ID: 961059941

View in Genome Browser
Species Human (GRCh38)
Location 3:123820185-123820207
Sequence CTGTTGTAGTTGGGCAGAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 133
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 124}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961059937_961059941 -8 Left 961059937 3:123820170-123820192 CCAGCAGGACACCAGCTGTTGTA 0: 1
1: 0
2: 0
3: 13
4: 118
Right 961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG 0: 1
1: 0
2: 1
3: 7
4: 124
961059934_961059941 17 Left 961059934 3:123820145-123820167 CCTGAGGGTGTGACTCAGGCAAA 0: 1
1: 0
2: 1
3: 19
4: 170
Right 961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG 0: 1
1: 0
2: 1
3: 7
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961059941 Original CRISPR CTGTTGTAGTTGGGCAGAAC AGG Intronic
900337815 1:2173402-2173424 CTGCTGTCCTTGGGCAAAACGGG + Intronic
903740412 1:25555478-25555500 CAGTTGTAGTTTTTCAGAACTGG + Intronic
903746487 1:25590312-25590334 CTGTGGTAGTTTAGCAGAGCTGG - Intergenic
904563888 1:31415687-31415709 GTGGTGTAGTTGGGCACTACTGG + Intronic
905785742 1:40755932-40755954 CAGCTGTAGTTGGGGATAACTGG + Intronic
907497560 1:54854942-54854964 CTGTTGGAGGTGGGCAGAGCTGG - Intronic
909175287 1:72349658-72349680 TTGTTGTTGGTGGGGAGAACGGG - Intergenic
910006731 1:82406399-82406421 CTGATCTAGTCTGGCAGAACAGG + Intergenic
910454751 1:87385551-87385573 CTCTTGCACTTGAGCAGAACAGG + Intergenic
911487219 1:98516723-98516745 CTGTTGTAGTGTGGCTGAGCTGG - Intergenic
911611643 1:99964975-99964997 CTGAGGTAATTGGCCAGAACTGG + Intergenic
912758601 1:112346188-112346210 GTTTTGCAGTTGGGCTGAACTGG - Intergenic
913157452 1:116113943-116113965 CAGTTCTTGTTGGGCAGAAATGG - Intronic
916097886 1:161367254-161367276 CTCTTTTTGTTGGGCAGCACTGG + Exonic
916145184 1:161732015-161732037 CTGTTGTAGAAGGGCTGCACAGG + Intergenic
916392097 1:164342149-164342171 CTGTTGGAGCTGGACAGAGCAGG + Intergenic
917140323 1:171828680-171828702 TTGTTGTAGATGGGCACAATAGG + Intergenic
920353589 1:205353921-205353943 CTATTAGAGTTAGGCAGAACAGG + Intronic
922239090 1:223743826-223743848 GTGTTGTGGTTGGGCAGAGATGG - Intronic
1064340889 10:14484301-14484323 CTGTTTTAGTTGGGTATGACAGG - Intergenic
1065304050 10:24351945-24351967 CTGTGGTTGATGGGCAGGACAGG + Intronic
1068820831 10:61376526-61376548 CTGTTGGATCTGGACAGAACAGG - Intergenic
1070654277 10:78260630-78260652 ATGTTGGAGGTGGGCAGAGCAGG - Intergenic
1076862901 10:133150115-133150137 CTGGTGAAGTTGGGGAGAAAAGG + Intergenic
1077059112 11:609986-610008 CTCCTGCAGGTGGGCAGAACAGG + Intronic
1082081246 11:48013930-48013952 TTGCTGAAGTTGGGCAGAGCAGG + Intronic
1082741541 11:56916955-56916977 ATGTTTTAGTTGGGCAGATTTGG - Intergenic
1087876836 11:103369199-103369221 CTGTTATAATAGGGCAGCACTGG - Intronic
1092048818 12:5453490-5453512 TTGTTCCAGTTGGGAAGAACTGG + Intronic
1092077455 12:5685453-5685475 CTGTTCCAGTTGGGCAGAGGTGG - Intronic
1096726791 12:53570518-53570540 ATGTTGTATTTTGGCAGGACAGG - Intronic
1098532308 12:71554723-71554745 CTGTTGTATTTTTGCAGAAGTGG + Intronic
1104500337 12:129279132-129279154 ATGTTGTATTTGGGCTGCACAGG - Intronic
1106676005 13:31958657-31958679 CTGTTGTAGTTGGGCAGCAGAGG + Intergenic
1107140654 13:36995274-36995296 TTGTTGTAGTTCGGCAGAGAGGG - Intronic
1107274355 13:38660916-38660938 CTGAAGAAGTTAGGCAGAACTGG - Intergenic
1108966020 13:56302920-56302942 CTATTGGAGTTGGGGAAAACTGG + Intergenic
1110607647 13:77451354-77451376 CTTTTTAAGCTGGGCAGAACTGG - Intergenic
1118787245 14:69056121-69056143 ATGTTGCAGTTGGGCAGAAGTGG - Intronic
1119500415 14:75122210-75122232 CTTTTGTGGTTAGGAAGAACTGG - Intronic
1121603415 14:95222961-95222983 CTGTTTTAGTTAGGCACAATGGG + Intronic
1121788284 14:96679663-96679685 CTATTGGAGTTGGGAAGATCTGG + Intergenic
1122548211 14:102536515-102536537 CTGTTGTAGTCGGGCGGGTCGGG - Intergenic
1122643900 14:103178599-103178621 CTGAAGTGGGTGGGCAGAACAGG + Intergenic
1127582830 15:60353337-60353359 CTGTTGTGGTGGGGGAGAAAGGG - Intronic
1128713043 15:69886214-69886236 CGGTTGCAGATGGGCAGAAAGGG + Intergenic
1130323411 15:82858841-82858863 CTGATGTGGTTGGCCAGAGCAGG + Intronic
1130618055 15:85431952-85431974 TTGCTGTAGTTGTGCAGATCTGG + Intronic
1131629820 15:94164915-94164937 CTGGTGTAGTGGTGCAGAACAGG - Intergenic
1136294807 16:29295384-29295406 CTGTGGCAGGTGGGTAGAACTGG + Intergenic
1142100698 16:88269395-88269417 CTGTGGCAGGTGGGTAGAACTGG + Intergenic
1144287772 17:13795076-13795098 CTGCTGTTGTTGGACAAAACTGG - Intergenic
1145367590 17:22277957-22277979 CTGATGTGGTTGTGCATAACTGG + Intergenic
1147667362 17:42157004-42157026 ATGTTGTAATGGGGGAGAACAGG + Exonic
1149583625 17:57769119-57769141 CTGTTGAAGCTGGGCAGGAAAGG - Intergenic
1150473709 17:65458533-65458555 TTGTTCTAGATGGGGAGAACTGG + Intergenic
1153336073 18:3926162-3926184 CTGAAGTAGTTGGGAAGACCTGG - Intronic
1154092065 18:11374549-11374571 GTGTGGAAGTTAGGCAGAACTGG - Intergenic
1154348268 18:13562331-13562353 CTGATGTAGGTTGGCAGAGCTGG - Intronic
1155667678 18:28331058-28331080 CTAATGAAGTTGGGAAGAACTGG + Intergenic
1158749202 18:60239395-60239417 CTGTTGAAGTTGTGGAGAAAAGG - Intergenic
1159755095 18:72354602-72354624 ATGTTATATTTAGGCAGAACTGG - Intergenic
1160067283 18:75587453-75587475 CTGGTGAACTTGGGCACAACTGG - Intergenic
1162740758 19:12772354-12772376 CTGGGGTTATTGGGCAGAACTGG - Intronic
1162771558 19:12952556-12952578 ATGTTGTGTTTGGCCAGAACAGG + Intronic
1163786970 19:19279744-19279766 CAGTTGTAGTTGGGCAGTGTCGG - Intronic
1164552155 19:29220896-29220918 CTGGTGGACTTGGGCAGACCTGG + Intergenic
929445320 2:41996665-41996687 CTGTGGAAGTTGGGCAGATGGGG - Intergenic
937650987 2:124318938-124318960 CTCCTCTAGTTGGGTAGAACTGG + Intronic
947502380 2:230680815-230680837 CTGTTGTCCTCGGGCAGAGCCGG - Intergenic
948765669 2:240217509-240217531 CTGGTGGAGATGGGCAGAGCTGG - Intergenic
948834705 2:240620408-240620430 CTGCTGCAGGTGGGCAGAGCTGG + Intronic
1170708009 20:18763361-18763383 GTGTTATCATTGGGCAGAACTGG + Exonic
1172929945 20:38579445-38579467 CTGTTGTGCGTGGGCAGAGCAGG - Intergenic
1174295884 20:49544782-49544804 ATGCTGGAGTTGGGCAGACCAGG - Intronic
1179169881 21:38964498-38964520 CTGGTTAAGTTGAGCAGAACAGG - Intergenic
1180580761 22:16834154-16834176 CTGTTGTCGTTGGGTTGACCTGG + Intergenic
1184045909 22:41972003-41972025 CTGTTGGATTTGGTCAGACCTGG - Intergenic
950350474 3:12346165-12346187 CTTTTGAAGCTGGGCAGAAAAGG + Intronic
952932234 3:38369324-38369346 CTGTGGCAGGTGTGCAGAACGGG - Intronic
953984774 3:47433186-47433208 CTGTTTTAGTTATGAAGAACAGG - Intronic
954967568 3:54624937-54624959 CAGCTGTAGTTGGGCAGGAAGGG - Intronic
955865387 3:63377035-63377057 CAGTTGTACTTGGGAAAAACGGG - Intronic
959349395 3:105242218-105242240 CTGTTGTAATTGGTTAAAACTGG - Intergenic
961059941 3:123820185-123820207 CTGTTGTAGTTGGGCAGAACAGG + Intronic
966512668 3:180781622-180781644 CTGTTGGACCTGGACAGAACAGG - Intronic
967771200 3:193335135-193335157 CTCAGGTAGTTGGTCAGAACTGG + Intronic
969400232 4:6950059-6950081 CTGTTGGAGGTGGGGAGCACGGG - Intronic
972933644 4:44104857-44104879 CTGTTGTACTTGAACAGAGCAGG - Intergenic
975208650 4:71673218-71673240 CTGTTGTAGGTCAGCAGGACTGG - Intergenic
976364450 4:84217564-84217586 CAGTGGTAGATGGGCATAACTGG + Intergenic
976591460 4:86853387-86853409 CTGTTATAGTGGGGAAGAATGGG + Intergenic
982037215 4:151357346-151357368 CATTTGTAGTAGGGCAGAATAGG + Intergenic
983456338 4:167969094-167969116 CTGTTGTAGTGTGGCTGAGCTGG - Intergenic
989779546 5:45247527-45247549 CTGTTGGAGCTGGACAGAACAGG - Intergenic
990999549 5:61768977-61768999 CTGTGGACGGTGGGCAGAACTGG + Intergenic
993492471 5:88568926-88568948 CTGTTGTGGGTCGGCAGAAGGGG + Intergenic
994477565 5:100290391-100290413 CTGTTGTACTGTGGCTGAACTGG + Intergenic
995299264 5:110558630-110558652 CTGTTGGACTTGTACAGAACAGG - Intronic
995793331 5:115916877-115916899 CAGTTGTAGTTGAGCAAAGCTGG - Intergenic
1003361436 6:5429852-5429874 GTTTTGGAGTTGGGCAGACCTGG + Intronic
1004020324 6:11770855-11770877 CTGCTGTAGTTAGGAAGAGCAGG + Intronic
1004424760 6:15499757-15499779 CTGATGTGGTTGTGGAGAACAGG - Intronic
1006728252 6:36215622-36215644 CTGTAGGAGTTGGGCTGAGCTGG + Intronic
1012801928 6:103841405-103841427 GTTTTGATGTTGGGCAGAACAGG - Intergenic
1016723326 6:147328282-147328304 CTGGTCCAGTTGGGCAGGACAGG - Intronic
1020368217 7:7403164-7403186 CTGTTGAAGTTGGGGTGAAAGGG + Intronic
1021993768 7:26160394-26160416 CTTTTGAAATTGGGGAGAACTGG + Intronic
1027897973 7:84069202-84069224 ATGTTGAAATCGGGCAGAACTGG + Intronic
1028340488 7:89713321-89713343 CTGTTGTAGTTGGGAAGGTTTGG - Intergenic
1031070793 7:117159417-117159439 CTGTAATATTTGGGCAAAACAGG + Intronic
1031118054 7:117689708-117689730 CTGGTGTATTTGGGAAGAACAGG + Intronic
1035475262 7:159139299-159139321 GTGTTGTAGCTGAGGAGAACTGG - Intronic
1037870087 8:22486069-22486091 CTGTTTTAGTTGGGTATGACAGG + Intronic
1040511441 8:48099875-48099897 CTATTGTAGTGTGGCTGAACTGG + Intergenic
1046766077 8:118071759-118071781 CTGTTGAAATTGGACAGAAAAGG - Intronic
1047744767 8:127836566-127836588 TTGTTGGAGCTGGCCAGAACTGG + Intergenic
1048316809 8:133369072-133369094 CTGTGGTTGCTGGGCAGAATGGG - Intergenic
1048826139 8:138429013-138429035 CTTTTGTAGTGGGGGAGAAGGGG + Intronic
1050106775 9:2174044-2174066 CTGCTGTACGTGGGCATAACTGG - Intronic
1051500808 9:17775829-17775851 CTGATGCACTTGGGCAGAACAGG - Intronic
1055852506 9:80649293-80649315 CTGTTGTTATTGGGCAGAGAAGG + Intergenic
1059253193 9:112905539-112905561 CTGTTGTTGTAGGGCAGGAAGGG - Intergenic
1188518449 X:31012483-31012505 CTGTTTTTGGTGGGCAGAATTGG + Intergenic
1190911273 X:54774668-54774690 CTGCTGTTGCTGGGCAGAGCAGG + Intronic
1190919944 X:54841542-54841564 CTGCTGTTGCTGGGCAGAGCAGG - Intergenic
1194448140 X:94011473-94011495 CTGTAGTTGTTGGGCAGGACTGG + Intergenic
1195971700 X:110480459-110480481 CTGTTGGACTTGAACAGAACAGG - Intergenic
1197177419 X:123500591-123500613 CTGTTGGACCTGGACAGAACAGG - Intergenic
1200238960 X:154483713-154483735 CTCTTCTCGTTGGTCAGAACTGG - Exonic
1200969219 Y:9132370-9132392 CAGTTGTAGTTGTGGAGACCTGG - Intergenic
1202141606 Y:21730126-21730148 CAGTTGTAGTTGTGGAGACCTGG + Intergenic
1202145259 Y:21773676-21773698 CAGTTGTAGTTGTGGAGACCTGG - Intergenic