ID: 961059502

View in Genome Browser
Species Human (GRCh38)
Location 3:123816527-123816549
Sequence CAGGTTGGTTCCCTGGAGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 189}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961059502_961059507 4 Left 961059502 3:123816527-123816549 CCACACTCCAGGGAACCAACCTG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 961059507 3:123816554-123816576 TGAAGATGTATTTCACTGGTTGG 0: 1
1: 0
2: 1
3: 14
4: 257
961059502_961059506 0 Left 961059502 3:123816527-123816549 CCACACTCCAGGGAACCAACCTG 0: 1
1: 0
2: 1
3: 15
4: 189
Right 961059506 3:123816550-123816572 AAATTGAAGATGTATTTCACTGG 0: 1
1: 0
2: 4
3: 23
4: 366

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961059502 Original CRISPR CAGGTTGGTTCCCTGGAGTG TGG (reversed) Intronic
900056123 1:632048-632070 CATATTGCTTCCGTGGAGTGTGG - Intergenic
900288187 1:1911787-1911809 GAGGCTGCTGCCCTGGAGTGGGG + Intergenic
900295410 1:1946744-1946766 CAGATTGTTTCCCGGGTGTGGGG - Intronic
902114249 1:14107859-14107881 CAGGTAGGTTTCTTGGAGTCAGG - Intergenic
902331281 1:15732267-15732289 CTGGCTGGTCCCCTGGAGTGTGG + Intronic
903254249 1:22082643-22082665 CATGTTGCTTCCATGGAATGTGG + Intronic
903997707 1:27318069-27318091 CAGGCTCTTTCCCTGGATTGAGG + Intergenic
904012696 1:27398803-27398825 CAGGTTGGTTCCTGTGTGTGTGG + Intergenic
906159854 1:43640036-43640058 CAGCCTGGTTCCCTGGGGAGGGG - Intergenic
912379679 1:109240637-109240659 AATGTTGGTTCCCAGGAGTGAGG - Intergenic
914338779 1:146740321-146740343 CAAGCTGGTTCCCTTGAGTAGGG + Intergenic
915039333 1:152954754-152954776 TGTGTTGGTTCCCTGGAGGGAGG - Intergenic
916496439 1:165352540-165352562 CGGGTTTGTTCGCTGGAGTCCGG - Intronic
918529370 1:185501367-185501389 CACATTAGTTCCCTGGACTGTGG - Intergenic
920657764 1:207889096-207889118 CAGGGGGGCTCCCTGGAGTAAGG - Intronic
920684906 1:208101954-208101976 AATCTTGGTTCCCTGCAGTGAGG - Intronic
920782749 1:209010578-209010600 CAGAATGGCTCCCTGGTGTGGGG + Intergenic
922760588 1:228127651-228127673 CAGGTTGATTGCCTGGACTCAGG - Intergenic
1062895894 10:1102894-1102916 CAGGTAGGAACTCTGGAGTGAGG - Intronic
1063925796 10:10976011-10976033 CAGGTTGTTGCCCTGGAAAGGGG + Intergenic
1063974541 10:11404858-11404880 CAGATCTGTTCCCTGGAGGGTGG - Intergenic
1065797628 10:29321807-29321829 CAGGTTAGATCCCAGGTGTGCGG - Intergenic
1066391363 10:34979668-34979690 CAGGTTGATGCCCTGGTTTGAGG + Intergenic
1067158705 10:43804133-43804155 CAGGTGAGTTTCCAGGAGTGTGG - Intergenic
1069085416 10:64134062-64134084 CAGGTTGGTACCCTACACTGTGG - Intergenic
1070388370 10:75947407-75947429 CAGGATGGCTGCCTGAAGTGAGG - Intronic
1070559678 10:77556743-77556765 GAAGATGGTTCCCTGGAGTTGGG - Intronic
1073179477 10:101575067-101575089 CAGGGATGTTCCCTGCAGTGTGG + Intronic
1075020423 10:118948255-118948277 CATGCTGGGTCCCAGGAGTGTGG + Intergenic
1075619141 10:123912791-123912813 CTGGATGGTTGCCTGGACTGAGG - Intronic
1075727044 10:124616059-124616081 CAAGTTGCTACCCAGGAGTGGGG + Intronic
1076616467 10:131758631-131758653 AAGACTGGCTCCCTGGAGTGAGG - Intergenic
1076702812 10:132283041-132283063 CGGGTTGGCTGCATGGAGTGGGG - Intronic
1078709078 11:13772989-13773011 CAGGTTGGTACACTGGAGTGTGG + Intergenic
1080679489 11:34460831-34460853 TTGGTTCCTTCCCTGGAGTGGGG + Intronic
1081867639 11:46368270-46368292 CAGGTTTGTTCCAGGCAGTGGGG - Intronic
1082654116 11:55831964-55831986 ATGGTTGATTCCTTGGAGTGTGG - Intergenic
1083166245 11:60889951-60889973 CTGGCTGCCTCCCTGGAGTGGGG - Intergenic
1083237331 11:61359791-61359813 CAGGTGGGTTACCTGAAGTCAGG + Intronic
1084562888 11:69914149-69914171 CAGGGTGGACCCCCGGAGTGTGG - Intergenic
1085702826 11:78760319-78760341 CAGGTAGTTTGCCTGGAGAGAGG - Intronic
1087890293 11:103530596-103530618 CAGATTGCTTACCTGGAGAGTGG - Intergenic
1088239222 11:107756757-107756779 CAGCGTGGTTGGCTGGAGTGAGG - Intergenic
1089130513 11:116208343-116208365 AAGCTTGGGACCCTGGAGTGAGG + Intergenic
1089431420 11:118427838-118427860 CAGGTTGGTACACTGGACAGGGG - Intronic
1091530568 12:1350924-1350946 CAGATTAGTTCCCAGGAGAGTGG - Intronic
1093339109 12:17949734-17949756 CAGCTTGGTCCCATGGGGTGGGG - Intergenic
1093928659 12:24933563-24933585 CAGGTTCCTCCCCTGGCGTGAGG - Intronic
1094727172 12:33132206-33132228 CAGGATTTTTCCCTGGAGTGCGG + Intergenic
1099324584 12:81198098-81198120 CATGTTGGTTTCTTAGAGTGTGG - Intronic
1103649779 12:122423146-122423168 CAGGGTCTTTCCCTGGAGGGAGG - Intergenic
1104415610 12:128594733-128594755 TAGGTGGGATCCCTGGACTGAGG - Intronic
1104857517 12:131909022-131909044 CTGGTTGGTTGGCTGGCGTGTGG + Intronic
1105544683 13:21342794-21342816 CAGCTTGGTTCTCTGGGCTGGGG + Intergenic
1107017668 13:35720856-35720878 CAGGCTGGTTCCCCGGCGCGGGG + Intergenic
1111923747 13:94440906-94440928 CAGGTGGATTCCCTGCAGTCAGG - Intronic
1112773880 13:102823300-102823322 CAGGTTGGTTACTTGGAGGCAGG + Intronic
1112786780 13:102960215-102960237 GAGGTTAGTTGCCTAGAGTGTGG + Intergenic
1113709468 13:112454154-112454176 GAGCTTGGGCCCCTGGAGTGAGG + Intergenic
1115376273 14:32680049-32680071 CAGATTGGGTCCCTGGAATCTGG - Intronic
1115490955 14:33957640-33957662 CAGGTTCTTTCTCTGGAGGGAGG - Intronic
1116733917 14:48663966-48663988 AAGGGTGGTTACCAGGAGTGGGG + Intergenic
1117419681 14:55531894-55531916 CAGGTGGATTACCTGGAGTCAGG + Intergenic
1118765781 14:68908518-68908540 CAAGTTGGTGACCTGGAGTTGGG - Intronic
1122211908 14:100178866-100178888 GAGGTTGGGCCCCTGGAGAGTGG + Intergenic
1123144143 14:106111471-106111493 CAGGTGGGTGCCATGGAGTAGGG + Intergenic
1123220915 14:106854560-106854582 CAGGTGGGTGCCATGGAGTAGGG + Intergenic
1126795847 15:52260024-52260046 CAGGGTGGGTCCCAGGAGAGGGG + Intronic
1128037901 15:64542817-64542839 CAGGTTGGTCCCCTGGCTTCTGG + Intronic
1128048084 15:64637074-64637096 GAGATTGGTTACCTGGGGTGGGG - Intronic
1129387944 15:75206287-75206309 CAGGTTGTCTGCCTGAAGTGGGG - Exonic
1129876168 15:78977136-78977158 CGGGTTGGTTTCCTGGAGTTTGG - Intronic
1131841068 15:96438273-96438295 CAGGTTGCTATCCTGGATTGTGG + Intergenic
1132309246 15:100844907-100844929 CAGCTTGTTTGCCTGGTGTGAGG + Intergenic
1132881440 16:2163343-2163365 CAGGTTCTTTCTCTGGGGTGTGG + Intronic
1133178590 16:4035243-4035265 GACACTGGTTCCCTGGAGTGAGG - Intronic
1133390159 16:5403818-5403840 CAAGTTGGGACCCAGGAGTGAGG - Intergenic
1133840064 16:9399824-9399846 CAGCTTGCTTTCCTGGGGTGGGG + Intergenic
1134000534 16:10779510-10779532 CAGGTTGGTGCCTGGGAGGGCGG - Intronic
1139995498 16:70977033-70977055 CAAGCTGGTTCCCTTGAGTAGGG - Intronic
1141761750 16:86033244-86033266 CAGTTTGCCTCCCTGGACTGTGG + Intergenic
1142611266 17:1110071-1110093 CAGGATGGCTCCCTGCGGTGGGG - Intronic
1142639839 17:1279502-1279524 CAGGGTGGTTCTCTGGGGAGAGG + Intergenic
1144415737 17:15044408-15044430 CAGGTGGGTTGACTGGAGAGGGG - Intergenic
1146065654 17:29632712-29632734 CAGGTTTGTTCTCTGGAGTCTGG + Exonic
1147666818 17:42154351-42154373 CTGGTTGGTTCTCTGGCTTGAGG + Intronic
1148358944 17:46996048-46996070 CTGCTTGCTTTCCTGGAGTGAGG + Intronic
1148810903 17:50290495-50290517 CAGGAGGGTTCCTGGGAGTGGGG - Intergenic
1148873512 17:50672960-50672982 CAGGTTAATGCCCTGGAGGGAGG - Exonic
1149575383 17:57708147-57708169 TAGCTCGGTTCCCTGGAGTCTGG - Intergenic
1155677661 18:28449255-28449277 CAGGTTGTTTCCCTCGAAGGTGG + Intergenic
1156563992 18:38163166-38163188 CACGTTGGTTTCCTGAACTGTGG - Intergenic
1157846074 18:51005169-51005191 CAAATTGGTTCCCTGGCCTGTGG + Intronic
1158523457 18:58191491-58191513 CAGGTAAGTTCCCTGGACTGAGG + Intronic
1158851173 18:61496542-61496564 CTGGCTGGTGCCCTGGAGTCTGG - Intronic
1159585410 18:70279035-70279057 CAGGTGGATCACCTGGAGTGGGG - Intergenic
1160371670 18:78377465-78377487 GATGTTGGTTCCCTGGAGCGTGG + Intergenic
1161120340 19:2522188-2522210 CTGGATCGTTCCCTGGAGCGGGG - Intronic
1161936692 19:7376572-7376594 CAGGCAGGTTCCCTGGATTGAGG - Intronic
1162013518 19:7831464-7831486 CAAGTTGGCTTCCTGGGGTGCGG - Intronic
1162067237 19:8133193-8133215 CAGGATCCCTCCCTGGAGTGTGG + Intronic
1163452068 19:17384155-17384177 CAGGATGGTGCCCTGGAGACAGG + Intergenic
1163734550 19:18971405-18971427 CAGGTGGGTTACCTGAAGTCAGG + Intergenic
1163820114 19:19491750-19491772 CAGGTTGGCTGCCAGGTGTGAGG + Intronic
1164855844 19:31520066-31520088 CAGGGTGTTGCCATGGAGTGTGG + Intergenic
1165313158 19:35040512-35040534 CAGGTAGGGTCCCTGGAAAGCGG - Exonic
1167110315 19:47456910-47456932 CAGGTGGGTCCCCCGGGGTGGGG - Exonic
1167801139 19:51742901-51742923 CAGGGTGGTTCCCGTGACTGAGG - Intergenic
1168388697 19:55988052-55988074 CAGCTTTGAACCCTGGAGTGAGG + Exonic
925180077 2:1811819-1811841 CAGGAGGGTGCCCCGGAGTGGGG - Intronic
926286307 2:11491728-11491750 CTGTCTGGTTCCCAGGAGTGAGG + Intergenic
931467599 2:62505542-62505564 CAAATTTGTTCCCTGGGGTGGGG + Intronic
932355361 2:71064237-71064259 CAGGTTGCTGCCCTGGCCTGAGG + Intergenic
933815618 2:86065955-86065977 CTGTTTGGTCCCCTGGAGTAGGG - Intronic
933901504 2:86853616-86853638 CAGCTTGGTGTCCTGGAGAGAGG + Intronic
937444903 2:121949674-121949696 CAGGCTGGTTCCCAGGATGGAGG - Intergenic
939266875 2:139885444-139885466 TGGATTAGTTCCCTGGAGTGTGG - Intergenic
940427391 2:153545802-153545824 CATGTTGGGTGCCTGGATTGGGG - Intergenic
941549813 2:166901079-166901101 CATGTTGTTTGCCTGGAGTATGG + Intronic
942301471 2:174566972-174566994 CAGGCTTCTTGCCTGGAGTGGGG - Intronic
942815598 2:180050231-180050253 CAGGTAGGTTCCATGGAGACAGG + Intergenic
947546141 2:231011673-231011695 CAGTTTGGTTCCCTGGATCCTGG - Intronic
948221314 2:236271991-236272013 CAGGCTGGGGCCCTGGGGTGAGG + Intergenic
948548104 2:238746700-238746722 CACAGGGGTTCCCTGGAGTGTGG - Intergenic
1169327718 20:4688514-4688536 CAGGTAAGTTCTCAGGAGTGGGG - Intronic
1171027564 20:21645098-21645120 CAGGTGGATTACCTGAAGTGAGG + Intergenic
1173920881 20:46743933-46743955 CCGGCTGGTGCCCTGCAGTGTGG + Intergenic
1174452298 20:50627951-50627973 CAGCTGTGTGCCCTGGAGTGGGG - Intronic
1175535299 20:59706810-59706832 CAGCCTGGTTCCCTGGGGTCTGG + Intronic
1175575496 20:60057791-60057813 CAAGTTGGTCCCCTGTAGGGAGG + Intronic
1175948776 20:62571556-62571578 GAGGTTGGGTCCCTGAGGTGGGG + Intergenic
1176171704 20:63699193-63699215 CAGGTTGGTTCCCAGGACCTGGG - Exonic
1180051695 21:45334640-45334662 CACGTGCCTTCCCTGGAGTGAGG + Intergenic
1182129950 22:27843629-27843651 CAGCTTGGTGCCCAGGAGGGAGG + Intergenic
1182366814 22:29784633-29784655 CAGGTGGGTCCCCTGGAGCCTGG + Intergenic
1182932524 22:34188808-34188830 CAGGTTTGGTGCCTGGAGAGAGG + Intergenic
1183565561 22:38611966-38611988 AAGGTTGCTTCCCAGGTGTGCGG - Intronic
1183888989 22:40909726-40909748 CAGGCTGGAGCACTGGAGTGCGG - Intronic
1184665970 22:45989234-45989256 CAGGATCGTTCCCTGTGGTGGGG + Intergenic
1185410256 22:50678054-50678076 CAGGATGGGTCCCTGGGGTGGGG + Intergenic
951474977 3:23095163-23095185 GAGGTAGTTTCCCTGGAGGGAGG - Intergenic
952284440 3:31954600-31954622 GATGGTGGTTGCCTGGAGTGGGG + Intronic
953521550 3:43648012-43648034 GAGGTTGGTTCCCTTGAGAGAGG - Intronic
954328317 3:49875677-49875699 CAGGTTGGGGCACTGGAGAGGGG + Intergenic
954704727 3:52473342-52473364 CAGCTCAGTTCCATGGAGTGGGG + Intronic
954794475 3:53154562-53154584 AAGGGTGGCTCCCTGGTGTGTGG - Intergenic
955008347 3:54990678-54990700 CACCTTGCTTCCCTGGAGAGAGG - Intronic
956338033 3:68186676-68186698 CAGGTTGGGTCCCTGGATAAAGG - Intronic
957984960 3:87562431-87562453 CATGATCTTTCCCTGGAGTGTGG - Intergenic
960816565 3:121679585-121679607 CATGTTGTTTGCCTGGAGTATGG - Intronic
961059502 3:123816527-123816549 CAGGTTGGTTCCCTGGAGTGTGG - Intronic
962991621 3:140582651-140582673 CAGGATGGTTCTCCGGAATGAGG - Intergenic
963488748 3:145971951-145971973 CAGCATGGTTTTCTGGAGTGAGG - Intergenic
968905499 4:3448868-3448890 CAGGATGGTTTCCTGGAGGAGGG + Intronic
969668315 4:8574996-8575018 CCGGTTGGCTCCCTGCACTGGGG + Intronic
970656656 4:18238163-18238185 AAGTTTCCTTCCCTGGAGTGTGG + Intergenic
972578133 4:40370801-40370823 CAAATTGATTCCCTGGAGTTGGG + Intergenic
975096307 4:70461003-70461025 CAGATTGTTTCCGTGCAGTGAGG + Intronic
981908586 4:149952530-149952552 CAAGTTGTTGTCCTGGAGTGGGG - Intergenic
983495166 4:168435258-168435280 CAGGTTGGTTCCCTGACCTGTGG + Intronic
985899398 5:2776886-2776908 CAAGCTGGCTGCCTGGAGTGGGG + Intergenic
987113187 5:14705878-14705900 GATGCTGGTTCCCTGAAGTGTGG - Exonic
988046552 5:25963036-25963058 CAGGTGGGTTCCCTGAGGTCGGG - Intergenic
988948498 5:36232786-36232808 TAGGTGAGTTTCCTGGAGTGGGG - Intronic
992449130 5:76859828-76859850 CAGATGGTTTCCCTGGAGTTGGG - Intronic
995168663 5:109079419-109079441 CAGATTGGTGCTCTGAAGTGTGG + Intronic
997427803 5:133816192-133816214 CAAGTGGGCTCCCTGCAGTGAGG + Intergenic
997440338 5:133904777-133904799 GTGGTCCGTTCCCTGGAGTGAGG - Intergenic
997738408 5:136231959-136231981 CCAGTTGTTACCCTGGAGTGGGG + Intronic
998368563 5:141646703-141646725 CAGGTGTGTGTCCTGGAGTGGGG - Exonic
999271284 5:150297704-150297726 CAGCATGGCTCCCTGGAGGGCGG - Exonic
1001707752 5:173753947-173753969 CAGGTTGGGTTGCAGGAGTGTGG - Intergenic
1004095015 6:12545051-12545073 CAGCTTGGTTTCCTGGCATGAGG - Intergenic
1006794405 6:36722502-36722524 GCCCTTGGTTCCCTGGAGTGAGG - Exonic
1007357564 6:41332531-41332553 GGGGTTGGTTCCATGGAGTAAGG + Intergenic
1007389024 6:41539151-41539173 CTGGCTGGGTCCATGGAGTGGGG - Intergenic
1010051085 6:71505164-71505186 GATGTTTGTTCCCTGGAGTTAGG + Intergenic
1010657340 6:78526686-78526708 CAGGTTTGTTCTCTGGGGAGTGG + Intergenic
1011074899 6:83428766-83428788 CAAGTTGGTACACTGGATTGTGG + Intronic
1012602187 6:101112323-101112345 CAGGTTGTCTCTCTGGAGTAGGG + Intergenic
1013761284 6:113521689-113521711 CAGGTTGTTTTCTTGAAGTGAGG - Intergenic
1014125872 6:117776474-117776496 GAGGTTGATTCCATGGAGTCAGG - Intergenic
1014156919 6:118121676-118121698 CAATTTGATTCCCTTGAGTGGGG - Intronic
1019061207 6:169259487-169259509 CAGGATCCTTCCCTGGAGAGGGG + Intergenic
1022408601 7:30118090-30118112 CAGGCTGATCCCCTGGAGAGAGG - Intronic
1024205030 7:47150885-47150907 CAGGTATGTTTCATGGAGTGGGG - Intergenic
1025723736 7:64038634-64038656 CAGGTTGGTTCCCAGGAATCAGG + Intronic
1032727257 7:134602194-134602216 CAGGTTGGTTCTCTGCAGTTTGG + Intergenic
1032802329 7:135326982-135327004 CAGGTAGGGTCCCTGGAGCCAGG + Intergenic
1033859890 7:145611931-145611953 TAAGTTTGTTCCCTGGAGAGAGG - Intergenic
1035577343 8:716243-716265 CAGGGTGATGCCCTGGAGAGAGG - Intronic
1036690397 8:10941262-10941284 CAGGTTGGTTCCCTGGGGGCAGG + Intronic
1042884765 8:73536434-73536456 CATGGTGTTTCCCTGGAGTAGGG - Intronic
1047564914 8:126033624-126033646 CACATTGGTTCCCTGAACTGTGG - Intergenic
1048113326 8:131491624-131491646 CCAGTTTGTTTCCTGGAGTGAGG - Intergenic
1050018414 9:1259893-1259915 CAGGTGGGTTTCCTGTGGTGGGG + Intergenic
1052278499 9:26705787-26705809 CAGGTTGGTATCCTGGAGATTGG + Intergenic
1057048027 9:91900648-91900670 CACGTCGGTTCCATGGACTGGGG + Intronic
1059169773 9:112114253-112114275 CAGGTTGGTCACCTGAAGTCAGG + Intronic
1061886099 9:133591787-133591809 CAGGTTGGTCCCAAGGAGTGAGG - Intergenic
1202629774 M:6877-6899 CATATTGCTTCCGTGGAGTGTGG - Intergenic
1190300124 X:49052665-49052687 CAGTTTGGGTCAGTGGAGTGTGG + Intergenic
1191159410 X:57312019-57312041 CAGGGTGGGTCCATAGAGTGTGG + Intronic
1194608022 X:96005803-96005825 CTGCTTGGTTCCCTGGATTCTGG - Intergenic
1196281500 X:113828441-113828463 GTGGTTTTTTCCCTGGAGTGGGG - Intergenic
1199784193 X:151089806-151089828 CAGGTTGATTACCTGAAGTCAGG - Intergenic