ID: 961057486

View in Genome Browser
Species Human (GRCh38)
Location 3:123801354-123801376
Sequence CTTAAAATACACAAGGAGAA AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 502
Summary {0: 1, 1: 1, 2: 2, 3: 42, 4: 456}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961057480_961057486 25 Left 961057480 3:123801306-123801328 CCTATCTCCCTACTCTCTCTGTT 0: 1
1: 0
2: 4
3: 74
4: 692
Right 961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG 0: 1
1: 1
2: 2
3: 42
4: 456
961057483_961057486 1 Left 961057483 3:123801330-123801352 CCATCTACTCTCATTTCTGTCCT 0: 1
1: 0
2: 8
3: 60
4: 569
Right 961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG 0: 1
1: 1
2: 2
3: 42
4: 456
961057482_961057486 17 Left 961057482 3:123801314-123801336 CCTACTCTCTCTGTTACCATCTA 0: 1
1: 0
2: 1
3: 17
4: 275
Right 961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG 0: 1
1: 1
2: 2
3: 42
4: 456
961057481_961057486 18 Left 961057481 3:123801313-123801335 CCCTACTCTCTCTGTTACCATCT 0: 1
1: 0
2: 3
3: 31
4: 410
Right 961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG 0: 1
1: 1
2: 2
3: 42
4: 456

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961057486 Original CRISPR CTTAAAATACACAAGGAGAA AGG Intronic
901672490 1:10864137-10864159 CTTAAAAGAGAAAAGGAGGAGGG - Intergenic
902064449 1:13672731-13672753 CTAAAAATACAAAAGGAGCCGGG - Intergenic
903073687 1:20744588-20744610 ATTAAAATGAACAAGGAAAAGGG + Exonic
903937434 1:26906117-26906139 CTAAAAATACACAATTAGCAGGG + Intronic
904070531 1:27792915-27792937 TTAAAAATACAAAAGGAGTAGGG - Intronic
906652758 1:47524626-47524648 CTTAGAATATCCAAGGATAAGGG - Intergenic
906683591 1:47748222-47748244 CATAGAATAAGCAAGGAGAAGGG + Intergenic
907996255 1:59635891-59635913 CTTCAGAATCACAAGGAGAAGGG + Intronic
908035663 1:60049451-60049473 CTTAAAATAGAGAAGAAAAAGGG - Intronic
908086362 1:60639065-60639087 ATCAAAATAAAGAAGGAGAAGGG + Intergenic
908503602 1:64772072-64772094 TTTAAATTTCACAAGGAAAATGG + Intronic
909142389 1:71884815-71884837 CTTTAAATTCACATGGACAAAGG + Intronic
909218837 1:72928081-72928103 CTGAAAAGAGACAAGGAGCAGGG - Intergenic
909307288 1:74097437-74097459 CCTAAAAGTGACAAGGAGAATGG + Intronic
909429485 1:75570384-75570406 ATCAAAATACACAAAGAGAAAGG + Intronic
909930417 1:81491536-81491558 CTTTAAAAACACAAACAGAAGGG + Intronic
910071673 1:83221943-83221965 CTTAATATCCATAAGGAGAGAGG - Intergenic
910921560 1:92353686-92353708 CTTAAACTTCACAATGACAAAGG - Intronic
911831561 1:102556173-102556195 ATTTAAATATACAAAGAGAAAGG - Intergenic
912345713 1:108961696-108961718 CTAAAAATACAAAAGTAGCAGGG + Intronic
913305036 1:117420143-117420165 CTTAAAATCCAGGAGGAGAGAGG + Intronic
915376690 1:155402367-155402389 CTTAAAATCCTCAAGGAATACGG + Intronic
915629526 1:157141069-157141091 CTTAAATTAAAAAAAGAGAAAGG + Intergenic
916077109 1:161207784-161207806 CTTCAGATACTGAAGGAGAAAGG - Intronic
917127669 1:171703268-171703290 TTTAAAAGACACAAGGAGGTTGG + Exonic
917982161 1:180276668-180276690 CTTAAAATACACAGGAGAAAAGG + Exonic
918398248 1:184137795-184137817 AACAAAAAACACAAGGAGAAAGG - Intergenic
919203108 1:194384720-194384742 CTTAAAATTTAAAAGGACAAAGG + Intergenic
919487988 1:198168079-198168101 CTTATAATAAATAAAGAGAAGGG - Intronic
920970152 1:210736385-210736407 CTAAAAATACAAAAGTAGACAGG + Intronic
921068364 1:211638832-211638854 CTTAAAATCCACAATCAGAAAGG + Intergenic
921228772 1:213047604-213047626 CTTATAGTAGACAAGAAGAAGGG - Intergenic
921306711 1:213804203-213804225 CTGAAAATATTCCAGGAGAAAGG - Intergenic
921918849 1:220643459-220643481 CTTAAAAGAGACAGGGAGAATGG + Intronic
921999228 1:221457776-221457798 CTCGGAATACACAGGGAGAAGGG - Intergenic
922403151 1:225282124-225282146 CTAAAAATGCTCAAGGAAAAGGG + Intronic
922466224 1:225846899-225846921 CTGAAAAGACACAACCAGAATGG - Exonic
923184712 1:231559829-231559851 CTTAAACTACCAAAGCAGAAAGG + Intronic
924122967 1:240821289-240821311 CTAAAAATACAAAATGAGCAGGG + Intronic
924414260 1:243842686-243842708 CTTAAAGTAGAAAAGGGGAAAGG - Intronic
924489153 1:244518101-244518123 CTCATGATACATAAGGAGAAGGG - Intronic
924883835 1:248190488-248190510 CCTGAAAGACATAAGGAGAATGG + Intergenic
1063222946 10:3987899-3987921 CTTAAGATAGACATGGAAAAAGG - Intergenic
1063272495 10:4526703-4526725 CTCAAAATAGACAAGGGAAAGGG + Intergenic
1063330142 10:5150207-5150229 CTTTAAATACACTTGCAGAAAGG - Intergenic
1063745220 10:8871644-8871666 CTTAAAATGGAGAAAGAGAACGG + Intergenic
1065208396 10:23378962-23378984 CTTAGAAAATACAAGGTGAAAGG - Intergenic
1065383990 10:25115764-25115786 CATAAAACACACAGGGGGAAAGG - Intergenic
1066622718 10:37375103-37375125 TACAAAATACACAAGTAGAAGGG + Intronic
1066780449 10:38940728-38940750 CTTAAAATAGGCAAGGAAAATGG + Intergenic
1066956196 10:42176004-42176026 CTTAAAATAGGCAAGGAGAATGG + Intergenic
1068134269 10:52936190-52936212 GTAGACATACACAAGGAGAAAGG + Intergenic
1068186468 10:53592612-53592634 CTTAAAAGAGACAGGGAGAATGG - Intergenic
1068501581 10:57845654-57845676 CTTAAATTACTAAAGGACAATGG - Intergenic
1068728855 10:60333834-60333856 CTTTAAAAACACTATGAGAATGG - Intronic
1069320533 10:67166060-67166082 CTTAAAATTGCCAAGGAGGAAGG + Intronic
1069574713 10:69518290-69518312 CTGAGAACACACAAGGACAAGGG + Intergenic
1070102057 10:73397789-73397811 CTTAAAATACAAAAGGGCTAAGG + Intronic
1070522809 10:77269227-77269249 CTTAAAAAGCACAAGGAATAAGG + Intronic
1072864971 10:99049317-99049339 CTAAAAATAAGCAAAGAGAAAGG + Intronic
1073160805 10:101393035-101393057 CTTAAGATCCACAATCAGAAAGG - Intronic
1073727838 10:106255005-106255027 CTTGAAAAACGTAAGGAGAATGG + Intergenic
1073831413 10:107387889-107387911 TTCAAAATACAAAAGGAGACAGG - Intergenic
1074960063 10:118436253-118436275 CATGAAATACACAAGTAAAAAGG + Intergenic
1077621611 11:3729829-3729851 TTTCAAATATACAAGTAGAAAGG - Intronic
1077626797 11:3779478-3779500 CTAAAAATACAAAATTAGAAGGG + Intronic
1077644162 11:3908882-3908904 CCTAAAATACACCTGGAAAAAGG + Intronic
1078654195 11:13222964-13222986 TGTTAAATTCACAAGGAGAAAGG + Intergenic
1079119099 11:17666941-17666963 CTTAAAAAACAGAAAAAGAAGGG + Intergenic
1079256976 11:18839158-18839180 CCTAAAAGACACGGGGAGAATGG + Intergenic
1079801471 11:24874803-24874825 CTTAAAATAGAAAATGAAAAGGG - Intronic
1080244340 11:30162946-30162968 CTTAAGATCCACAATCAGAAAGG - Intergenic
1080334689 11:31182125-31182147 CTTGAAATTGACAAGGAGAATGG + Intronic
1080338498 11:31228445-31228467 CTTACAATAGAAAAGTAGAAAGG + Intronic
1081030657 11:38077608-38077630 CTTGAAAAATACAAGGAGAGTGG + Intergenic
1082052025 11:47778688-47778710 ATTAAAATACAAAAGGTGATAGG + Exonic
1082147206 11:48684533-48684555 CCTGAAATAGACAGGGAGAATGG + Intergenic
1082611801 11:55308438-55308460 CTTAAAATACAAAATTAGCAGGG + Intergenic
1084598547 11:70131621-70131643 CTTAAAACACACAATGGGACGGG - Intronic
1084765366 11:71304877-71304899 CAAAAAATAAAAAAGGAGAATGG + Intergenic
1084807817 11:71591224-71591246 CCTAATATCCACAGGGAGAAAGG - Intronic
1085356515 11:75842959-75842981 CTTAAAAAACAAAAGTAGTATGG - Intronic
1085445997 11:76601296-76601318 CTAAAAATACAAAAGTAGCAGGG - Intergenic
1086279904 11:85173004-85173026 CCTGAAAGAGACAAGGAGAATGG + Intronic
1086698049 11:89866232-89866254 CTTAAAATACACAATTAGCAGGG - Intergenic
1086708113 11:89978256-89978278 CTTAAAATACACAATTAGCAGGG + Intergenic
1086820594 11:91432200-91432222 CCTAAAAAACACAGGGAGAATGG - Intergenic
1087477799 11:98659293-98659315 CTAAAAATAAATAAGAAGAATGG - Intergenic
1088509765 11:110562371-110562393 TTTAAAATACAGAGGGGGAATGG - Intergenic
1088724098 11:112619334-112619356 TCTAAAAGACACAAGTAGAAAGG - Intergenic
1088872639 11:113904419-113904441 CTTGAATTACACAAGGCTAATGG - Intergenic
1090582710 11:128177590-128177612 ATGAAAATAAACCAGGAGAATGG - Intergenic
1090703722 11:129317861-129317883 AGGAAAATAAACAAGGAGAAGGG - Intergenic
1091326060 11:134688987-134689009 TTTAAAATGCACATGGAAAATGG - Intergenic
1091798226 12:3309232-3309254 CTTAAGGAACACAAGGAGAGGGG + Intergenic
1092512536 12:9171874-9171896 CTTGAAAGAGACAGGGAGAATGG + Intronic
1092797939 12:12132058-12132080 CTTCAAATGAACAAGGAGAAGGG + Intronic
1092899212 12:13043122-13043144 CTTAAACAAAACAAGGAGAGTGG + Intergenic
1093034295 12:14318794-14318816 CTTAAAATAAAGAAGGACAGTGG - Intergenic
1094034753 12:26056269-26056291 CTTAAAATAAATAAGAAGAAAGG - Intronic
1094610996 12:31995516-31995538 CTAAAAATACACAATTAGCATGG + Intergenic
1095268701 12:40190870-40190892 CTCAAAAAACACAAGGTAAAAGG - Intergenic
1095283077 12:40379558-40379580 CTAAAAAGGCACAATGAGAATGG + Intergenic
1095455423 12:42378972-42378994 ATCATAATACACAGGGAGAAAGG - Intronic
1096034954 12:48458443-48458465 GTTAAAATACAGCAGTAGAAAGG - Intergenic
1097124076 12:56759472-56759494 CATAATAAACAAAAGGAGAATGG + Intronic
1098130239 12:67342596-67342618 CTCAAAAAACACATGGGGAAGGG - Intergenic
1098812217 12:75109288-75109310 CTTAAAACAGACACAGAGAAAGG - Intronic
1099016948 12:77354689-77354711 CTCTAAAGACACAAAGAGAAAGG - Intergenic
1099755402 12:86840554-86840576 CTGAATAAACACAAGGAGATTGG + Intergenic
1099788632 12:87300764-87300786 CTTCTATTACACAAGAAGAAAGG + Intergenic
1100028271 12:90154711-90154733 CCTAAAGGAGACAAGGAGAATGG + Intergenic
1100710821 12:97254686-97254708 CTGAAATGAAACAAGGAGAATGG + Intergenic
1101078642 12:101158437-101158459 TTCAAAAAACACAAAGAGAAAGG + Intronic
1103046722 12:117741721-117741743 TTAAAAATAAAGAAGGAGAAGGG + Intronic
1103202726 12:119101537-119101559 GATAAAATATACAAGCAGAAAGG - Intronic
1103976929 12:124708740-124708762 TTCAGAATACACAAGCAGAAGGG - Intergenic
1105462577 13:20606255-20606277 CTGACACTACCCAAGGAGAAAGG - Intronic
1106431115 13:29681478-29681500 CTTAAAATACAAAATGAGCCGGG + Intergenic
1106835155 13:33626200-33626222 CTTCAAAGACAGGAGGAGAAAGG + Intergenic
1107181714 13:37469154-37469176 CTGACAACACTCAAGGAGAAGGG - Intergenic
1108150656 13:47530594-47530616 CATAAAATACAGGAGGAAAATGG + Intergenic
1108348613 13:49569969-49569991 CTTACAAAACAGATGGAGAAAGG + Intronic
1109093526 13:58080422-58080444 TTTAAAATAAACATGGAGACGGG - Intergenic
1109319411 13:60791511-60791533 GTTAGAATACTCAAGGACAAGGG - Intergenic
1109639075 13:65163394-65163416 CATAAAATAAAAAATGAGAAAGG + Intergenic
1109921868 13:69074461-69074483 CTTATAATAAACTAGGGGAAAGG + Intergenic
1110483290 13:76008523-76008545 CTAAAGATACAAAAGGAGTAAGG - Intergenic
1110564160 13:76941118-76941140 ATAAAAATACAAATGGAGAAGGG + Intergenic
1111104914 13:83632277-83632299 CTAGAAATAAAGAAGGAGAATGG + Intergenic
1112457357 13:99574913-99574935 CTAAAAATACACAATTAGACAGG + Intergenic
1112797689 13:103074594-103074616 CTTAAAATCCTCAAGGAGACAGG - Intergenic
1112970839 13:105260251-105260273 CTTAAAATGTACCTGGAGAAGGG - Intergenic
1113043877 13:106133243-106133265 GCTAAAAGACACAAGGAGCAAGG + Intergenic
1113062496 13:106338241-106338263 ATTAGAATGCACAAGGGGAATGG - Intergenic
1113245236 13:108388021-108388043 CCTAAAATCCTCAAGGGGAACGG - Intergenic
1113440581 13:110325036-110325058 CTTCACATGCACAAGGAGGATGG + Intronic
1114877039 14:26732983-26733005 CTTGAAATACACTAAGAGAGTGG - Intergenic
1115009288 14:28524701-28524723 TTTAAAATAAAAAAGGAGAAGGG + Intergenic
1115385365 14:32790254-32790276 CTTGAAAGAGACAGGGAGAATGG + Intronic
1116038022 14:39652333-39652355 CCAAGAATACACATGGAGAAAGG + Intergenic
1116145864 14:41068503-41068525 CTTGAAAGACAAAAGGAAAAAGG + Intergenic
1116262326 14:42646455-42646477 CTTAAAAGTGACGAGGAGAATGG + Intergenic
1116360230 14:43985225-43985247 CTTAACAAACAAAAGGAGAAAGG - Intergenic
1116386687 14:44339416-44339438 TTTGAAATACAAAAGGAGACAGG - Intergenic
1116983799 14:51198179-51198201 CTCAAAATACTCATGGTGAAGGG - Intergenic
1117269232 14:54124615-54124637 CTTAGAATACACAAGAAGAAAGG + Intergenic
1119250350 14:73147354-73147376 CTTATTTTACAAAAGGAGAAGGG - Intronic
1119531776 14:75366614-75366636 CTTAAAATACACAAGCCGGCTGG - Intergenic
1119708433 14:76802905-76802927 CTTCAAAGCAACAAGGAGAATGG - Intronic
1119750308 14:77072647-77072669 CTTAAAATACAAAATTAGCAGGG + Intergenic
1120908532 14:89643281-89643303 CTAAAAATACAAAATTAGAAGGG + Intergenic
1121106358 14:91282445-91282467 TTTAAAATATGCAAAGAGAAAGG - Intronic
1121164034 14:91774685-91774707 CTTACAACACAACAGGAGAAAGG + Intronic
1121949718 14:98160854-98160876 CAAAAAATAAACAAGGTGAAAGG - Intergenic
1123433710 15:20239501-20239523 CTTACAATCCACAAGCTGAATGG + Intergenic
1124197090 15:27640683-27640705 CCTAAAAGAGACAGGGAGAATGG + Intergenic
1126008410 15:44280181-44280203 TTAAAAATACACAATGAAAAAGG + Intergenic
1127257752 15:57306433-57306455 CTGAAAATAAACACGGGGAAAGG - Intergenic
1127871041 15:63073919-63073941 ATTAATATAAAAAAGGAGAACGG + Intergenic
1128392998 15:67195761-67195783 TTCAAAACACCCAAGGAGAAAGG + Intergenic
1128402301 15:67296002-67296024 AATAAAATACACTAGGATAATGG - Intronic
1129873610 15:78957607-78957629 TTTAAAATACCCAAGGAGGCTGG - Intergenic
1129952934 15:79607887-79607909 TTTGAAAAACACAATGAGAAAGG + Intergenic
1133866828 16:9651878-9651900 ATTAAAATATAGAAGGGGAATGG + Intergenic
1134423833 16:14119420-14119442 TTTAAAATACATAAGGAGGCAGG + Intronic
1136638810 16:31544262-31544284 CTTAAAATATATAAGAAGACAGG + Intergenic
1136698877 16:32114535-32114557 CTTAAAATAGACAAGGAGAATGG + Intergenic
1136799384 16:33057834-33057856 CATAAAATAGGCAAGGAGAATGG + Intergenic
1136850908 16:33611609-33611631 CTTACAATCCACAAGCTGAATGG - Intergenic
1139415323 16:66803410-66803432 TTTATAATAAAAAAGGAGAAAGG + Intronic
1140682035 16:77394568-77394590 CTTAATATACAGAAAGAGGAGGG + Intronic
1203112511 16_KI270728v1_random:1460066-1460088 CTTACAATCCACAAGCTGAATGG - Intergenic
1143431448 17:6890151-6890173 ATGAAAATACACAATCAGAAGGG - Intronic
1143825034 17:9598598-9598620 CTAAAAATACACAAGTAGCCAGG + Intronic
1144264788 17:13557657-13557679 CTGAAAATACAAAAGTAGAAAGG + Intronic
1144616741 17:16782950-16782972 CCTGAAAAAGACAAGGAGAATGG - Intronic
1144895950 17:18532711-18532733 CCTGAAAAAGACAAGGAGAATGG + Intergenic
1145136263 17:20411509-20411531 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1145709767 17:26961404-26961426 CTTAAAATAGGCAAGGAAAATGG + Intergenic
1146236284 17:31166799-31166821 CTTAACATCCACATGGAGACTGG - Intronic
1146430316 17:32787172-32787194 ATTAAAAGACATAAAGAGAATGG + Intronic
1146966330 17:37034165-37034187 CTTAGGAAACACAATGAGAATGG - Intronic
1147030201 17:37627766-37627788 CTTAAAAAAAACAAAAAGAACGG - Intronic
1149110557 17:53023394-53023416 TATGAAATACACAAAGAGAAGGG + Intergenic
1149622186 17:58054209-58054231 CTGAAATTTCACAAGTAGAAAGG - Intergenic
1151108244 17:71644315-71644337 CCTGAAAGACACATGGAGAACGG + Intergenic
1153205355 18:2693790-2693812 CTTAAAATACAAAAGTAGCCAGG - Intronic
1153654824 18:7273236-7273258 CTAAAAAAACAAAAGGATAATGG + Intergenic
1155487673 18:26364041-26364063 CAAAAAATACTCAAGGACAAAGG - Intronic
1155884132 18:31186800-31186822 CATAAAATCCACCAGGACAAAGG + Intergenic
1156165186 18:34410674-34410696 CTTAAAATAAACAAATAAAAAGG - Intergenic
1156171503 18:34492339-34492361 CTTCACATACACCAGGTGAAAGG + Intergenic
1156417637 18:36914073-36914095 CTGAAAATATACAAGAAGGAAGG + Intronic
1156709023 18:39919351-39919373 CTTAAAATACAAATAGTGAAGGG + Intergenic
1157316847 18:46598284-46598306 CTTACAATATAAAAGTAGAAGGG + Intronic
1157963265 18:52180489-52180511 GCTAAAATCCAGAAGGAGAAAGG + Intergenic
1160107607 18:75992959-75992981 CTTAACATACAGGGGGAGAAAGG + Intergenic
1160118197 18:76101789-76101811 GTTAAAAAAAAAAAGGAGAAAGG + Intergenic
1160177599 18:76608584-76608606 ATTAACATAAACAAGTAGAAAGG + Intergenic
1162599068 19:11653390-11653412 TCTAAAATAAACAAGGAGCATGG - Intergenic
1163399563 19:17083956-17083978 ATTTAAATACACAAAGTGAATGG + Intronic
1164781063 19:30893253-30893275 CTGAAAACACAGATGGAGAATGG + Intergenic
1165029922 19:32990613-32990635 CTTACAATCCACAAGCTGAATGG + Exonic
1167341748 19:48920682-48920704 CTAAAAATACAAAATGAGCAGGG - Intronic
1168364043 19:55769573-55769595 CTTTTAATTCAGAAGGAGAAAGG + Intronic
1168670128 19:58234665-58234687 CTAAACATACACATGCAGAAAGG + Intronic
925770446 2:7277228-7277250 CATAAAATACACATGAAGAATGG + Intergenic
926028618 2:9566214-9566236 CTAAAAATACAAAATGAGCAGGG + Intergenic
926746338 2:16161435-16161457 CTGGAAATACACAGGGAGGATGG + Intergenic
927831619 2:26356130-26356152 CTTAAAATACAAAAAAAGTAGGG - Intronic
928652549 2:33418237-33418259 CTTAGAATAGACATGGAAAAAGG + Intergenic
928808077 2:35186141-35186163 CTTAAAATAGATAAGGTAAAAGG - Intergenic
929421191 2:41791555-41791577 CTGAAAATGAAAAAGGAGAATGG + Intergenic
929532016 2:42758720-42758742 TTTTAAATACAGGAGGAGAAGGG - Intergenic
930520093 2:52454790-52454812 TTTAAAATAGATAAGGATAAAGG - Intergenic
931101561 2:59007619-59007641 CTTAAAATACTCTAGAAGTAGGG + Intergenic
931402411 2:61943327-61943349 ATGAAAAAACACAAGGAGAGTGG - Intronic
931492623 2:62765767-62765789 CTCAAAATACAAAATGAGAGGGG + Intronic
931642146 2:64391415-64391437 CTTTAAACTCACAATGAGAAGGG + Intergenic
932233924 2:70106113-70106135 CTAAAAATACAAAATTAGAAGGG - Intergenic
933583215 2:84150704-84150726 CTAAAAAAACAGAAGGTGAATGG + Intergenic
933672223 2:85019514-85019536 CATAAACTAAACAATGAGAAAGG + Intronic
933987877 2:87607880-87607902 CTTAAGATCCACAATGAGAAAGG - Intergenic
934622683 2:95824811-95824833 CCTGAAAGAGACAAGGAGAATGG - Intergenic
934782485 2:96980370-96980392 TTTAAATTACATAAGGAGACCGG - Intronic
934811092 2:97277292-97277314 CCTGAAAGAGACAAGGAGAATGG + Intergenic
934826600 2:97430647-97430669 CCTGAAAGAGACAAGGAGAATGG - Intergenic
935035203 2:99364481-99364503 CTTAATGTTCAGAAGGAGAATGG + Intronic
935501023 2:103838946-103838968 CTTCAACTTCATAAGGAGAAGGG - Intergenic
936305964 2:111342928-111342950 CTTAAGATCCACAATGAGAAAGG + Intergenic
936592751 2:113819685-113819707 ATTAATATTCAAAAGGAGAAGGG + Intergenic
936641575 2:114317640-114317662 TGTAAAATACCCAAGGAGAGAGG - Intergenic
937709829 2:124967466-124967488 CTGCTAATACACAAGAAGAAAGG - Intergenic
938265382 2:129924325-129924347 CTAAAAATACAAAAAGAAAACGG + Intergenic
938692205 2:133801999-133802021 CTGCAAAGACACAAGGAGAGGGG - Intergenic
938954436 2:136284965-136284987 CTTAAAGTAGGCAAGGAGGAAGG - Intergenic
939609975 2:144298334-144298356 CTTAAGATAAACAAGCTGAAGGG + Intronic
941008432 2:160270639-160270661 TTTAAAATTCACTAGGAGAAAGG - Intronic
941202774 2:162533476-162533498 TTTAAAATACAGAAAGAAAATGG + Intronic
941453435 2:165687653-165687675 TTTAAATAACACAAGGACAAAGG - Exonic
942265925 2:174225387-174225409 CTAAAAATACAAAATTAGAAGGG + Intronic
942455369 2:176134832-176134854 TTTAAATTACACAAGCAGATGGG - Intergenic
942757887 2:179363606-179363628 CTTGGAATAGACAAGGAGATAGG - Intergenic
943350112 2:186786821-186786843 CCTAAAATAGACAGGGAGAATGG + Intergenic
943897846 2:193390235-193390257 CATAAAGTCCACAAGGAGAAAGG - Intergenic
946118550 2:217487796-217487818 CTTTAAATGCAAAAGAAGAAAGG + Intronic
946655501 2:221941601-221941623 CTTCAAATAAAAAATGAGAATGG - Intergenic
948099671 2:235363858-235363880 CTAAAAATACAAAAGTAGCAGGG - Intergenic
948787676 2:240361410-240361432 CTCAACAAACCCAAGGAGAATGG + Intergenic
1170199924 20:13731757-13731779 CTTAAGATGCACAATTAGAAAGG - Intronic
1170695786 20:18657327-18657349 CTGAAAAAAAACAAGGGGAAAGG + Intronic
1171022452 20:21598305-21598327 TTAAAAAGAGACAAGGAGAATGG - Intergenic
1171158246 20:22896646-22896668 CTTAAAAAACACAAAGAGAGTGG + Intergenic
1171430931 20:25082666-25082688 CTGAAAATCCCCAAGGGGAAAGG + Intergenic
1173218178 20:41107724-41107746 TTCAAAAGACACAAGGAAAATGG - Intronic
1174837318 20:53869771-53869793 CTTAAAATAGACAAAAGGAAAGG + Intergenic
1177694734 21:24556355-24556377 CTTAAAAGTGACAGGGAGAATGG + Intergenic
1178539354 21:33436192-33436214 CTTAAAATACAAAATTAGCAGGG + Intronic
1180241957 21:46514820-46514842 CTTTTAACAAACAAGGAGAAGGG - Intronic
1183889778 22:40917410-40917432 TTTAAAAAACACAAGGAATAGGG + Intronic
1185304939 22:50109839-50109861 CTTAAAAAATAAAAAGAGAAAGG + Intronic
1203289401 22_KI270735v1_random:19133-19155 CTTAAAATAGGCAAGGAAAATGG - Intergenic
949248319 3:1951726-1951748 CTTAAACTCCACAAAGAGAAAGG + Intergenic
950174266 3:10861569-10861591 CTTAAAAAAATCATGGAGAAAGG + Intronic
950699843 3:14735063-14735085 CTTAAAATAAAGGAGCAGAAAGG - Intronic
951140944 3:19158964-19158986 CTTAAAGTTAAGAAGGAGAAGGG - Intronic
951167413 3:19499322-19499344 CCTGAAAGTCACAAGGAGAATGG + Intronic
951175553 3:19594869-19594891 CCTGAAAGTCACAAGGAGAATGG - Intergenic
951962391 3:28342970-28342992 CTTAAAATACACAAACTGCAGGG - Intronic
952096038 3:29955490-29955512 CTTAGAATATCCAAGGAAAATGG - Intronic
952592404 3:34972806-34972828 CTTAAAATACAAATGTGGAAAGG + Intergenic
952694743 3:36251492-36251514 CCTAAAATAAATGAGGAGAATGG + Intergenic
953017785 3:39094913-39094935 CTTAATCTACACATGGAGACTGG - Exonic
953707840 3:45244686-45244708 GTTAAATTAAACAAGGGGAAAGG + Intergenic
953946973 3:47157710-47157732 CTAAAAATACAAAAGTAGACAGG + Intronic
954086801 3:48251095-48251117 ATTAAGATTCACAGGGAGAATGG - Intronic
954141764 3:48610545-48610567 CTAAAAATACAAAAGTAGACGGG + Intronic
954522448 3:51241529-51241551 CTTAAAATAGACGGGGAGAATGG - Intronic
954954812 3:54509831-54509853 CTTAAAATTCACAAGTTGAGTGG + Intronic
956157752 3:66316726-66316748 CCTGAAAGAGACAAGGAGAATGG - Intronic
956237061 3:67084078-67084100 CTGAAAATACAAATGGACAATGG - Intergenic
956974425 3:74563831-74563853 CAGAAAACACACAATGAGAACGG - Intergenic
957758163 3:84519026-84519048 CAGAAATTACACAAGGGGAAAGG - Intergenic
958650349 3:96929833-96929855 CCTGAAAGAGACAAGGAGAATGG - Intronic
958759457 3:98290567-98290589 CTCAAAAGAGACATGGAGAATGG - Intergenic
959030935 3:101299007-101299029 CCTGAAAAAGACAAGGAGAAAGG - Intronic
959372921 3:105551575-105551597 CTTAAAATGGACAAAGAGCATGG + Intronic
959630578 3:108502850-108502872 CTTGAAATACAGAAAGTGAAGGG - Intronic
959984473 3:112557338-112557360 CTTAAAACTCACAAGGAGCCGGG + Intronic
960363245 3:116739837-116739859 CTTTAAATACATTAGGAGAAGGG - Intronic
961057486 3:123801354-123801376 CTTAAAATACACAAGGAGAAAGG + Intronic
963232408 3:142921726-142921748 CTAAAAATACAAAAGGAGCTGGG - Intergenic
963820569 3:149888057-149888079 CTTAAAATACACCTTGAGAGAGG + Intronic
963834658 3:150046031-150046053 TTTAAAAGACAGAAGGAGAGAGG + Intronic
964696429 3:159512976-159512998 CTTAAAATACAGCAGGTGAATGG + Intronic
965869047 3:173244668-173244690 ATTGAAATACAGAAGGAAAAAGG - Intergenic
966080735 3:175997008-175997030 CCTGAAAGACACAGGGAGAATGG + Intergenic
967490391 3:190083979-190084001 TTTAAAAAACATAATGAGAATGG - Intronic
969097569 4:4745173-4745195 CTTAAAAAAAAAAAGTAGAAGGG + Intergenic
971150511 4:24026488-24026510 ACTTAAATACAAAAGGAGAAAGG - Intergenic
971411496 4:26377746-26377768 CTTAAAATAAAAACAGAGAAAGG - Intronic
972693143 4:41419508-41419530 CATAAGCTTCACAAGGAGAAAGG - Intronic
973726140 4:53777988-53778010 TTTAAAATTCAGAAGGAGATTGG + Intronic
973879556 4:55255263-55255285 TTTAAAATACACAAGTGGTATGG + Intergenic
974087935 4:57280994-57281016 CTTAAAAAACACTAAGAGAGTGG + Intergenic
974319082 4:60321478-60321500 CTCAGAAAACACAAGGATAAAGG + Intergenic
974461960 4:62199669-62199691 ATTAAAATCCACAAGTAGAAGGG - Intergenic
974627216 4:64441088-64441110 GTTAAAACAGAAAAGGAGAATGG - Intergenic
974728034 4:65822019-65822041 CTTAAAAAATAAAAGGAGGAAGG - Intergenic
975167341 4:71191982-71192004 ATAAAAATACAAAATGAGAAAGG + Intronic
975181574 4:71351697-71351719 CTAAAAATACAAGTGGAGAAGGG + Intronic
975233141 4:71958241-71958263 CTTTAAATATTCAAGGAAAACGG - Intergenic
975248752 4:72152246-72152268 CAAAAAATACACAGGGAAAATGG - Intergenic
976446328 4:85134007-85134029 TTTTAAAGACATAAGGAGAAAGG - Intergenic
976463683 4:85343318-85343340 GTTAATATTCAAAAGGAGAAAGG - Intergenic
976725390 4:88211196-88211218 TTTAAAATACACAATGAAAGTGG - Intronic
976988812 4:91337899-91337921 TTTAAATTACATAAGGAGAGAGG + Intronic
978053119 4:104228228-104228250 CTTGAAATACACCAAGACAAAGG + Intergenic
978617357 4:110611039-110611061 CTCAAACTCCGCAAGGAGAACGG + Intergenic
978689139 4:111485224-111485246 CCTAAAAGAGACAGGGAGAATGG + Intergenic
979867812 4:125777802-125777824 CTAAAAATAAAAAAGGAGCATGG + Intergenic
980008731 4:127570904-127570926 CTTAAAACCCACAAGATGAAAGG - Intergenic
980223152 4:129946566-129946588 CTTAAAAGTGACAGGGAGAATGG - Intergenic
980321415 4:131283078-131283100 CTTAAAATAATCAGGGAGATAGG + Intergenic
980545027 4:134249102-134249124 CTGAAAACAGACAAGGAAAAAGG + Intergenic
980581319 4:134756472-134756494 CTAAAACAACACAAGGAGAATGG + Intergenic
981237695 4:142437318-142437340 CTTGAAAGAGACAAGGAGAGTGG + Intronic
981539241 4:145831765-145831787 CTTAAAATGCAGGAGGAAAAAGG + Intronic
981579122 4:146234874-146234896 CTTTAAATTCACAAAGAAAATGG + Intergenic
983042774 4:162949770-162949792 CATGTAATACACAAGGAAAATGG - Intergenic
983681851 4:170362460-170362482 CCTGAAATTCACAGGGAGAATGG - Intergenic
983794198 4:171839746-171839768 ATGAAAATTCACAAGCAGAAAGG + Intronic
983990652 4:174115218-174115240 ATTAATATACACAATAAGAAAGG - Intergenic
983997359 4:174200002-174200024 TTTAAAATAAATAAGAAGAAAGG - Intergenic
987119588 5:14754218-14754240 TTTAAAATAGAGAAGGAAAATGG + Intronic
987463075 5:18237616-18237638 TTTTAAATAGACAAGAAGAATGG - Intergenic
987692125 5:21280914-21280936 CTTAAAAAAGAGAAGGAAAAAGG + Intergenic
988497098 5:31754563-31754585 CTTAAAATACACAAAGAAGCTGG - Intronic
988904145 5:35768651-35768673 TTTAAAGTCCACAAGGAAAAGGG - Intronic
989019306 5:36982850-36982872 CTTAAGATACACAACGACATAGG - Intronic
989183487 5:38600941-38600963 GGTAAACTACACAAGGACAAAGG + Intronic
990775472 5:59301181-59301203 CTTAAAAGCCACAATCAGAAAGG + Intronic
991152256 5:63384114-63384136 CATAAAATACCCAAGTAGATGGG - Intergenic
991227659 5:64291752-64291774 CCTGAAAGAGACAAGGAGAATGG - Intronic
991936582 5:71808002-71808024 ATTAAAATACACATGGACATTGG + Intergenic
992132899 5:73712329-73712351 CTCACAATTCACAAGGACAAAGG - Intronic
992292608 5:75294696-75294718 CTAAAAATACAAAAGTAGACGGG + Intergenic
993643953 5:90439974-90439996 CTTAAAAAAGAAAAGGAGAATGG + Intergenic
993699523 5:91101560-91101582 CTCAAAATAGACAAGTGGAAAGG + Intronic
994595076 5:101821759-101821781 CATAAAAGACACACTGAGAAAGG - Intergenic
994626867 5:102231069-102231091 CTTTAAATAAACAGAGAGAAAGG + Intergenic
996143766 5:119948034-119948056 CTGAAAGTAGACAAGAAGAATGG + Intergenic
997155994 5:131558600-131558622 CTTAAATTTCACAACAAGAAAGG + Intronic
999732994 5:154489971-154489993 CTAAAAATACACATGGAAATAGG - Intergenic
1000735218 5:164890810-164890832 CTTTAAATACACATAGAGACAGG + Intergenic
1000970790 5:167712046-167712068 CCTAAAATAAACTATGAGAAGGG + Intronic
1001489656 5:172146439-172146461 CTCAAGAAACACAAGGAAAACGG + Intronic
1001899294 5:175411051-175411073 ATTAAAAGAGAGAAGGAGAATGG + Intergenic
1002255823 5:177958075-177958097 ATTAAAATACAAAAGGAGGCCGG - Intergenic
1003361126 6:5426161-5426183 ATTAAAAGACACAAGGAAATAGG + Intronic
1003845173 6:10166368-10166390 CTTAAAATACATAAGGAAGCAGG + Intronic
1005979048 6:30822147-30822169 ATTAAGATAAACAAAGAGAATGG + Intergenic
1006536506 6:34703296-34703318 CTAAAAATACAAAAGTAGCAGGG + Intergenic
1007133849 6:39501867-39501889 CCTAAAAGAGACAGGGAGAATGG + Intronic
1007489920 6:42212196-42212218 CTTCAAATTCACAATGAAAAAGG + Intronic
1007618574 6:43197460-43197482 CTTAAAACAAAAAAAGAGAAAGG - Intronic
1007961464 6:45963650-45963672 CTTAAAAAAAAAAAGTAGAAAGG + Intronic
1008276881 6:49552351-49552373 TTTGAACTACACAAGGAGAATGG - Intronic
1008840019 6:55891529-55891551 TTACAAATACACAATGAGAAAGG - Intergenic
1009518973 6:64657964-64657986 CCTGAAATTGACAAGGAGAATGG - Intronic
1010749700 6:79604217-79604239 CTCAAAATCCACATGGACAAAGG + Intergenic
1010913966 6:81592891-81592913 ATCCAAATACAAAAGGAGAAAGG - Intronic
1011190005 6:84718594-84718616 CTTAAAATACAGAACCAGAAAGG - Intronic
1011709306 6:90035909-90035931 AAGAAAATACCCAAGGAGAAGGG + Intronic
1011800458 6:91008469-91008491 CTAAAAATACTGAAAGAGAATGG - Intergenic
1011888357 6:92126116-92126138 CAGCAAATGCACAAGGAGAAGGG - Intergenic
1012175691 6:96079466-96079488 CTTTAAATACTCAAGGGGAATGG - Intronic
1012200097 6:96395186-96395208 CTTAAAATACAAAAGGAGTTTGG + Intergenic
1012676278 6:102116673-102116695 CTTAAACTTAACAAGGAAAAGGG - Intergenic
1012774002 6:103479949-103479971 CTCAATATCCACAGGGAGAAAGG + Intergenic
1012987478 6:105890251-105890273 CTTAAAAAACAAAAGGACAGGGG + Intergenic
1013231004 6:108162442-108162464 ATTAAAATACCGAAGGTGAAAGG - Intronic
1013470197 6:110457384-110457406 CTCAAAAAACAAAAGGATAAGGG + Intronic
1013721448 6:113034370-113034392 CTTAAAATACAAAAAGGGAGTGG - Intergenic
1014326262 6:119999052-119999074 CTTCAAATAGATTAGGAGAAAGG - Intergenic
1014471753 6:121823821-121823843 CTTAAGTAACACAAGTAGAAAGG + Intergenic
1014835727 6:126158356-126158378 CAGAAAATACAAAAGGACAAAGG - Intergenic
1017466174 6:154695911-154695933 CAAAAAATAAACAAGGATAAAGG + Intergenic
1018082741 6:160272347-160272369 CTGAATATACACATGGACAATGG - Intronic
1018479575 6:164176511-164176533 TTGAAAAGACACAAGGAGATGGG - Intergenic
1020398092 7:7740814-7740836 GTTAAAAGAGAAAAGGAGAAAGG - Intronic
1020713505 7:11638709-11638731 TATAAAATACTCAAGGAGACTGG + Intronic
1020798176 7:12701047-12701069 CATAAAAGACACAAGAAGACTGG - Intergenic
1022257840 7:28677098-28677120 CTTAAAATAGAAGAGGGGAAAGG + Intronic
1022647557 7:32245276-32245298 CTAAAGATAAACAAAGAGAAGGG - Intronic
1023130959 7:37002819-37002841 CTTAGAATACAGAAAGAGCAAGG + Intronic
1023277155 7:38532194-38532216 ATTAGAAGAGACAAGGAGAAAGG - Intronic
1024568356 7:50703159-50703181 CTTAAATTACTTAATGAGAAAGG - Intronic
1024613622 7:51088437-51088459 TTTAAAATACATAACAAGAAGGG - Intronic
1024775052 7:52774284-52774306 CTTAAAAAACAGAGGGAAAAAGG + Intergenic
1024868698 7:53935305-53935327 AATAAAATACACAAGGTAAATGG + Intergenic
1025289658 7:57704305-57704327 CTTAAGATCCACAACCAGAAAGG + Intergenic
1026420635 7:70233458-70233480 TGTGAAAGACACAAGGAGAATGG + Intronic
1026508250 7:71005185-71005207 CATAAAATGGTCAAGGAGAATGG + Intergenic
1027499186 7:78926769-78926791 TTTAAATTACAAAAGGAGACTGG - Intronic
1027812365 7:82920470-82920492 GTGAAAATAGACAAAGAGAAGGG + Intronic
1028080464 7:86568710-86568732 CCTAAAATTGACCAGGAGAATGG + Intergenic
1028404495 7:90461014-90461036 CTTAAGATCCACAATCAGAAAGG + Intronic
1029049845 7:97674056-97674078 CTTACTTTACACAAGGAGAGTGG + Intergenic
1029878138 7:103775648-103775670 CTTACAATAAACAATGAAAATGG + Intronic
1029930732 7:104367927-104367949 CTTAAAGTTCAAAAGGACAAGGG - Intronic
1031255898 7:119448640-119448662 CTTAAAAGACACAAAGTGAAAGG - Intergenic
1031492963 7:122411559-122411581 CTTAAAACAAAAAAGGAGGATGG + Intronic
1032607257 7:133369283-133369305 CTTTAAAAAGAAAAGGAGAAAGG - Intronic
1034015315 7:147577512-147577534 CTTTGTATACACAAGTAGAATGG - Intronic
1034027513 7:147722179-147722201 CATGAAATCCACAAAGAGAAGGG - Intronic
1035099259 7:156382787-156382809 CTTTAAATAGAAAAGAAGAAAGG - Intergenic
1036124111 8:6047355-6047377 CTTAAAATACTCCAGTAGCATGG + Intergenic
1037510761 8:19579442-19579464 CTTAATTTACACCAGGGGAAAGG - Intronic
1037514135 8:19612661-19612683 CGGAAGCTACACAAGGAGAATGG - Intronic
1038406014 8:27323483-27323505 CTTGAGATACAGAAGTAGAAGGG + Intronic
1038667372 8:29550774-29550796 CTTCAAATATACAAGGAGTCTGG - Intergenic
1039265314 8:35817231-35817253 CCTAAAAGAGACAGGGAGAATGG + Intergenic
1041589616 8:59561880-59561902 CATAAAAATCACAAGAAGAAGGG + Intergenic
1041590461 8:59575166-59575188 CTTATATTACAAAAGTAGAATGG + Intergenic
1042479709 8:69289721-69289743 CTGAACATACACAAAGAAAATGG - Intergenic
1042620799 8:70701528-70701550 CTAAAAATATACAAAGAGAAAGG - Intronic
1042711335 8:71720637-71720659 CTTCAAATGCCCAAAGAGAAGGG - Intergenic
1042772613 8:72395889-72395911 TTTAAAATTTTCAAGGAGAAGGG + Intergenic
1042931877 8:74022244-74022266 CTAAAAATACAAAAGTAGATGGG + Intronic
1043112333 8:76201590-76201612 CTTAAAATTCCCTAGGAAAATGG + Intergenic
1043218263 8:77622916-77622938 CTGAAAAGACAAAAAGAGAATGG - Intergenic
1044000692 8:86876584-86876606 ATTAAAATACATAAGAAAAATGG - Intronic
1044360966 8:91283233-91283255 TTAAAAATACAGAAAGAGAAGGG + Intronic
1044397570 8:91730920-91730942 CTAAAAATACACAATTAGCAGGG + Intergenic
1045342870 8:101269996-101270018 CTTATAATCCACAGGGAGAGTGG + Intergenic
1045550640 8:103169031-103169053 TTTAAAAGACACAGGGAGATGGG - Intronic
1045606118 8:103778910-103778932 CTTCAAAAAGACAAGGATAAGGG - Intronic
1045713605 8:105015482-105015504 GGTAAAATCCTCAAGGAGAAAGG - Intronic
1045991523 8:108314349-108314371 CTTAAGATTCACAATCAGAAAGG - Intronic
1046134407 8:110008300-110008322 CTTAAAACAAAAAAGGAAAATGG - Intergenic
1047595459 8:126373415-126373437 CTTAAAATAGAACAGGAGGAAGG - Intergenic
1047954865 8:129966442-129966464 TTTTAAATACAAAAGAAGAAAGG + Intronic
1048094163 8:131273420-131273442 CACAACAAACACAAGGAGAATGG - Intergenic
1048269711 8:133018860-133018882 CTTAAAGTACTCCAGGAAAAGGG + Intronic
1048505455 8:135016743-135016765 CCCATAATACATAAGGAGAAGGG - Intergenic
1048868174 8:138776141-138776163 CTTAGACTACACAGGGAGACAGG - Intronic
1048931892 8:139321786-139321808 CATAAATTCCACAGGGAGAATGG - Intergenic
1050549660 9:6738313-6738335 CTAAAAATACAAAATTAGAAGGG + Intronic
1050673098 9:8020001-8020023 CTTAAAATGGACAAAGACAAAGG - Intergenic
1051465667 9:17374696-17374718 CTAAAAATACAAAATGAGAGGGG + Intronic
1051643086 9:19241725-19241747 TTTAAAAAACATAAGTAGAACGG + Intronic
1051983070 9:23047229-23047251 CCTGAAAGAGACAAGGAGAATGG + Intergenic
1052393086 9:27904214-27904236 CTTAAAATTCATAAGGAAACAGG + Intergenic
1052550617 9:29942700-29942722 CTTAATCTATACAAGAAGAAGGG - Intergenic
1052950180 9:34202443-34202465 CTTAAGACTCACAATGAGAAAGG + Intronic
1053195114 9:36111553-36111575 CTAAAAATACAAAATTAGAATGG - Intronic
1054922934 9:70559935-70559957 TTTAAAATACACAGGGGGCAGGG - Intronic
1055186655 9:73464612-73464634 CTTAAAATATAAAAAAAGAATGG - Intergenic
1056899986 9:90589246-90589268 CTTATATTACAGAAGAAGAAAGG + Intergenic
1057536878 9:95918751-95918773 TTTAAAAAACACAATGAGAATGG - Intronic
1057563280 9:96145715-96145737 ATTAAAACACACAAGGAGGCTGG - Intergenic
1057658556 9:96978948-96978970 CTTAAAAAACAAAAGGAGGCCGG + Intronic
1058199912 9:102026845-102026867 CCTGAAAAAGACAAGGAGAATGG - Intergenic
1058295995 9:103307518-103307540 TGTAAAAGACAAAAGGAGAATGG - Intergenic
1058398332 9:104582466-104582488 TTTTAAAAACACATGGAGAATGG + Intergenic
1058446270 9:105058060-105058082 CTTAAAATACAAAATTAGCAGGG - Intergenic
1058514256 9:105753199-105753221 CTTGAAAGAGACGAGGAGAATGG + Intronic
1059095176 9:111405656-111405678 ATTAAAATACACAATAAGTAAGG + Intronic
1059207926 9:112483985-112484007 CTTAAAAAACACATGCACAAAGG - Intronic
1059702050 9:116784766-116784788 CTGAAAATACAAAAGTAGACAGG + Intronic
1059943518 9:119381948-119381970 CTAAGAAAACACAGGGAGAAAGG - Intergenic
1060070025 9:120538387-120538409 CTTAAAATAGATAAGGAGACAGG + Intronic
1061448315 9:130654592-130654614 CTAAAAATACAAAAGTAGACGGG + Intergenic
1061765751 9:132880144-132880166 CTTAAAATAAATGAGGAGAAAGG - Intronic
1062105305 9:134751914-134751936 ATTAAAATACACAAGATAAAAGG - Intronic
1062330399 9:136040434-136040456 ATTAAAATAAAATAGGAGAACGG + Intronic
1185731711 X:2466902-2466924 CTAAAAATACAAAAGTAGCAGGG + Intronic
1187942578 X:24396282-24396304 CTTACAATACAAAAGAAGAAAGG - Intergenic
1188922667 X:35996955-35996977 TTTAAAAAACAACAGGAGAATGG - Intergenic
1189681906 X:43525774-43525796 CTAAAAATACAAAATTAGAAGGG + Intergenic
1190526976 X:51338270-51338292 CTTAAAGAACAGAAGTAGAAGGG - Intergenic
1191024176 X:55896060-55896082 CTTACAATACAAAAAAAGAAAGG - Intergenic
1191784741 X:64905333-64905355 TATAAAATACAGAAGGAGAGAGG + Intergenic
1191936882 X:66436483-66436505 CTTAAAATTCTCAAGGGAAAAGG + Intergenic
1192005852 X:67211418-67211440 CTTTATATAAAGAAGGAGAAAGG + Intergenic
1192277329 X:69647301-69647323 CCTAAAAGAGACAGGGAGAATGG - Intronic
1192746857 X:73947823-73947845 CTTAAAAGAAAAAAGGAAAATGG + Intergenic
1193117815 X:77792306-77792328 CCAAAACTACACAATGAGAAAGG + Intergenic
1193370035 X:80684637-80684659 TTTAAAATCAAGAAGGAGAAAGG - Intronic
1195199685 X:102535625-102535647 CTTAAAATACAAAATTAGCAGGG + Intergenic
1196574684 X:117304366-117304388 CTTCAAATACAGAAGCACAAAGG + Intergenic
1196752287 X:119128834-119128856 CTAAAAATACACAATTAGCAGGG - Intronic
1196791148 X:119466278-119466300 CTTAAAATACACGCGGTGATAGG + Intergenic
1197423897 X:126271994-126272016 CTTGAAAGACACAGAGAGAATGG - Intergenic
1198241285 X:134789139-134789161 CCTAAAATAAACAAAGGGAAGGG + Exonic
1199602190 X:149548090-149548112 CTCCAAATAAACAAGGACAATGG + Intronic
1200002739 X:153070610-153070632 CTTATATCACAAAAGGAGAAAGG + Intergenic
1200004984 X:153079399-153079421 CTTATATCACAAAAGGAGAAAGG - Intergenic
1201773636 Y:17642231-17642253 CTTAAAATACAAAATTAGGAGGG - Intergenic
1201827920 Y:18263754-18263776 CTTAAAATACAAAATTAGGAGGG + Intergenic