27475245-27475267 CAGAAAAAGAAGCCTCTCTCCGG + Intergenic
1182542796 22:31054133-31054155 CAGAAAAAGAGGAGGTGGCCAGG + Intergenic
1184111360 22:42397454-42397476 CACAAAAAGAGGAAGAGGTCAGG - Intronic
1185005560 22:48274687-48274709 CAGAAAAAGAAAACAGTGTCAGG + Intergenic
955455988 3:59122269-59122291 AAGAAAAAGAAAAAACGGTCAGG + Intergenic
956768336 3:72503438-72503460 CAGAAATAAAAGACAAGGTCAGG + Intergenic
961056486 3:123793373-123793395 CAGAAAAAGAAGACGCGGTCCGG - Intronic
962107050 3:132401343-132401365 CAGAAACAGTAGGTGCGGTCAGG - Intergenic
962463909 3:135639332-135639354 CAGGAGAAGAAGACCTGGTCTGG - Intergenic
962740665 3:138360821-138360843 GAGAAAAAGAAGACAAGGCCTGG + Intronic
964897765 3:161618589-161618611 CATAAAAACAAGACAAGGTCAGG - Intergenic
966820605 3:183921405-183921427 CAAAAGAAGGAGACGCCGTCAGG + Intronic
966854129 3:184182630-184182652 CAGAACAAGGAGAAGTGGTCAGG - Intronic
969239357 4:5888740-5888762 AAGAAAAAGACGGCGCGGTCAGG + Intronic
970033918 4:11710268-11710290 CAGCAAAAGAAGACGCTCTAGGG - Intergenic
972867144 4:43246589-43246611 CAGATAAAGAATACGTGGTACGG - Intergenic
973170121 4:47131451-47131473 CAGAAAAACAAGACTCGGCCTGG - Intronic
974212316 4:58794797-58794819 CAGTAAAAGAAGTTGAGGTCAGG + Intergenic
977221732 4:94345412-94345434 CAGAAAGAGAAGTAGCTGTCAGG + Intergenic
981753987 4:148121170-148121192 AAGAAACAGAAAACGAGGTCTGG + Intronic
982270369 4:153579769-153579791 CAGAAAAAAAAGAATAGGTCAGG - Intronic
984824817 4:183915118-183915140 CAGAAAAAGAAAACTTGGCCTGG - Intronic
985529894 5:427846-427868 CAGAAGAAGAAGGCGCCGTCAGG + Exonic
992716612 5:79516728-79516750 CAAAAAAAAACGACGCGGTCGGG - Intergenic
999443535 5:151621003-151621025 CAGAAAAAGAAGCAGAGGTGGGG + Intergenic
1003677474 6:8219492-8219514 CAGAAAAAGAAAATGCCGTTGGG - Intergenic
1003894675 6:10596128-10596150 AAGAAAAAGAAAACTCAGTCCGG - Intronic
1007114123 6:39331164-39331186 CAGAAAAAGAAGAAGGAGTTGGG - Exonic
1007427858 6:41758980-41759002 CAGAAAAAAAAGACCAGGCCTGG + Intergenic
1011486586 6:87848581-87848603 CAGAGAAAGAAGATGCAATCGGG - Intergenic
1016986710 6:149900814-149900836 CAGCAAAAGGAGAAGCAGTCTGG - Intergenic
1017875564 6:158521520-158521542 CAGAAAAAGAAGAGGAGGGGAGG + Intergenic
1020804387 7:12770418-12770440 CAGCAAAAGAAGACGGGATCTGG - Intergenic
1021337031 7:19416324-19416346 GAGAAAAAGAAGACGCAGAAGGG + Intergenic
1022391458 7:29947842-29947864 CAGAGAAAGAGGACGTGTTCTGG - Intronic
1022715583 7:32895117-32895139 CAGAAAAAGAAAATGCAGACTGG - Intergenic
1023116566 7:36868642-36868664 CAGAATAAGGAGAAGCGGGCAGG - Intronic
1023624281 7:42100741-42100763 AAGAAAAAGAAGAGGGGGTGGGG + Intronic
1023866530 7:44241069-44241091 CAGGAAAAGAAGGGGCTGTCAGG - Intronic
1024686637 7:51752859-51752881 CAGAAGGAGAAGACTTGGTCAGG + Intergenic
1025285255 7:57655356-57655378 CAGAAACAGCAGACGGAGTCCGG - Intergenic
1027031282 7:74890585-74890607 CGGAAAAAAAAAACGCAGTCCGG + Intergenic
1029650436 7:101887602-101887624 CAGAAAAAGAGGACATGGCCGGG - Intronic
1037195626 8:16185959-16185981 GAGAAAAACAAGAAGCAGTCAGG + Intronic
1037846945 8:22291911-22291933 AAGAAAAAGAGCACACGGTCAGG + Intronic
1039278976 8:35961633-35961655 CAGAAAAAGAAGAAGCCATGAGG - Intergenic
1040073199 8:43204836-43204858 CAACAAAAGAAGACCCCGTCTGG - Intergenic
1044070191 8:87750973-87750995 CACAAAAGGAAGAGGCAGTCAGG - Intergenic
1044710136 8:95049203-95049225 CAAAAAAAGAAGAAGAGTTCAGG - Intronic
1045176580 8:99731602-99731624 CAGAATAAGAAGACCTGGTAAGG + Intronic
1048217133 8:132506596-132506618 TAGAAAATGAAGACAAGGTCAGG - Intergenic
1049452433 8:142669533-142669555 GAGAAAAAAAAGTCTCGGTCTGG + Intronic
1055492709 9:76822510-76822532 GAGAAAAAGAAGAATAGGTCGGG + Intronic
1055797347 9:79989114-79989136 GAGAAAAAGAGGAAGCTGTCAGG - Intergenic
1056794374 9:89647515-89647537 CAGGAAAAGAAAACGCTGTGGGG - Intergenic
1059976376 9:119722288-119722310 AAGATAAAGAAGACGATGTCTGG + Intergenic
1186287707 X:8063707-8063729 AAGAAAAAGAAGAGGCAGTGTGG - Intergenic
1190375288 X:49783180-49783202 CAGAAAAATAAGGCAGGGTCAGG + Intergenic
1198036920 X:132810005-132810027 CAGAAAACGAAGACTCAGTGGGG - Intronic
1199269217 X:145863554-145863576 CAGAAAAAGCAGCCTAGGTCAGG - Intergenic
1201018163 Y:9625333-9625355 CAGACACAGAAGAAGTGGTCAGG - Intergenic
1201625962 Y:16014790-16014812 ATGAAAAAGAACACGTGGTCTGG - Intergenic