ID: 961058389

View in Genome Browser
Species Human (GRCh38)
Location 3:123808125-123808147
Sequence CAGTGAAGGGTGAAGGAGGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 703
Summary {0: 1, 1: 0, 2: 4, 3: 58, 4: 640}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961058389 Original CRISPR CAGTGAAGGGTGAAGGAGGC TGG (reversed) Intronic
900154727 1:1199323-1199345 CAGGGAGGGGTGAAGCAGGAGGG + Intergenic
900177002 1:1295395-1295417 CAGGGCAGGGCCAAGGAGGCTGG - Intronic
900484433 1:2914719-2914741 CAGAGCAGGATGAGGGAGGCTGG + Intergenic
900760316 1:4466123-4466145 AAGTGAAAGGTGAAGGGTGCAGG + Intergenic
900919302 1:5660731-5660753 GGGTGAGGGGTGAAGGGGGCTGG - Intergenic
901685148 1:10939589-10939611 CAGGGAAGGGGGATGGAGGCAGG + Intergenic
902012285 1:13280034-13280056 GATTGAAGGGTGAAGAATGCTGG + Intergenic
902052083 1:13571693-13571715 TAGTGTTGGGTGATGGAGGCTGG - Intergenic
902960119 1:19957384-19957406 TAGTGGAGGGTGAAGGAACCTGG + Intergenic
903229137 1:21911391-21911413 CAGGGAAGGGTGACAGAGGAGGG - Intronic
903363561 1:22792368-22792390 CAGTTGAGGGAGAAGGAGGGGGG + Intronic
904019383 1:27450793-27450815 AAAAGAAGGGAGAAGGAGGCTGG - Intronic
904033246 1:27546135-27546157 AGGTGAAGGGTGAGGGACGCAGG + Intronic
905469302 1:38179770-38179792 GTGTCAAGGGTGAAGGAAGCAGG - Intergenic
905484835 1:38288182-38288204 CAGTGATGGGTGGAAGAGCCGGG + Intergenic
906116709 1:43361818-43361840 CAGTGAAGGCTGAATGTGGGGGG - Intronic
906151267 1:43588992-43589014 CAGTGAAAGGTGAGTGTGGCAGG + Exonic
906288568 1:44604334-44604356 CAGTGGAGGGTGGGGCAGGCAGG - Intronic
906747781 1:48233802-48233824 CAGTGGAGATTGGAGGAGGCTGG - Intronic
907099057 1:51811176-51811198 CAGGGAAAGGTAAAGGAGGAAGG - Intronic
907364316 1:53946409-53946431 CAGTGAAGGTGGGAGGAGGGAGG - Exonic
907738034 1:57134785-57134807 CAGTAAGGGGTGACAGAGGCAGG - Intronic
908487510 1:64610035-64610057 AAGTGAAGAGTGAAGCAGGGAGG + Intronic
909302006 1:74024309-74024331 CAGGGTAGGGTGAAGGAGTTGGG + Intergenic
910768984 1:90811723-90811745 AAGTGAAGTTTGAAGGGGGCTGG + Intergenic
910852901 1:91666099-91666121 CAGTGTTGGGAGAAGGAGGCTGG + Intergenic
910959360 1:92745233-92745255 CAGTAAAGAGTGAAAAAGGCTGG - Intronic
911101513 1:94099315-94099337 CTCTGGAGGCTGAAGGAGGCAGG + Intronic
911328812 1:96501658-96501680 CAGTGATCTTTGAAGGAGGCAGG + Intergenic
911679411 1:100697598-100697620 GAGTGAAGAGGGAAGGAGGGTGG - Intergenic
911969160 1:104408318-104408340 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
912579556 1:110707799-110707821 CAGAGAAGAGAAAAGGAGGCAGG - Intergenic
913209296 1:116570162-116570184 GTGTGGAGGGTGAAGGAGGATGG + Intronic
915252982 1:154603680-154603702 CACTGGAGGGTGATGGAGCCAGG + Intronic
915340676 1:155175061-155175083 CAGAGATGGGGGATGGAGGCAGG + Intronic
916264136 1:162873260-162873282 CAATGTAGGGAGAAGGAGCCAGG - Intergenic
917202599 1:172533159-172533181 CAGTGGCGGCTGCAGGAGGCGGG + Exonic
917238134 1:172916902-172916924 CAGTGATGGGTGATGGAAGATGG - Intergenic
918206049 1:182310267-182310289 TAGTGCAGGGTGAAGAAGGCTGG - Intergenic
920919736 1:210288667-210288689 CAGGGAAGGGTCCAGGAGGAGGG - Intergenic
921884153 1:220287639-220287661 CAGTGAAAAGTGAAGGAGGATGG - Intergenic
923394476 1:233547408-233547430 CAGTGCAGGGAGAAGGTGTCTGG - Intergenic
924416489 1:243861378-243861400 CTGTCCGGGGTGAAGGAGGCAGG - Intergenic
924743147 1:246809427-246809449 CATTGAAGTGGGAGGGAGGCAGG + Intergenic
1062926778 10:1322020-1322042 CAGAGGAGGGAGGAGGAGGCAGG - Intronic
1063335033 10:5203903-5203925 CAGTGAAGAGTGTGGGAGGCAGG + Intronic
1063509972 10:6635194-6635216 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063527204 10:6797184-6797206 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1063583626 10:7331561-7331583 CAGTGGTGGGTGCAGGAGACAGG - Intronic
1065070143 10:22015005-22015027 CAGTGCAGGGAGAGGAAGGCTGG - Intergenic
1065156010 10:22870860-22870882 CTCTGGAGGGTGAAGGAGGGAGG - Intergenic
1065299501 10:24308513-24308535 CACTGAATGGAGAAGAAGGCAGG + Intronic
1066009108 10:31177290-31177312 CAGTGAAGGGAGAAGGTGGAGGG - Intergenic
1067073028 10:43150796-43150818 CAAAGAAGGGGGAAGGAGTCAGG - Intronic
1067694117 10:48523389-48523411 CAGTCAAGGGTTAAGTCGGCCGG + Intronic
1068525208 10:58120968-58120990 CACTGAAGGGTGCAGGATGGAGG + Intergenic
1069862556 10:71480721-71480743 CAGAGAAGGCTGGAGGAGCCAGG + Intronic
1070371068 10:75782536-75782558 CTGTGAAGCGGAAAGGAGGCCGG + Intronic
1070407811 10:76112404-76112426 GAGTGAAGGGTGACGAGGGCCGG - Intronic
1070712651 10:78693929-78693951 GAGTCAGGGGAGAAGGAGGCTGG + Intergenic
1070920981 10:80186284-80186306 GACTGAAGGGGGAAGGAGGGGGG + Intronic
1070961458 10:80502856-80502878 CAGGGCAGGGTGAAGGAGCTAGG + Intronic
1071386119 10:85123075-85123097 CAGAGAAGGGGTGAGGAGGCAGG + Intergenic
1071614824 10:87065883-87065905 CACTGATGGGTGAAGGTGCCAGG + Intronic
1073302855 10:102481456-102481478 TAGTGATAGGTGAAGGAGGTTGG - Intronic
1073970366 10:109040942-109040964 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1074122211 10:110501189-110501211 CAGTCAAGAGAGAATGAGGCAGG - Intronic
1074422663 10:113323131-113323153 CACTGAAGTGCGCAGGAGGCAGG - Intergenic
1074883650 10:117678005-117678027 CAGTCAAGGGTGAGGGTGGAAGG + Intergenic
1075076738 10:119357054-119357076 AAGTGAGGTGTGAAGGTGGCTGG + Intronic
1075490150 10:122859714-122859736 CTGTGAGGGGTGAGGGAAGCAGG + Intronic
1075656241 10:124163001-124163023 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1076402301 10:130192262-130192284 CACTGAGGGGTGAACCAGGCTGG + Intergenic
1077027010 11:444682-444704 CAGTGAAGGGTGGAGAGGGAGGG + Intergenic
1077383637 11:2258978-2259000 GGGTGAAGGGTGAGGGAGGGAGG + Intergenic
1078181626 11:9016557-9016579 GCCTGAAGGGAGAAGGAGGCAGG + Intergenic
1078555754 11:12324800-12324822 CGGGGAAGGGTAAAGGAGGGTGG - Intronic
1078708746 11:13769907-13769929 TAGCTAAGAGTGAAGGAGGCTGG + Intergenic
1079511631 11:21217119-21217141 AAGTACAGGGTGAAGGAGGGGGG - Intronic
1080311161 11:30894302-30894324 CCGTGGTGGTTGAAGGAGGCTGG - Intronic
1080512739 11:32991104-32991126 CAGTGAAGCATGAAAGAGACAGG - Intronic
1081897322 11:46597700-46597722 GAATGAAGGGTGAAGGAGGGAGG + Intergenic
1082785262 11:57313184-57313206 CAGTGATGGGGGAGGGAGGCGGG + Exonic
1083048419 11:59755984-59756006 CAGGAAAGGGAGAAGGAGGCTGG - Intronic
1084084287 11:66847810-66847832 TGGTGAAGGGAGCAGGAGGCTGG - Intergenic
1084517713 11:69645468-69645490 CAGCGGTGGGTGAAGGAGGAGGG + Intronic
1084615266 11:70231615-70231637 CTGTGAGGGGGTAAGGAGGCAGG + Intergenic
1084751069 11:71204797-71204819 CTGGGAAGGGGGCAGGAGGCAGG + Intronic
1084953202 11:72678014-72678036 CAGGGGAGGGGGAAGGAAGCAGG - Intergenic
1085120476 11:73964397-73964419 CAGCGAAGGGTTATGGAGTCTGG + Intronic
1085172474 11:74461000-74461022 AAGTGAGGGTTGAAGGAGGAAGG + Intronic
1085801433 11:79593644-79593666 CAGGGAAGGGTCAAGGAGGAAGG - Intergenic
1086109078 11:83179165-83179187 CAGTGTTGGGTGAAGGAGAAAGG - Intronic
1086135702 11:83442284-83442306 CAGTGAAGGGAGATAGAGGTGGG + Intergenic
1086239320 11:84670201-84670223 CAGTGAGTGGTGAAGAAGACAGG - Intronic
1086775306 11:90823795-90823817 CAGTAAAAGGTGAAGGAGACAGG + Intergenic
1086920943 11:92585952-92585974 ATGTGAAGGGAGAAGGTGGCTGG + Intronic
1087153491 11:94879429-94879451 CATGGGAGGGTGAAGTAGGCAGG - Intergenic
1087962230 11:104366401-104366423 CAGTGAGAGGTGAAGCTGGCTGG - Intergenic
1088026627 11:105192725-105192747 CAGTGAAGAGTGAAAGAGAAAGG - Intergenic
1088558106 11:111083475-111083497 AAGAGAGGGGTGAAGGAGACGGG - Intergenic
1088577497 11:111285877-111285899 GGGTGAAGGGGTAAGGAGGCGGG - Exonic
1088589683 11:111392689-111392711 CAGTGAGGGATGAAGGAGCCAGG - Intronic
1088968814 11:114753108-114753130 TAGTGAAAGGTGAAGTGGGCTGG + Intergenic
1090225309 11:125068096-125068118 AAGTGAAGAGTGTTGGAGGCTGG - Intronic
1090229072 11:125088830-125088852 CAGTGGAAGGTGATGGGGGCCGG + Exonic
1090659269 11:128870381-128870403 CAGTGAGGGGTGCAGAAGGGAGG - Intergenic
1091730882 12:2879245-2879267 CTGTGAAAGGTGAAGGTGGGAGG - Intronic
1091843504 12:3637156-3637178 CACTGAAGGGAGGAGCAGGCAGG + Intronic
1092387912 12:8050410-8050432 CAGGGAAGAGAGAAGGAGGATGG + Intronic
1092409646 12:8243440-8243462 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1093373033 12:18387522-18387544 CAGTGGAGGGTGAAGGGGCGAGG - Intronic
1093850545 12:24031526-24031548 CAGAGGTGGATGAAGGAGGCTGG + Intergenic
1094325486 12:29233371-29233393 TAGTGAAGAGTGAAGGAGTGAGG - Intronic
1094385417 12:29888692-29888714 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1094698099 12:32841657-32841679 CAGTTAGTGGGGAAGGAGGCAGG - Intronic
1095449901 12:42319431-42319453 CAGTGAAAGATGAAGGAGATGGG - Intronic
1095642655 12:44502555-44502577 CAGTGAGAGGTGAAGTTGGCTGG - Intergenic
1095898832 12:47306616-47306638 CAGTGAAAGGTGAAGCCTGCTGG + Intergenic
1096180642 12:49548769-49548791 CAGTGAAGGGGCAAAGCGGCGGG + Intronic
1096486519 12:51985694-51985716 CAGAGAGCTGTGAAGGAGGCAGG + Intronic
1096534382 12:52261792-52261814 GAGAGCAGGGGGAAGGAGGCTGG + Intronic
1096628068 12:52907322-52907344 CAGGGAAGGCGGAAGGAGGGAGG + Intronic
1096777554 12:53973553-53973575 CGGTGACGGTGGAAGGAGGCAGG - Exonic
1097208207 12:57342310-57342332 CATTCAAGGGTGAAGGGGGCGGG - Intronic
1097547606 12:61023721-61023743 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1097601050 12:61694216-61694238 CATTGAAAGGTGAGGAAGGCAGG - Intergenic
1098246072 12:68519326-68519348 CAGTGAGGCCTGAAGGAGGAAGG - Intergenic
1099437238 12:82659385-82659407 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1101260255 12:103021983-103022005 AAGTGCAGAGTGAAGGAGGATGG - Intergenic
1101409909 12:104458814-104458836 CAGTGAAAGGAGAAGGCGGGAGG - Intronic
1101570384 12:105948208-105948230 CATTGAAGGATGGAGGAGCCTGG + Intergenic
1101586330 12:106088930-106088952 AAATGAAGGGGGAAGGAGGAGGG + Intronic
1102222295 12:111202674-111202696 CATTGGAGGGGGCAGGAGGCGGG + Intronic
1102658686 12:114505780-114505802 CATTGAGTGGTGAAGGAGGAAGG + Intergenic
1103039715 12:117685132-117685154 CAGGGGATGGTGGAGGAGGCTGG - Intronic
1103201880 12:119094509-119094531 CAGTGAAGGTGGAGGGTGGCAGG - Intronic
1103413720 12:120730458-120730480 CTGTGTAGGGAGGAGGAGGCTGG + Intronic
1103787445 12:123443762-123443784 CAGTGAAAGTTAAAAGAGGCCGG - Intergenic
1103942709 12:124509661-124509683 CAGTGTAGGGGGAAGGGGCCAGG + Intronic
1104172507 12:126295849-126295871 GAGGGAAGGGGGAAGGAGGGAGG + Intergenic
1105237138 13:18567803-18567825 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1105279135 13:18953056-18953078 CAGTCAAGGTTGGAGGAGGGCGG + Intergenic
1106015747 13:25867566-25867588 TAGGAAAGGGTGAAGGAGGATGG - Intronic
1106690950 13:32115781-32115803 CACTAGAGGGAGAAGGAGGCTGG - Intronic
1106878841 13:34106805-34106827 CATTGAGGGGTGAAGTTGGCGGG - Intergenic
1107285167 13:38782088-38782110 CAGCGCAGGGTGAAGCAGGGTGG + Intronic
1107838188 13:44429082-44429104 CAGTGGAAGGAGAAGGAGCCTGG + Intergenic
1107871414 13:44749697-44749719 CTGTCAAGGGTGGAGGAGGATGG + Intergenic
1107875765 13:44789498-44789520 AAGTGAAGGGTGAAGAAGAAGGG + Intergenic
1107971907 13:45651256-45651278 CAGTCAAGGGAAAAGGAGGTTGG - Intergenic
1108119169 13:47164626-47164648 CTTTGAAGGGTAGAGGAGGCTGG - Intergenic
1108713033 13:53053002-53053024 CAGGGAAGGTTGAAGGACTCAGG + Intergenic
1108958265 13:56187817-56187839 CAGTGAGATGTGAAGCAGGCTGG + Intergenic
1109149200 13:58823628-58823650 CAGTTAGAGGTGAAGCAGGCTGG - Intergenic
1110627374 13:77666461-77666483 GAGTGGAGGGTGATGGAGGTGGG - Intergenic
1111344770 13:86936672-86936694 CAGGGAAGGGTGAAGAAGAATGG + Intergenic
1111710249 13:91802710-91802732 TAGTGAAAGGTGAAGCTGGCTGG - Intronic
1112338961 13:98537118-98537140 CAGTGTAGGCTGAAGAACGCTGG - Intronic
1112730978 13:102361943-102361965 CAATGAAGACTGAAGGAGACTGG - Intronic
1112880466 13:104100970-104100992 GGGTGAAGGATGAAGAAGGCAGG + Intergenic
1113612657 13:111658411-111658433 CAGTGCGTGGTGCAGGAGGCAGG + Intronic
1113634867 13:111912656-111912678 TTGTGAAGGGGCAAGGAGGCTGG - Intergenic
1115564468 14:34613171-34613193 CACTGAAAGCTGGAGGAGGCAGG + Intronic
1115815511 14:37160558-37160580 CTGGGAAGGGTGAGAGAGGCAGG + Intronic
1115959291 14:38816878-38816900 TATTGGAGAGTGAAGGAGGCAGG - Intergenic
1116084362 14:40216920-40216942 TAGTGAGAGGTGAAGCAGGCTGG - Intergenic
1118049688 14:62013501-62013523 CAGTGAATGAAGAAGCAGGCAGG - Intronic
1118716086 14:68561086-68561108 CAGAGGAAGGTGTAGGAGGCAGG - Intronic
1119591591 14:75893520-75893542 CATTCAAGAGTGAAGGCGGCTGG + Intronic
1119785499 14:77310650-77310672 CAGGGAAGGCAGGAGGAGGCAGG - Intronic
1120818715 14:88891919-88891941 CAGTGAAGGGGAAAGGAGGCTGG - Intergenic
1120882302 14:89423061-89423083 CAGTGAAGAGTGGAGGGGACTGG + Intronic
1121281910 14:92705096-92705118 CAGGGAAGGGTGAAGCAGCGGGG + Intronic
1121717829 14:96088807-96088829 CGGTGAAGGGAGGAGAAGGCAGG + Exonic
1121991476 14:98561902-98561924 CAGAGAGGGGTGGAGGAGTCAGG - Intergenic
1122055868 14:99097979-99098001 CAGTGAATGGGGAAGAAGGCTGG - Intergenic
1122884611 14:104705477-104705499 CAGTGTGGGCTGAAGGGGGCCGG + Intronic
1122918742 14:104870948-104870970 GAGTGAGGGGTGACAGAGGCCGG - Intronic
1123159551 14:106264655-106264677 CAGAAAAGTGTGCAGGAGGCCGG - Intergenic
1202835425 14_GL000009v2_random:74546-74568 GAGTGAAAGGTGAAGGTGGGGGG + Intergenic
1202870809 14_GL000225v1_random:161689-161711 CAGTGAAGAGTGAAATAGGAAGG - Intergenic
1124848766 15:33315694-33315716 CGGTGAGGTGAGAAGGAGGCTGG + Intronic
1125485693 15:40109236-40109258 AAGGGAGGGGGGAAGGAGGCGGG + Intergenic
1125600842 15:40915110-40915132 CAGTGATGGGGGGAGGGGGCTGG - Intergenic
1125670062 15:41465141-41465163 AAGGGAAGGGGGAAGGAGGAAGG - Intronic
1127354894 15:58188734-58188756 GAGTGAAGAGTGAAAGAGGTGGG + Intronic
1127530516 15:59839164-59839186 CAGAGCAGTGTGAAGGAAGCTGG - Intergenic
1128681274 15:69653652-69653674 CAGTGAATAGGAAAGGAGGCTGG + Intergenic
1128943709 15:71807973-71807995 TAGTGAGTGGTGGAGGAGGCTGG - Intronic
1129191270 15:73939073-73939095 CAGTGTAGGAGTAAGGAGGCTGG - Intronic
1129230546 15:74194931-74194953 GAGTGAAGCTTGATGGAGGCCGG - Intronic
1129521737 15:76190542-76190564 CAGTGGAGGTGGAGGGAGGCGGG + Intronic
1129892869 15:79083168-79083190 CAGTGAAGGAGGCTGGAGGCTGG + Intronic
1130375275 15:83323475-83323497 CAGTCAAGAGTGAAGAATGCGGG + Intergenic
1130882174 15:88064811-88064833 TGGGTAAGGGTGAAGGAGGCAGG - Intronic
1131166396 15:90145090-90145112 AAATGAAGGGTGAAGGAGGGAGG - Intergenic
1131362607 15:91806452-91806474 CAGAGAAGAATGAAGGAAGCTGG + Intergenic
1132540602 16:507054-507076 CATCGAAGGCTGAGGGAGGCGGG - Intronic
1132858123 16:2056546-2056568 CAGCGCAGGCTGAAGGAGGTGGG + Intronic
1133062953 16:3187159-3187181 CACAGAAAAGTGAAGGAGGCTGG - Intergenic
1133611942 16:7441828-7441850 CAGTGGATCGTGAAGCAGGCTGG - Intronic
1135770759 16:25216798-25216820 CAGGGCAGGGTGAGGGAGTCAGG - Intronic
1136019321 16:27430019-27430041 CAGTGGAGGGTGAGCCAGGCGGG - Intronic
1136267198 16:29128746-29128768 CAGTGGAGGGGGAAGGAGGCTGG + Intergenic
1136695282 16:32074858-32074880 AATGGAAGAGTGAAGGAGGCTGG + Intergenic
1136795781 16:33018115-33018137 AATGGAAGAGTGAAGGAGGCTGG + Intergenic
1136874137 16:33836265-33836287 AATGGAAGAGTGAAGGAGGCTGG - Intergenic
1138212238 16:55173305-55173327 CTGTGAAGGGGGAAGGAGTGGGG + Intergenic
1138215795 16:55204278-55204300 CAGTGAGGGTTTGAGGAGGCTGG - Intergenic
1139654390 16:68378529-68378551 GACTGCAGGGAGAAGGAGGCAGG - Intronic
1140196489 16:72859731-72859753 CAGTGAGGGGAGAATGCGGCAGG + Intronic
1141235755 16:82214515-82214537 AAGTGCAGAGTGAAGGAGGGGGG - Intergenic
1141275405 16:82583294-82583316 CAGAGAACGGTGAGGGAGGTGGG + Intergenic
1141679886 16:85537814-85537836 GAGTGAGGGGTCAAGGAGGCTGG + Intergenic
1141740991 16:85892865-85892887 CAGTGAAGGCTGGAGTAGGAAGG + Intergenic
1141741515 16:85896310-85896332 CAGGGAAGGGATGAGGAGGCCGG + Intergenic
1142044011 16:87913699-87913721 CAGTGTGGGGTGGAGGAGGAGGG - Intronic
1142070490 16:88089069-88089091 CAGTGGAGGGGGAAGGAGGCTGG + Intronic
1142135732 16:88451247-88451269 CAGCGAAGGGGGCAGGCGGCAGG - Intergenic
1203098039 16_KI270728v1_random:1279770-1279792 AATGGAAGAGTGAAGGAGGCTGG + Intergenic
1142744132 17:1947369-1947391 CGCTGCAGGGTGAAGGGGGCCGG - Intronic
1142749695 17:1979812-1979834 CAGTCAAGGGGGGAGGAGGAGGG - Intronic
1142883965 17:2901365-2901387 CAGAGAAGGGAAAAGGAGGATGG - Intronic
1143122537 17:4617852-4617874 CAGTGAGGGGAGTAGGGGGCAGG - Intergenic
1143361517 17:6375234-6375256 AAGTGAAGGGTTAACCAGGCCGG - Intergenic
1143563133 17:7706845-7706867 CAGAGAAGTGTGAGGGAGGCTGG - Intronic
1144219381 17:13086216-13086238 GTTGGAAGGGTGAAGGAGGCTGG - Intergenic
1144257887 17:13487635-13487657 CAGGGAATGGTGCAGGAGACAGG + Intergenic
1144394872 17:14834319-14834341 CACTGAAAGGTGAAGCCGGCTGG + Intergenic
1144681764 17:17200673-17200695 CAAGGAAGGGGGAAGGGGGCAGG + Intronic
1144748618 17:17633190-17633212 CAGTGAGGCGTGAAGCTGGCTGG - Intergenic
1144758023 17:17691944-17691966 CAGATAGGGGTGAGGGAGGCGGG + Intronic
1145040190 17:19572227-19572249 CAGTACAGGGTGAGGGAGACAGG - Intronic
1145043870 17:19596947-19596969 TAGTGAGGGTAGAAGGAGGCTGG + Intergenic
1145056378 17:19706506-19706528 CAGTGAAGCTGGAAGGGGGCTGG + Intronic
1146314809 17:31798422-31798444 CAGCCAAGGGAGAGGGAGGCAGG + Intergenic
1146554770 17:33813923-33813945 CAGTGGAGGGAGAATGAGGAAGG + Intronic
1146672740 17:34753008-34753030 TAGCGAAGAGGGAAGGAGGCAGG - Intergenic
1147320340 17:39642221-39642243 CAGAGGAGGGTTAAGGAGGAGGG - Intronic
1147388001 17:40092898-40092920 CGGTGATGGGGGAGGGAGGCAGG + Exonic
1147847552 17:43415457-43415479 CAGTGGAGAGTGTAGGAGGCAGG + Intergenic
1147919622 17:43907738-43907760 CTGGGAAGGGTTAGGGAGGCAGG + Intronic
1148460963 17:47838766-47838788 TAGTGAACGGTGGAGGGGGCTGG - Intronic
1149018709 17:51938342-51938364 CAGTCGAGGGTGAAGGATCCAGG + Intronic
1149394081 17:56221078-56221100 AGGTGAAGGGGGAAGCAGGCAGG + Intronic
1149579245 17:57736932-57736954 GAGTGTAGGGTGATGGAAGCAGG - Intergenic
1149594823 17:57858714-57858736 CTCTGAAGAATGAAGGAGGCAGG - Intergenic
1149816638 17:59731684-59731706 CAGTGATGGCAGAAGGAGCCTGG + Intronic
1149867120 17:60157194-60157216 CAGTGGAGGGTGCAGGAGAGGGG + Intronic
1149891085 17:60391535-60391557 CAATGAAGGATGAGGGGGGCTGG + Intronic
1149974931 17:61256076-61256098 CAGTAGAGGCTGATGGAGGCTGG - Intronic
1150391117 17:64790493-64790515 CAGGGATGGGTGAATGGGGCTGG + Intergenic
1150446652 17:65231787-65231809 CTGGGAAGGCTGAAGGAAGCCGG + Intergenic
1150621031 17:66807811-66807833 CTGAGAAGGGAGAGGGAGGCGGG + Exonic
1151412437 17:73940175-73940197 CAGAGAAGGGGGAAGGAGGGAGG + Intergenic
1152009471 17:77702491-77702513 CAGTGAGGGGTCGAGGAGGTTGG - Intergenic
1152403706 17:80084603-80084625 CAGTCACGAGTGCAGGAGGCTGG - Intronic
1152640763 17:81448289-81448311 CAGGGGAGGGGGCAGGAGGCTGG + Intronic
1152818778 17:82425022-82425044 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818785 17:82425052-82425074 CAGAGAAGGCTGGAGAAGGCTGG + Intronic
1152818804 17:82425127-82425149 CAGAGAAGGCTGGAGAAGGCTGG + Intronic
1152818811 17:82425157-82425179 TAGAGAAGGCTGGAGGAGGCTGG + Intronic
1152818820 17:82425187-82425209 CGGAGAAGGCTGGAGGAGGCTGG + Intronic
1153170823 18:2313996-2314018 CATTGAGAGGTGAAGGAGGGAGG + Intergenic
1153407141 18:4753541-4753563 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1153491065 18:5648437-5648459 CAGTGAGAGCTGAAGGAGCCTGG + Intergenic
1153512260 18:5868871-5868893 CAGGGGTGGGTGGAGGAGGCAGG - Intergenic
1153718131 18:7871741-7871763 CAGTGAATGTTGAACGAGGGAGG + Intronic
1154132941 18:11751816-11751838 CGGGGAAGGGAGAGGGAGGCTGG - Intronic
1155630540 18:27887533-27887555 CAGGGAAGGAGGAGGGAGGCAGG - Intergenic
1156040224 18:32812248-32812270 ATGTGAAGGGTTCAGGAGGCTGG + Intergenic
1156535783 18:37863261-37863283 AAGTCAAGGTAGAAGGAGGCAGG - Intergenic
1158976925 18:62717196-62717218 CTGTGGAGGGTGCAGGAGGAAGG + Exonic
1160261193 18:77295763-77295785 CAGGCAAGGGAGAAGGTGGCTGG + Intergenic
1160328089 18:77968753-77968775 CTGGGAAGGTTGAAGGGGGCTGG - Intergenic
1160812596 19:1019431-1019453 CTGTGAAGGGTTACGCAGGCAGG - Intronic
1160866247 19:1257483-1257505 GAGTGAAGGGTGAAGGAGGTAGG - Exonic
1160996318 19:1883697-1883719 TGGTGAAAGGTGATGGAGGCAGG - Intronic
1162053642 19:8050304-8050326 CAGTGAGGGGTGAGGCAGGGAGG + Intronic
1162070457 19:8149384-8149406 CGCTGAAGGGTGGAGAAGGCGGG - Intronic
1162292960 19:9792716-9792738 CGGTGAGGGGAGACGGAGGCGGG - Intronic
1162702092 19:12524023-12524045 CAGTGAAGGGGGGAGGAGACAGG + Intronic
1162777767 19:12990184-12990206 GAGTGATGGGGGATGGAGGCAGG - Intergenic
1162785483 19:13032123-13032145 CAGTGGAGGGGGAGGGGGGCAGG + Intronic
1162985492 19:14266813-14266835 CAGTGCTGGGTGGTGGAGGCAGG - Intergenic
1163755522 19:19104330-19104352 TGGTGAGGGGTGAGGGAGGCGGG + Intronic
1164103455 19:22080425-22080447 AAGTGTAAGGTGAAGGAGCCAGG - Intronic
1164671784 19:30076555-30076577 CAGTGAGGGGTGGGAGAGGCAGG - Intergenic
1164744162 19:30599144-30599166 GAGGGAAGGGTGAGGGAGGGAGG - Intronic
1165777494 19:38413279-38413301 CATTGAAGGGGGAGGGTGGCTGG + Exonic
1166096254 19:40541323-40541345 CAGTGATGGGTGCCAGAGGCAGG + Intronic
1166246985 19:41536424-41536446 AAGTGATGGGTAGAGGAGGCCGG + Intergenic
1166267469 19:41694232-41694254 AAGTGAAGGGTGAAGCTGGGTGG + Intronic
1166326529 19:42054286-42054308 CGGGGATGGGTGGAGGAGGCAGG - Intronic
1166546773 19:43638994-43639016 CAGAGAAGGGGGAAAGAGACAGG + Intronic
1166741263 19:45116289-45116311 CAGTGAAGGGCGCAGATGGCAGG - Intronic
1166881112 19:45930690-45930712 CTGGGAAGGGGGAAGGAGGGAGG - Intergenic
1167322739 19:48806527-48806549 TAGTGGAGGCTGGAGGAGGCTGG + Exonic
1167674706 19:50877149-50877171 CAGGGAAGGGGGAAGGAGGGCGG - Intronic
1168024211 19:53631985-53632007 CAGAGAAAGGTGGAGGAGGTGGG + Intergenic
1168296528 19:55379728-55379750 CAGTGAAGACAGAAGGAGGCCGG + Intronic
1168587427 19:57604601-57604623 CAGTGAAGGGTCTGGGAGACAGG + Intronic
1168701631 19:58443371-58443393 CAGTGAAAAGTGAAGCCGGCTGG - Intergenic
925055425 2:853518-853540 AAGAGAAGGGTGAAGGTGGTGGG - Intergenic
925097268 2:1216974-1216996 CAATGAAGGGTGAAGGGTGAAGG - Intronic
925339722 2:3127769-3127791 CAGTGGAGGGTGGAGGACGGAGG + Intergenic
925912385 2:8582362-8582384 CAGTGGAGGGGGAAAGAGGCTGG - Intergenic
926038040 2:9650235-9650257 TAGTGCAGGGTGAAGAAGGGTGG + Intergenic
926311624 2:11679785-11679807 CTCTGAAGGGTGATGGGGGCCGG + Intronic
927673852 2:25090299-25090321 CAGTGAGGGGTGAAGCTGGGTGG + Intronic
928410833 2:31052655-31052677 CAGTGGAGGCTGATTGAGGCTGG - Intronic
928793879 2:34992242-34992264 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
929467039 2:42154384-42154406 AAGTGATTGGGGAAGGAGGCTGG + Intergenic
929818054 2:45251613-45251635 CAATGAAAGGAGAAGGAGGTTGG - Intergenic
929875888 2:45795997-45796019 GAGTGAAGGGAGATGGAGGATGG - Intronic
929888044 2:45895854-45895876 TAGAGAAGGGTGGAGGATGCAGG + Intronic
930473023 2:51844962-51844984 CATGGAAGGGTGTTGGAGGCTGG - Intergenic
930585155 2:53259663-53259685 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
931000477 2:57775225-57775247 CAGAGAAGGGTAGAGGAAGCTGG - Intergenic
932400635 2:71478880-71478902 CAGAGAGGGATCAAGGAGGCAGG - Intronic
932432619 2:71685034-71685056 CAGTGCAGGGTGCAGCTGGCAGG - Intronic
933180136 2:79217410-79217432 CAGTGAAGGGAGATAGAGGTGGG + Intronic
933854071 2:86396437-86396459 CAGCGAAGGGCGAAGGGGGTGGG - Intergenic
933897128 2:86821824-86821846 AAGAGAAGGGTGGAGGAAGCAGG - Intronic
934731777 2:96663385-96663407 CAGTGGAGGGAGGAGGGGGCAGG + Intergenic
934762791 2:96865607-96865629 CAGAGAAGGGTGAGGAGGGCGGG + Intronic
935591052 2:104845467-104845489 CAGGGAGCGGTGAAGGAGACTGG - Intergenic
935721431 2:105982754-105982776 TAGTGTTGGGTGAAAGAGGCTGG + Intergenic
935785534 2:106545202-106545224 CAGTGAAAGGAGACGGTGGCAGG - Intergenic
936060616 2:109293470-109293492 CAGTGGAGAGAGAAGGGGGCAGG - Intronic
936419538 2:112350082-112350104 CAGTGTTGGGAGACGGAGGCTGG + Intergenic
938134940 2:128749102-128749124 CAGTGGAGGTTGAAGAATGCGGG + Intergenic
938254433 2:129844298-129844320 CAGTGAATGTTGAAGCAGGCTGG - Intergenic
938370773 2:130767125-130767147 CCATGAAGGGAGAAGGTGGCTGG + Exonic
939028130 2:137038697-137038719 CAGAAAAGGGTCAAGGAGGCAGG + Intronic
940652691 2:156453448-156453470 CAGTGTAGGGTGCTTGAGGCTGG + Intronic
941478779 2:165980108-165980130 GGGTAATGGGTGAAGGAGGCTGG + Intergenic
942058175 2:172204656-172204678 CAGAGCAGGGTGAGGGAGACTGG - Intergenic
942328209 2:174793665-174793687 CAGGGAAGGATGCATGAGGCAGG - Intergenic
944207421 2:197171244-197171266 GAGTGATGGGAGAAGGAAGCTGG + Intronic
944237151 2:197450896-197450918 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
944987080 2:205189523-205189545 CAGTGAAGGCTGTTGGAAGCTGG - Intronic
945006862 2:205417741-205417763 CAGTGAAAGGTTAAGGGGGCTGG - Intronic
945125727 2:206507457-206507479 CAGTGGAAGGTGAAGGTGGGAGG - Intronic
945151999 2:206801359-206801381 TGGTGATGGGGGAAGGAGGCTGG + Intergenic
948024020 2:234762471-234762493 CAATGTAGGATGAAGGAGACAGG - Intergenic
948091881 2:235302039-235302061 GAGAGAAGGGGGAAGGAGGGAGG - Intergenic
948395762 2:237643860-237643882 AAGTGAAGGTTTAAGGAAGCGGG + Intronic
948732569 2:239976402-239976424 CAGTTGAGGGAGAAGGAGGATGG - Intronic
1168739094 20:173100-173122 CAGTGAAGGGAGATAGAGGTGGG - Intergenic
1168815606 20:734529-734551 GAATGAAGGATGAATGAGGCCGG - Intergenic
1169455675 20:5750301-5750323 CAGTGAAGGGCAATGGAAGCCGG - Intergenic
1170120151 20:12902578-12902600 CATTGAAAGGTGGAGGAAGCAGG - Intergenic
1170345031 20:15376292-15376314 CAGTGCAAGGAGAAGGAAGCAGG + Intronic
1171447921 20:25217746-25217768 CATTAAAGGATGAAGGAGGAGGG - Intronic
1172039878 20:32036309-32036331 CAGGGAAGTGGGGAGGAGGCTGG + Intergenic
1172318525 20:33976741-33976763 TAATGAAGGGTGAGGCAGGCAGG - Intergenic
1172434829 20:34921465-34921487 GAGTGAAGGGTACAGAAGGCTGG + Intronic
1172447807 20:35002281-35002303 CAGGGAAGGCTGAAGGCAGCAGG - Exonic
1172489837 20:35327157-35327179 CAATGAAGAGTGAAAGGGGCGGG + Intronic
1173648754 20:44650167-44650189 CAGTAAGACGTGAAGGAGGCAGG + Intronic
1173766533 20:45615365-45615387 CAGTCAAGTGGGCAGGAGGCAGG + Intronic
1173900384 20:46583447-46583469 CAGTGAAAGGAGAAGCAGGAAGG + Intronic
1174137365 20:48389473-48389495 CATCCAAGGGTGAAGAAGGCAGG + Intergenic
1175159168 20:56995295-56995317 CTGTGAAGGGTGGAGGAGATGGG - Intergenic
1175802472 20:61808785-61808807 CAGTCAAAGGTGGAGGGGGCAGG - Intronic
1175802688 20:61810173-61810195 CAGAGATGGGTGAGGGAGGCCGG + Intronic
1176000247 20:62828412-62828434 CAGTCCAGGGTGGACGAGGCAGG + Intronic
1176109197 20:63403894-63403916 AAGTGCAGCGGGAAGGAGGCTGG - Intergenic
1176781125 21:13196085-13196107 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1177159296 21:17530259-17530281 GAAAAAAGGGTGAAGGAGGCCGG - Intronic
1178103148 21:29291635-29291657 CAGAGAAGTGTGGAGGAGGCTGG + Intronic
1178849669 21:36202470-36202492 GACTGAGGGGTGCAGGAGGCTGG + Intronic
1179073761 21:38098700-38098722 CAGGAAAGGGAGTAGGAGGCAGG - Intronic
1179350693 21:40607975-40607997 CAGTGAAGAGTGAGTGAGGAAGG + Intronic
1179367206 21:40769542-40769564 CAGGGATGGTTGAAGGAGGCTGG - Intronic
1179525616 21:41974160-41974182 CAGTGTAGGGAGATGGAGCCAGG + Intergenic
1179795312 21:43779004-43779026 AAGTGCAGGGTGAAGCAGGGTGG + Intergenic
1180025375 21:45158173-45158195 CTGTGCAGGGTGCAGGAAGCTGG - Intronic
1180161640 21:46000951-46000973 CAGTTATGGGTGAAAGAGGGCGG - Intronic
1180187760 21:46148197-46148219 CAGTGAAGGGTCCAGGAGGAAGG + Intronic
1180238735 21:46483488-46483510 CAGTGCAGGGTGGAGTAGGTGGG + Intronic
1180614523 22:17119194-17119216 CAGTTAACGGTGAGGGAGGTAGG - Exonic
1181079139 22:20402203-20402225 CAGTGGAGGGGGATGGAGGAGGG - Intronic
1181136881 22:20773621-20773643 CAGTGAAAGGTGGAGGAGAGAGG - Intronic
1181473434 22:23154464-23154486 CAGTCAAGAGCAAAGGAGGCTGG + Intronic
1182058817 22:27382186-27382208 GAGGGCAGAGTGAAGGAGGCTGG + Intergenic
1182302228 22:29343381-29343403 CAGGGAAGGCTGACAGAGGCAGG + Intronic
1182415172 22:30216791-30216813 AAGGGAAGTGTGAAGGAGGAGGG + Intergenic
1182419142 22:30240344-30240366 CAGCGAAGGGTGGAGGAGGGTGG - Intergenic
1183137433 22:35902593-35902615 TAGTGAAGAGTGAATGAGGGAGG - Intronic
1184300264 22:43554591-43554613 CAGGGAAGGGAGAAGGAGTGTGG + Intronic
1184376584 22:44117328-44117350 CTGTAGAGGGTGAAGGAGGAGGG + Intronic
1184530440 22:45051945-45051967 CTGAGGAGGTTGAAGGAGGCTGG - Intergenic
1184544173 22:45154763-45154785 AAGTGAAGGCTGAAGGAGCCAGG - Intergenic
1184617941 22:45650731-45650753 CAGTGGAGAGTAAAGGAAGCGGG + Intergenic
1185023250 22:48392915-48392937 CACTGATGGGTGGAGGAGGGAGG + Intergenic
1185093884 22:48795216-48795238 GAGTCAACAGTGAAGGAGGCTGG - Intronic
1185413472 22:50697707-50697729 CCGTGAAGGGTGAGGGGCGCGGG + Intergenic
949815203 3:8050876-8050898 CTGTAAATGGTGAAGGAGGGTGG + Intergenic
950222776 3:11208988-11209010 CAGTTGAGGGTGAAGGAAACTGG - Intronic
950706261 3:14784371-14784393 TAGGGAAGGGAGAAAGAGGCAGG - Intergenic
950714363 3:14837207-14837229 CAGTGAGGGCTGAAAGAGTCAGG - Intronic
951636716 3:24786814-24786836 CAGTAAAGGGAGAAGGAAACAGG - Intergenic
952920023 3:38277661-38277683 ATGAGAAAGGTGAAGGAGGCCGG - Exonic
953207318 3:40842818-40842840 CAGAGATGGCTCAAGGAGGCAGG - Intergenic
953483782 3:43275302-43275324 TAGGGAAGGGTGAAGGACACTGG - Intergenic
953545964 3:43863760-43863782 CAGTGAGGTCTGATGGAGGCTGG + Intergenic
953582896 3:44173180-44173202 CAGTGAATGGTGAAGCTGGATGG - Intergenic
953811920 3:46120093-46120115 GAGAGAAGGCTGAAGGAGGAAGG + Intergenic
954427743 3:50452272-50452294 CTGTGAGGGGTGAAGGACGCAGG - Intronic
954593064 3:51800809-51800831 CACTGAGAGGTGAAGGAGGGAGG + Intergenic
954757514 3:52849559-52849581 CAGGGAAGGTGGCAGGAGGCAGG - Intronic
955144849 3:56306999-56307021 CCATGCAGGGTGAAGGAGGATGG - Intronic
955170403 3:56558154-56558176 CAGTCAAGGGAGAGAGAGGCTGG - Intronic
955226225 3:57062492-57062514 CAGAGAAGAGGGAAGGAAGCAGG + Intronic
955407659 3:58635651-58635673 CAGTGAAGAACGCAGGAGGCCGG - Intronic
955534084 3:59904704-59904726 CATTGAAGGGTGAGGAGGGCAGG + Intronic
957054885 3:75435568-75435590 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
957271024 3:78030124-78030146 CAGTGAGAGGTGAAGCAGGCTGG + Intergenic
957734387 3:84187912-84187934 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
959061177 3:101617908-101617930 CAGTGAAGGGAGAAGGTGCATGG - Intergenic
960096535 3:113695984-113696006 CAGGAAAAGGTGAAGGAGGCGGG + Intronic
960097127 3:113699291-113699313 CAGGAAAAGGTGAAGGAGGCGGG - Intergenic
960267806 3:115640737-115640759 CAGTGAAGGGTCAAGAGGTCAGG + Intronic
960517731 3:118620592-118620614 CAGTGCTGAGTGAACGAGGCAGG - Intergenic
961017918 3:123481772-123481794 CAGAGAGGGCTGAGGGAGGCAGG + Intergenic
961053329 3:123766294-123766316 CAGAGAAGGGGGAATGAGGGTGG - Intronic
961058389 3:123808125-123808147 CAGTGAAGGGTGAAGGAGGCTGG - Intronic
961299947 3:125916106-125916128 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
961546177 3:127635155-127635177 CTGTGAAGGAGAAAGGAGGCTGG - Intronic
961745740 3:129062545-129062567 CAGTTAAGGGTGAAGGGTGGGGG - Intergenic
961888556 3:130111967-130111989 CAGAGAAGGGCTCAGGAGGCGGG + Intronic
962106640 3:132396614-132396636 CAGTGAAAGGTGAAGCCGGCTGG + Intergenic
963538012 3:146552384-146552406 CACTTAATGGAGAAGGAGGCTGG + Intergenic
963692761 3:148525435-148525457 CAGTGAAAGGTGAAGCTGGCTGG + Intergenic
963700296 3:148617781-148617803 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
964207441 3:154190058-154190080 CCATGAAGGGAGAAGGAAGCAGG - Intronic
964799872 3:160544152-160544174 TATTGAAAGGTCAAGGAGGCCGG - Intronic
964931297 3:162027843-162027865 CAGGGAAAGGTGAAGGTTGCAGG + Intergenic
965139266 3:164814444-164814466 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
965139876 3:164818668-164818690 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
965802859 3:172512418-172512440 CAGTGATGGGAGAAGGTGGCAGG - Intronic
966638131 3:182158127-182158149 CAGTGGAGGGGCACGGAGGCTGG + Intergenic
967254145 3:187572602-187572624 CAGTGAAGGGTAAAGAAGACAGG + Intergenic
967979844 3:195059196-195059218 CTGAGGTGGGTGAAGGAGGCGGG - Intergenic
968075884 3:195815992-195816014 CTGCGTAGGGAGAAGGAGGCCGG - Intergenic
968075957 3:195816262-195816284 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968076144 3:195816953-195816975 CTGTGTAAGGAGAAGGAGGCCGG - Intergenic
968613075 4:1565869-1565891 CAGGGACGGATGGAGGAGGCTGG - Intergenic
968975533 4:3820412-3820434 CAGGGAAGGATGCAGGAGTCAGG + Intergenic
969125528 4:4945205-4945227 CAGTGTAGGGTGGAAGTGGCTGG + Intergenic
969272059 4:6109710-6109732 CACTGTAGGATGAAGGAGGGTGG - Intronic
969350222 4:6593991-6594013 CAGTCACGGATGAAGAAGGCAGG - Intronic
969355206 4:6621020-6621042 CAGTGTGGTGAGAAGGAGGCTGG + Intronic
969398321 4:6937714-6937736 CAGGGAAGGGAGAGAGAGGCAGG + Intronic
969436209 4:7191160-7191182 CAGTGAAGGGTGGAGGGGAGGGG - Intergenic
969445664 4:7243481-7243503 GAGTGAAGGCTGGAGGAGCCCGG + Intronic
969756304 4:9152778-9152800 CAGGGAAGGGCTCAGGAGGCGGG - Intergenic
969816632 4:9691976-9691998 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
969922849 4:10557257-10557279 TAGAGAAGGGTGAAGGTGGAGGG - Intronic
970460301 4:16268502-16268524 CAGTGAGGGTTGGAGGAGGTTGG - Intergenic
971150314 4:24024438-24024460 CAGTGAAGGTGGAAGGAGATGGG - Intergenic
973271136 4:48264366-48264388 CCCTGAAGGGTGAAGGAGTAGGG - Intronic
973703424 4:53558526-53558548 CAGTGATGGGTGCTGGAGGAAGG - Intronic
975563183 4:75725983-75726005 CTGAGAGGGGTGAAGTAGGCCGG + Intronic
976151689 4:82099014-82099036 CAGGGAAGGGTGAAGGTGGTAGG - Intergenic
976210941 4:82669095-82669117 CAGTCAAGGGAGATGGAGTCAGG + Intronic
976480869 4:85543383-85543405 CAGTGAAGGGTGGACAAAGCTGG + Intronic
976596978 4:86904072-86904094 CAGTGAGAGGTGAAGCTGGCTGG - Intronic
976607910 4:86999831-86999853 CAGTGATGGCAGAAGGAGACTGG + Intronic
976771872 4:88662035-88662057 TACTGAGGGATGAAGGAGGCAGG + Intronic
976775133 4:88698804-88698826 CAGTGAGTGGGGAAGAAGGCGGG - Intronic
977064522 4:92296764-92296786 CAGTGAAGGGTGCAGGAAAGTGG + Intergenic
977534176 4:98237795-98237817 CAGAAAAGGGTGAAGGAAGAAGG + Intergenic
978373239 4:108050318-108050340 CAGTGAAGGGACAAGAAGACTGG + Intronic
978373341 4:108050939-108050961 CAGTGAAGGGACAAGAAGACTGG - Intronic
978862888 4:113471728-113471750 CAGTGAGGAGTGAGAGAGGCCGG - Intronic
979121190 4:116904312-116904334 CAGTTAATGGTGAAGAAGGGAGG + Intergenic
979942552 4:126779903-126779925 CAGTGGAGGGTCAGGGTGGCAGG - Intergenic
980011324 4:127597867-127597889 CAGTGAAGAGTCAGGCAGGCAGG + Intergenic
980302496 4:131012198-131012220 CAGTGAAGGGAGATAGAGGTGGG - Intergenic
980611964 4:135171984-135172006 CAGCTAAGGGTGAAGGAGAAGGG + Intergenic
981288525 4:143047161-143047183 CAGGGAAGGGTGGAGGTGGCTGG + Intergenic
981729765 4:147885065-147885087 CAGTAGAGGGTGAAGGAGTGGGG + Intronic
982116238 4:152100523-152100545 GTGTGAAGGGTGAGGGACGCAGG + Intergenic
982277139 4:153647561-153647583 CACTCAAGGGGGAAGGAGGCTGG + Intergenic
982293841 4:153806534-153806556 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
982340476 4:154293075-154293097 CAGCCAAGGGTGAAGGAAGAGGG - Intronic
983267695 4:165524483-165524505 AAGTGAAGGCCCAAGGAGGCAGG + Intergenic
983452126 4:167923856-167923878 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
984630173 4:182052565-182052587 CACTGAAGGGTGAAGAAGTGAGG - Intergenic
984911456 4:184676968-184676990 AAGTGAAGGGGGAAAGAGGAAGG - Intronic
1202764518 4_GL000008v2_random:138660-138682 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
986555780 5:9008693-9008715 CTGCTAAGGGTGAAGGAGGAGGG + Intergenic
986694349 5:10338845-10338867 CAGTGATGAGTGAAGTAAGCTGG + Intergenic
986991494 5:13558204-13558226 CTGGGAAGGGTGGAGGAGGTGGG - Intergenic
987427273 5:17787402-17787424 CTGTGAAGGGTGAAGGGTGAGGG - Intergenic
987705220 5:21454886-21454908 CAGTGAAGGGAGATGCAGTCAGG + Intergenic
987872680 5:23641059-23641081 AAGTGCAGAGTGAAGGTGGCCGG - Intergenic
988300706 5:29422311-29422333 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
988400363 5:30753453-30753475 CAGGGAATGGTGAAGATGGCTGG - Intergenic
988437279 5:31191149-31191171 GACTGGAGGATGAAGGAGGCAGG + Intergenic
988605904 5:32678334-32678356 TAGTGAGAGGTGAAGAAGGCTGG - Intergenic
992905851 5:81345042-81345064 CTGTGAAGGGTGATGCAGGGCGG + Intronic
993068954 5:83134249-83134271 CAGTGAGAGGTGAAGCTGGCTGG + Intronic
993430533 5:87827168-87827190 CAGTTCAAGGTGAGGGAGGCAGG + Intergenic
994295683 5:98085192-98085214 CAGTGAAGGGAGATAGAGGTGGG - Intergenic
995707408 5:114999528-114999550 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
996127127 5:119739158-119739180 CCGTGAATGGTGAGGGAGGGAGG - Intergenic
996388556 5:122934853-122934875 CAATGAAGGGTGGGGGAGGGTGG - Intronic
996832484 5:127755132-127755154 CAGTGAAGGGAAAAGGATGGAGG + Intergenic
997308804 5:132862282-132862304 CACTAAAGGTTGAAGGAGGCTGG + Exonic
997390632 5:133512054-133512076 CAGTGAAGGATGTAGAAGGAGGG - Intronic
997398133 5:133580900-133580922 CTGTGCAGATTGAAGGAGGCGGG - Intronic
997606773 5:135180479-135180501 CAGTGGAGGATGAAGGAACCAGG - Intronic
997972939 5:138419166-138419188 CAGTGCAGGGCGGAGGAGGGTGG - Exonic
998562067 5:143180993-143181015 CAGTGATGAGTAAAGGAAGCTGG - Intronic
998701607 5:144708948-144708970 CAGTGAGAGGTGAAGCTGGCTGG + Intergenic
999340426 5:150765345-150765367 CACTGAAGGGTGAGGGAGTTGGG + Intergenic
1000632191 5:163603250-163603272 CAGTCAAGGGGGAAGGATGCTGG + Intergenic
1000920674 5:167133118-167133140 CAGTAAAGGGGGAAGAAGGGAGG + Intergenic
1000960753 5:167598068-167598090 CAGTGAAGCATGAAGGAGTGAGG + Intronic
1001400604 5:171444211-171444233 GAGTGAACAGCGAAGGAGGCAGG - Intronic
1001417250 5:171554829-171554851 CGGTGAAGTGGGAAGGAGACTGG - Intergenic
1001485165 5:172114862-172114884 CAGTGAAGGCCGAAGGTGGGGGG - Intronic
1001810434 5:174623486-174623508 CAGGGAAGGATGAAAGAGGAAGG - Intergenic
1001946924 5:175786900-175786922 CTGTGAAGAGTGTAGGTGGCTGG - Intergenic
1002358428 5:178649953-178649975 CAGTGACGGTTGATGGAGACAGG + Intergenic
1002552965 5:180010730-180010752 TAGGGAAGGGGGAAGGAGGGAGG + Intronic
1003514831 6:6809288-6809310 CAGTGAAGGGGGAAGAAAGTAGG + Intergenic
1004251765 6:14028722-14028744 CCTTGAAGGGTGGAGGAGTCTGG + Intergenic
1004281422 6:14282597-14282619 CAGGGATGGGAGAAGCAGGCAGG + Intergenic
1004562295 6:16761760-16761782 CAGCGAAGGGTTAAGGGCGCGGG - Intergenic
1004574899 6:16886263-16886285 CAGTGAAGGGAGATGGGGGTGGG - Intergenic
1005083454 6:21980596-21980618 CAGAGCAGGAAGAAGGAGGCAGG - Intergenic
1005083678 6:21981824-21981846 CAGTGCAGGAAGGAGGAGGCAGG - Intergenic
1005953317 6:30647128-30647150 TCGTGAAGGGGAAAGGAGGCCGG - Exonic
1006518467 6:34557427-34557449 CAGAGAAGGTTGAGGGAGGATGG + Intergenic
1007158681 6:39771234-39771256 CAGGGTAGGGTGGAGGAGGATGG - Intergenic
1007244401 6:40450164-40450186 CAGTGGTGGGGTAAGGAGGCCGG - Intronic
1007290655 6:40783638-40783660 CAGGGCAGGGTGGAGGAGGATGG + Intergenic
1007322334 6:41036797-41036819 CAGTGAAGCTGGAATGAGGCAGG + Intronic
1007378027 6:41469555-41469577 GGGTGAGGGGTGAGGGAGGCTGG + Intergenic
1007599957 6:43075569-43075591 CAGCAAGGGGTGTAGGAGGCGGG - Intergenic
1007703615 6:43778331-43778353 CAGGGATGGGTGGTGGAGGCAGG - Intronic
1007739187 6:44000719-44000741 CAGTCAAAGGAGAAGGGGGCAGG + Intronic
1007853485 6:44829256-44829278 GAGTGAAGGGGAAAGGAGGTGGG + Exonic
1007966537 6:46008549-46008571 CTGTGAAAGCTGAAGGGGGCTGG - Intronic
1008415699 6:51237453-51237475 CAGGGAAGGGAGAAGGTGGGAGG + Intergenic
1008453152 6:51676045-51676067 CAGAGGAGGAGGAAGGAGGCAGG + Intronic
1008541681 6:52551490-52551512 CAGGGGAGGGTGAATGAGGGAGG + Intronic
1008543392 6:52564973-52564995 CAGAGAAGCATGAAGGAGGAGGG + Intronic
1008551755 6:52639342-52639364 CAGTGAGAGGTGAAGCTGGCTGG - Intergenic
1009023083 6:57966020-57966042 CAGTGAAGGGAGATGCAGTCAGG - Intergenic
1009379672 6:63011327-63011349 CAGTGAAGGGAGATAGAGGTGGG - Intergenic
1009925811 6:70119381-70119403 CAGTGCTTGGTGCAGGAGGCGGG - Intronic
1009972599 6:70640913-70640935 CAGTAGAGGGGTAAGGAGGCAGG - Intergenic
1010037556 6:71343914-71343936 CTGTGAAGGGTAAAGGAGGAGGG + Intergenic
1010758512 6:79695072-79695094 TAGTGAAGTGTGAAGCTGGCAGG - Intronic
1011104915 6:83768826-83768848 CAGTGATGGGAGTAGGAGGTTGG - Intergenic
1011741059 6:90361181-90361203 GGGTGAGGGGTGTAGGAGGCAGG - Intergenic
1012505942 6:99946469-99946491 CTTAGAAGGGTGAAAGAGGCAGG + Intronic
1013275303 6:108579333-108579355 CTGGGAAGGGTCAAGAAGGCAGG + Intronic
1013632798 6:112001479-112001501 CAGTGAAAGTTGGAGGAGTCAGG + Intergenic
1013632986 6:112002807-112002829 CAGTGAAAGCTGGAGGAGTCAGG - Intergenic
1013654049 6:112226984-112227006 CAGTTAAGGGTAAAGGAGTGGGG + Intronic
1013764871 6:113563038-113563060 CAGAGAAGGATGAAGGTGGCAGG - Intergenic
1014066026 6:117126591-117126613 CAGTGAAAGGATATGGAGGCTGG + Intergenic
1016043680 6:139459283-139459305 CAGTGATGCTTCAAGGAGGCTGG + Intergenic
1016183538 6:141175290-141175312 CATTGAAAGGTGAAGCCGGCTGG + Intergenic
1016471411 6:144378549-144378571 GAGAACAGGGTGAAGGAGGCAGG + Intronic
1016888887 6:148985917-148985939 CTGTGAAGGGAAAAGGAGGCAGG + Intronic
1017702893 6:157093067-157093089 CAGCGAAGGGAGAAGGCAGCGGG - Intronic
1017875720 6:158522747-158522769 CGGTGAAGTGTCAAGCAGGCAGG + Intergenic
1017931912 6:158963406-158963428 AAGGGAAGGGGGAAGGAGGGGGG - Intergenic
1018205548 6:161434369-161434391 CGGTGCAGGGTGAGGGAGGGTGG + Intronic
1019397533 7:830093-830115 CTGTTAAGGGGGAAGGAGGAAGG + Intronic
1019647810 7:2140348-2140370 CCCTGAAGGGTGAAGGGTGCCGG + Intronic
1019778629 7:2926942-2926964 CAAGGAAGGGTGGAGTAGGCAGG + Intronic
1019779294 7:2930105-2930127 CAGAGAAAGGAGAAGGGGGCCGG + Intronic
1022140347 7:27487999-27488021 CAATGCAGGGTAAAGGAGACGGG + Intergenic
1022728103 7:32998745-32998767 CCGGGGAGGGTGAAGCAGGCAGG + Intronic
1022801247 7:33779492-33779514 CAGTGTAGGGGGAAGGGGGAGGG + Intergenic
1022806645 7:33829264-33829286 CACTGAAGGGCGAAGGGGGATGG - Intergenic
1023301974 7:38782818-38782840 CAATGAAGAGTGACTGAGGCTGG + Intronic
1023514755 7:40990752-40990774 AAGTGAAAGGTGAAGGAGCAAGG - Intergenic
1023867931 7:44247599-44247621 CAGGGAAGGGTCAAGGCGGCTGG + Intronic
1026108188 7:67437546-67437568 CAGTGATTGGTCCAGGAGGCGGG - Intergenic
1026177605 7:68011727-68011749 TAGTGAAGGGTGAAGATGGCTGG + Intergenic
1026515006 7:71061463-71061485 AAGTGAAGGGTGAATTAGCCAGG + Intergenic
1026851522 7:73726763-73726785 CAGTAAGGGTTAAAGGAGGCAGG - Intergenic
1028297807 7:89156926-89156948 CAGTGAGGGAGGAAGGAGGAGGG + Intronic
1029436513 7:100566935-100566957 AAGGGAAGGGTGATGGAAGCTGG - Exonic
1029458019 7:100680701-100680723 CAGTGAAGGGGGCAGGAGGAGGG - Exonic
1029483222 7:100825053-100825075 CAGTGGAGAGTGGAGGAGGGAGG + Intronic
1030106404 7:105990901-105990923 CAATCAAGGGTGAATGGGGCAGG + Intronic
1030441978 7:109597290-109597312 CAGTGAAGGGAGATAGGGGCGGG + Intergenic
1030677403 7:112398547-112398569 CAGAGCAGGGTGGAGGAGGGTGG - Intergenic
1030950900 7:115789908-115789930 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1031777926 7:125923989-125924011 CAGTGAAGGGAGAAAGGGGTGGG - Intergenic
1031846006 7:126806672-126806694 CAGTGACAGGTGAAGCCGGCTGG - Intronic
1033544974 7:142391602-142391624 CAGTGGAGGGTGAAGGGGCTGGG + Intergenic
1033553247 7:142466457-142466479 CATTAAAAGGTGATGGAGGCTGG + Intergenic
1033790850 7:144790905-144790927 CAATCAAGGGTGAAGGGGGTGGG + Intronic
1033909823 7:146248915-146248937 CAGTGAAGGGAGAAAGGGGTGGG + Intronic
1034859900 7:154586070-154586092 CAGTGGAGGGGCAAGCAGGCAGG + Intronic
1035117130 7:156533839-156533861 CAGTGAAGGCAGAAGGAAGAGGG + Intergenic
1035356548 7:158279393-158279415 CAGTGAGAGGTGAAGCTGGCTGG - Intronic
1035389716 7:158496675-158496697 CAGGGAAGGGGGAAGGGGGAAGG - Intronic
1035418474 7:158708075-158708097 CAGTGAACGGTGATGGCAGCGGG - Intergenic
1035551635 8:532262-532284 CCTTGCAGGGTGAAGGATGCTGG + Intronic
1036379545 8:8228086-8228108 CAGAGAAGGGCTCAGGAGGCGGG - Intergenic
1036850015 8:12194529-12194551 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1036871377 8:12436802-12436824 CAGAGAAGGGCTCAGGAGGCGGG + Intergenic
1037386433 8:18347617-18347639 CAGTCAATGGTGAAGCAGTCTGG - Intergenic
1037598595 8:20374659-20374681 GAGAGCAGGGAGAAGGAGGCAGG - Intergenic
1037683340 8:21117003-21117025 AAGGGAGTGGTGAAGGAGGCAGG - Intergenic
1037769141 8:21788930-21788952 CCGCGAAGGGAGAAGGGGGCGGG - Intronic
1038020747 8:23550337-23550359 CAGAGAAACGTGAAGGAGGGCGG - Intronic
1038611775 8:29065577-29065599 CTGAGAAGGGAGAGGGAGGCCGG - Intergenic
1039938271 8:42066940-42066962 AAGTGGTGGGAGAAGGAGGCAGG + Intergenic
1040389831 8:46940481-46940503 CAGTGGAGGGTGCTGGGGGCTGG + Intergenic
1040994136 8:53384568-53384590 CATTGAAGGGTGAGGAGGGCTGG + Intergenic
1041133818 8:54734428-54734450 CAGGGTAGGGTGAAGCAAGCAGG - Intergenic
1041215529 8:55596382-55596404 CAGGGCAGGAGGAAGGAGGCAGG - Intergenic
1041380190 8:57246674-57246696 CAGTTGAAGGTGAAGGAGGTGGG + Intergenic
1041927859 8:63254623-63254645 CAGGAAAGGATGAGGGAGGCAGG + Intergenic
1042776057 8:72432574-72432596 AAGTGCAGAGTGAAGGAGGGTGG + Intergenic
1044017287 8:87059590-87059612 AAGTGCAGAGTGAAGGAGGTTGG + Intronic
1044148697 8:88746844-88746866 CTGTTAAGGGTGAAGGAGAAGGG + Intergenic
1044302872 8:90606264-90606286 CAGTGAGAGGTGAAGCCGGCCGG - Intergenic
1044457058 8:92401261-92401283 CATTGAAAGGTGAAGCCGGCTGG - Intergenic
1045197265 8:99944670-99944692 CTGTTAAGGGTGAAGGAGAAGGG - Intergenic
1047086837 8:121526898-121526920 ATGTGAAGGGAGAAGGAGTCAGG - Intergenic
1048181080 8:132194903-132194925 CAGTGGAGGATGTAGCAGGCTGG - Intronic
1048764568 8:137830268-137830290 CAGTGAAGGGAGATGGGGGTGGG + Intergenic
1049047660 8:140165579-140165601 AAGGGAAGGGGGAAGGAGGGAGG + Intronic
1049564666 8:143331882-143331904 CAGGGCGGGGTGGAGGAGGCGGG + Intronic
1049657442 8:143805018-143805040 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1049720261 8:144112341-144112363 CAGTGCAGGGTGAGGGACCCAGG + Exonic
1050512643 9:6412241-6412263 CAGGGAAGGATTAAGAAGGCGGG + Intergenic
1051879934 9:21829527-21829549 CAGTGTAGGGAAAAGGAGCCTGG - Intronic
1052324818 9:27206325-27206347 CTGTAAAGGGTGACGGAGGAAGG - Intronic
1052353901 9:27484750-27484772 CAGGGCAGGGTAGAGGAGGCCGG - Intronic
1052812148 9:33070866-33070888 CTGGGAAGGGTGGAGGTGGCGGG + Intronic
1053057761 9:35004254-35004276 CAGCTAAGGGTGAAGGAGAAGGG - Intergenic
1054800658 9:69345154-69345176 AAGTGTCAGGTGAAGGAGGCTGG + Intronic
1055072687 9:72183319-72183341 AAGTGCAGTGTCAAGGAGGCAGG - Intronic
1055863732 9:80787224-80787246 CAATGAAGAGTGAAGAAAGCAGG + Intergenic
1056030807 9:82551491-82551513 CAGTGAAGTCTGAGTGAGGCTGG + Intergenic
1056531561 9:87492765-87492787 CAGTGGAGGGTGAGGGTGGAGGG - Intergenic
1056552409 9:87663159-87663181 CAGTGGAGGGTGCAGGAGTAGGG - Intronic
1056732060 9:89174840-89174862 CAGTGCAGGGGACAGGAGGCAGG - Intronic
1056740713 9:89252156-89252178 CAGCAAAGGGTGAAGGTTGCTGG + Intergenic
1057195986 9:93115806-93115828 GAGAGACGGGTGAAGGAGGGAGG + Intergenic
1057196004 9:93115850-93115872 GAGAGACGGGTGAAGGAGGGAGG + Intergenic
1057196038 9:93115969-93115991 GAGGGAGGGGTGAAGGAGGGAGG + Intergenic
1057230519 9:93318844-93318866 CAGTGGGAGGTGGAGGAGGCTGG - Intronic
1057997293 9:99829563-99829585 CAGAGAAGGGAGATGGAGGCAGG + Intronic
1059355686 9:113697764-113697786 CAGTGCAGGTTCCAGGAGGCAGG - Intergenic
1059772806 9:117443723-117443745 CAGGGATGAGTGGAGGAGGCAGG + Intergenic
1060193307 9:121606721-121606743 CAGTGGGGGGTGAGGGAGGTGGG + Intronic
1061852441 9:133424024-133424046 CAGAGCAGGGTCCAGGAGGCAGG + Intronic
1061909298 9:133714344-133714366 CAGGGGAGGGTGGAGGAGGCAGG + Intronic
1062011587 9:134269984-134270006 CCGTGAAGGGTGAAGGATGAAGG - Intergenic
1062011592 9:134270011-134270033 TCGTGAAGGGTGAAGGATGAAGG - Intergenic
1062107992 9:134766158-134766180 CTGGGAAGGCTGAAGGGGGCAGG - Intronic
1062488210 9:136791512-136791534 CAGGGAAGAGTGGCGGAGGCTGG + Intronic
1203733646 Un_GL000216v2:114896-114918 CAGTGAAGAGTGAAATAGGAAGG + Intergenic
1203545267 Un_KI270743v1:123547-123569 GAGTGAAAGGTGAAGGTGGGGGG - Intergenic
1186342215 X:8657054-8657076 CAGAGAAGTGGGAAGGGGGCAGG + Intronic
1186368985 X:8927295-8927317 CAGTTAAGGGTGATGGAGGGAGG - Intergenic
1187606933 X:20895127-20895149 CAGTGAAGGGTGAAGAATCAGGG + Intergenic
1187824210 X:23318445-23318467 CAGAGAAGGGAGAAGGAGGTTGG - Intergenic
1187882869 X:23862838-23862860 AAGGGAAGGGAGAAGGAGGGAGG + Intronic
1187882913 X:23862944-23862966 CAGGGAAGGGAGAAGGAGGGAGG + Intronic
1188019773 X:25144451-25144473 CAGAGAAGGGCGAAGGATTCGGG + Intergenic
1188078217 X:25805705-25805727 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1188781111 X:34286558-34286580 CACTGAAGAAAGAAGGAGGCTGG + Intergenic
1189187879 X:39069988-39070010 CATTGAAAGGTGAAGTTGGCTGG - Intergenic
1189242021 X:39532666-39532688 CAGGGAGGGCTGAAGGATGCAGG + Intergenic
1189297690 X:39930332-39930354 CAGGGTAGGGTGACGGAGGGTGG - Intergenic
1189989495 X:46580721-46580743 GAGTGAACAGGGAAGGAGGCTGG + Intronic
1190301774 X:49061136-49061158 CAGAGAAGGAGGCAGGAGGCAGG + Intronic
1190753289 X:53380527-53380549 CAGTGGAGGGGAAAGGAGGTGGG - Intronic
1191255306 X:58277090-58277112 CAGGGAAAGGTTGAGGAGGCCGG - Intergenic
1191764620 X:64683862-64683884 GAGTGAAGGATGAAAGAGGGAGG + Intergenic
1192048541 X:67701932-67701954 GAGTCAAGGGTGAAGAAGGGAGG + Intronic
1193223975 X:78959985-78960007 CAATGCAGGCTTAAGGAGGCAGG + Intronic
1194035360 X:88864072-88864094 CAGTGAGAGGTGAAGCCGGCTGG + Intergenic
1194809633 X:98374879-98374901 CTTTGAAGGGTGAAGGAGAATGG + Intergenic
1195157563 X:102139617-102139639 CAGTAAAGGGTGCAGGACCCGGG + Intergenic
1196505537 X:116436740-116436762 AAGTGCAGGGAGAAGGAGGTAGG + Exonic
1196741285 X:119028415-119028437 CACTGAAAGGTGAAGCTGGCTGG - Intergenic
1196911854 X:120491874-120491896 CAGGCAAGGGTTAAGGAGGAAGG + Intergenic
1197078934 X:122388912-122388934 CAGTGAGAGGTGAAGCTGGCTGG - Intergenic
1197300836 X:124778391-124778413 CATTGAAGGGTGAGGGGAGCAGG - Intronic
1198839424 X:140840835-140840857 CAGTGTTGGGTGAGGGAGCCAGG + Intergenic
1199556383 X:149113931-149113953 CAGTGAGAGGTGAAGCCGGCTGG - Intergenic
1201256346 Y:12111996-12112018 GAGGGAAGGGGGAAGGAGGGAGG - Intergenic
1201361319 Y:13153069-13153091 CAGTGAGAGGTGAAGGTAGCTGG - Intergenic