ID: 961061630

View in Genome Browser
Species Human (GRCh38)
Location 3:123833491-123833513
Sequence CTGAGGATAGGGAGAGCAGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 696
Summary {0: 1, 1: 1, 2: 2, 3: 65, 4: 627}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961061630_961061644 14 Left 961061630 3:123833491-123833513 CCTGCTGCTCTCCCTATCCTCAG 0: 1
1: 1
2: 2
3: 65
4: 627
Right 961061644 3:123833528-123833550 CCATGCACACGGGAGGCCCCTGG 0: 1
1: 0
2: 0
3: 10
4: 167
961061630_961061636 3 Left 961061630 3:123833491-123833513 CCTGCTGCTCTCCCTATCCTCAG 0: 1
1: 1
2: 2
3: 65
4: 627
Right 961061636 3:123833517-123833539 CCTACCCTGCCCCATGCACACGG 0: 1
1: 1
2: 3
3: 32
4: 295
961061630_961061639 7 Left 961061630 3:123833491-123833513 CCTGCTGCTCTCCCTATCCTCAG 0: 1
1: 1
2: 2
3: 65
4: 627
Right 961061639 3:123833521-123833543 CCCTGCCCCATGCACACGGGAGG 0: 1
1: 0
2: 3
3: 21
4: 192
961061630_961061637 4 Left 961061630 3:123833491-123833513 CCTGCTGCTCTCCCTATCCTCAG 0: 1
1: 1
2: 2
3: 65
4: 627
Right 961061637 3:123833518-123833540 CTACCCTGCCCCATGCACACGGG 0: 1
1: 0
2: 3
3: 24
4: 236
961061630_961061645 15 Left 961061630 3:123833491-123833513 CCTGCTGCTCTCCCTATCCTCAG 0: 1
1: 1
2: 2
3: 65
4: 627
Right 961061645 3:123833529-123833551 CATGCACACGGGAGGCCCCTGGG 0: 1
1: 0
2: 0
3: 6
4: 108

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961061630 Original CRISPR CTGAGGATAGGGAGAGCAGC AGG (reversed) Intronic
900517074 1:3087381-3087403 CTGAGGAACGCGAGAGCAGGTGG + Intronic
900802324 1:4745089-4745111 CTGTGGAGGGGAAGAGCAGCTGG - Intronic
901086469 1:6614558-6614580 CGGGGGATCGGGGGAGCAGCCGG - Intronic
901911125 1:12459112-12459134 CTGTGGATATGGAGAGCTGATGG - Intronic
901923541 1:12552407-12552429 GGTAGGATGGGGAGAGCAGCAGG - Intergenic
902334827 1:15748767-15748789 CAGAGGGTAGGCAGAGGAGCTGG - Intergenic
902618341 1:17636017-17636039 CTGAGGAAAGAGACAGCATCTGG - Intronic
902631502 1:17707235-17707257 CTGAGGATAGGGGCAGCAGTCGG - Intergenic
903004165 1:20287683-20287705 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
903637131 1:24828792-24828814 CTGAGGACAGGAAGAGTAGGTGG - Intronic
903954053 1:27012722-27012744 AGGAGGACAGGGAGAGCGGCTGG + Exonic
904475602 1:30762711-30762733 CTGAGGATGAGGTCAGCAGCAGG - Intergenic
904617525 1:31757982-31758004 CTGAGGATGGGGGGAGCTGCAGG + Intronic
904783105 1:32965036-32965058 CGGAGACCAGGGAGAGCAGCGGG - Intergenic
904977638 1:34470312-34470334 CAGAGCAAAGGGAGACCAGCTGG - Intergenic
904989641 1:34581426-34581448 CTGAGAACAGGAAGAGTAGCTGG - Intergenic
905281726 1:36853583-36853605 CTCAGGAGAGGGAGGGCAGGCGG - Intronic
905663790 1:39749359-39749381 GTGAGGGCAGGGAGAGCAGTGGG - Intronic
906312723 1:44765320-44765342 CTGAGGGTAGGGATAGCATTAGG + Intronic
906662137 1:47590573-47590595 CTGAGGATAGAGAGGGAGGCTGG + Intergenic
906725352 1:48040316-48040338 CTGGGGATGGGGAGAGGAGTGGG + Intergenic
906969397 1:50495257-50495279 CAGAGGCTAGGGAGGGCAGTGGG - Intronic
907963772 1:59309438-59309460 TTGAGGTTAGGGAGAGAGGCAGG + Intronic
908316509 1:62937794-62937816 CTGAGGAAAGGGCAGGCAGCCGG + Intergenic
908690926 1:66779633-66779655 CAGAGGAGAGAGAGAGCAGGAGG - Intergenic
909206089 1:72759523-72759545 CTCAGGATAGGGAGGGTGGCAGG - Intergenic
910103080 1:83599207-83599229 CTGAGGCTACACAGAGCAGCAGG + Intergenic
910640077 1:89450889-89450911 CTAAGGAGAGGGAGAATAGCAGG - Intergenic
910655472 1:89614125-89614147 CTCAGGAGTTGGAGAGCAGCTGG - Intergenic
910892857 1:92035750-92035772 GTGGGGAGAGGGAGAGCATCAGG - Intronic
910937718 1:92499211-92499233 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
911574767 1:99562330-99562352 GTGGGGAGAGGGAGGGCAGCAGG + Intergenic
911744920 1:101430885-101430907 GTGGGGAGAGGGAGAGCATCAGG - Intergenic
911968529 1:104399213-104399235 CTGAGGATAGGGAGAGAAGCAGG + Intergenic
912244434 1:107946012-107946034 TTGAGGCTGGGGAGGGCAGCAGG + Intronic
912270040 1:108199910-108199932 CTGAGCGTAGGGAGGGCTGCGGG - Intronic
912431179 1:109629255-109629277 CTGGGTATGGGGAGGGCAGCCGG + Intronic
912546479 1:110455032-110455054 CTCCAGAGAGGGAGAGCAGCAGG - Intronic
913039928 1:115012282-115012304 CTGAGGCTGCAGAGAGCAGCAGG - Intergenic
913453225 1:119006984-119007006 CTGCGGGGAGGGAGAGCCGCGGG + Intergenic
913583519 1:120250310-120250332 ATGTGGATAGGGAGAGCTGGAGG - Intergenic
913624657 1:120648009-120648031 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914405158 1:147363208-147363230 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
914565506 1:148862147-148862169 ATGTGGATAGGGAGAGCTGGAGG - Intronic
914607319 1:149268102-149268124 ATGTGGATAGGGAGAGCTGGAGG + Intergenic
914680288 1:149934145-149934167 GGGAAGATTGGGAGAGCAGCAGG + Intronic
915315894 1:155029127-155029149 CTGAGGATGGGAAGAGGAGAAGG + Intronic
915339125 1:155166817-155166839 CAGAGAAAAGGGAGAGCAGTAGG - Intergenic
915762782 1:158331656-158331678 GTGAGGACAGGGAGAGCGGCTGG - Intergenic
916123339 1:161548702-161548724 GTGAGGACAGGGAGAGGAGCAGG + Intronic
916133231 1:161630059-161630081 GTGAGGACAGGGAGAGGAGCAGG + Intronic
916648253 1:166810644-166810666 GTGGGGGTAGGGAGAGCATCAGG - Intergenic
916841668 1:168607846-168607868 ATGGGGGTAGGGAGAGGAGCAGG + Intergenic
916852364 1:168716685-168716707 GTGAGGAGAGGGAGAGCATTAGG - Intronic
917243504 1:172974878-172974900 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
918498363 1:185165103-185165125 CTGAGGAGAGGGAGAGAGACTGG + Intronic
919155182 1:193755099-193755121 ATGAGGATAGGGAAAACATCTGG + Intergenic
920421508 1:205837557-205837579 CTGTGCACAGGGAGTGCAGCAGG + Intronic
920440666 1:205978635-205978657 CTGAGTATAGTGAGAGCGTCTGG - Exonic
920678518 1:208055405-208055427 CTGAGGATGGGGAGAGATGAAGG + Intronic
920716759 1:208347332-208347354 CAGAGGAGATGGAGAACAGCTGG + Intergenic
921225995 1:213019870-213019892 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
922412727 1:225391705-225391727 CGGAGCACAGGGAGAGGAGCAGG + Intronic
922476461 1:225910206-225910228 GGGAGGATAGAGAGAGAAGCTGG - Intronic
922659155 1:227414082-227414104 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
922789127 1:228300364-228300386 GTCAGGACAGGGAGAGCAGCAGG + Intronic
924490127 1:244528090-244528112 ATGGGGAAAGGGAGAGCATCAGG - Intronic
924661835 1:246026707-246026729 CTGAGGAGAGGGAGAGAGACAGG - Intronic
924743603 1:246812695-246812717 CTGAGGGTAGGGGGAGCATCGGG - Intergenic
1062819709 10:525640-525662 CTGAGGACAGGGAGAGAACAGGG + Intronic
1062985498 10:1765009-1765031 GTGAGGCTATGGAGAGCACCCGG + Intergenic
1064847918 10:19676809-19676831 CAGGGGAGAGGGAGAGCATCAGG - Intronic
1065523543 10:26594815-26594837 TTGAGGGGAGGGAGAGCATCAGG - Intergenic
1065529620 10:26655174-26655196 TTGAGGGGAGGGAGAGCATCAGG - Intergenic
1065557323 10:26929759-26929781 TTGAGGGGAGGGAGAGCATCAGG + Intergenic
1065786736 10:29222897-29222919 CTGGGGATATGCAGAACAGCAGG + Intergenic
1066510969 10:36095453-36095475 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
1067413022 10:46081361-46081383 GCGAGGAGAGGGAGAGCATCAGG - Intergenic
1067820082 10:49520764-49520786 CTGAGGACAGGGAGGGCAGGTGG - Intronic
1067878086 10:50021712-50021734 CTGAGTGTTGGGAGAGCAGTGGG + Intergenic
1068270734 10:54719657-54719679 CTGAGGTGAGGGAGAGCATTAGG - Intronic
1068374766 10:56164622-56164644 CTGAGGCTGCAGAGAGCAGCAGG - Intergenic
1069214406 10:65801612-65801634 CAAAGGAAAGGGAGAGCATCAGG + Intergenic
1069312051 10:67050298-67050320 CTCAAGAAAGGGAGAGCAGGAGG - Intronic
1069772796 10:70910219-70910241 CTGAGGTGAGGGGTAGCAGCAGG - Intergenic
1069890619 10:71650052-71650074 CTGAGGGTAAAGAGAGGAGCCGG + Intronic
1070158145 10:73849022-73849044 CGAAGTACAGGGAGAGCAGCAGG - Exonic
1070721203 10:78758389-78758411 CTGTGGATGGAGAGAGCCGCTGG - Intergenic
1071338700 10:84623010-84623032 CTGAGCATCTGCAGAGCAGCAGG + Intergenic
1071410641 10:85389743-85389765 GTGAGGAGAGGGAGAACATCAGG + Intergenic
1072613074 10:97031790-97031812 GTGAGGGGAGGCAGAGCAGCCGG + Intronic
1072621415 10:97081848-97081870 CTGAGCAGAGGAAGAGCCGCCGG - Intronic
1072663518 10:97377999-97378021 GTGAGGATAGGCAGAGCATGGGG - Intronic
1073118728 10:101108364-101108386 CTCAGGATAGGGAGAGGAGGCGG - Intronic
1074415628 10:113264580-113264602 CAGATGAGCGGGAGAGCAGCAGG + Intergenic
1074581064 10:114720010-114720032 GTGAGGGAAGGGAGAGCATCAGG - Intergenic
1074691462 10:116008720-116008742 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1075063866 10:119275861-119275883 GTGAGGAAAGGGAGGGCCGCAGG + Intronic
1075251075 10:120874540-120874562 GTGAGGGGAGGGAGAGCATCAGG - Intronic
1075345494 10:121679175-121679197 CTGGGGATAGAGAGAGGAGGGGG + Intergenic
1075535871 10:123271666-123271688 CCGAGGATAGGGAGAATAGGAGG + Intergenic
1075567371 10:123514422-123514444 CTGAGGTTAGGATGAGGAGCGGG + Intergenic
1075992850 10:126852658-126852680 CTCAGGAAAGGGAGACCAGATGG - Intergenic
1076107984 10:127839513-127839535 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
1076205922 10:128602760-128602782 CTGAGGAGAGGGAGAGAATTGGG - Intergenic
1076399038 10:130166612-130166634 CTGAGGATAGGTAGGCCAACTGG - Exonic
1076666504 10:132095977-132095999 CTGCTGTTAGGGAGAGCAGGAGG + Intergenic
1076886655 10:133266187-133266209 CTGAGGAAAGGCAGAGGGGCCGG + Intronic
1077149516 11:1064060-1064082 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
1077450879 11:2644890-2644912 CTGGGGATAGGGACACCAGCTGG + Intronic
1077606385 11:3615648-3615670 CAGAGCAGAGGGGGAGCAGCTGG + Intergenic
1077779745 11:5313993-5314015 GGGAGGAGAGGGAGAGCACCAGG + Intronic
1078462996 11:11529486-11529508 CCGAGAATAAGGAGAGCAGATGG - Intronic
1078995879 11:16698751-16698773 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1080782518 11:35443343-35443365 GTGAGGGGAGGGAGAGCATCAGG - Intronic
1080829369 11:35877087-35877109 CTGAAGGTAGGAAGAGGAGCAGG + Intergenic
1081009149 11:37786094-37786116 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
1081206720 11:40284108-40284130 CAGAGGACAGGGAGATCAGTGGG + Intronic
1081370411 11:42293703-42293725 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
1081537208 11:44004685-44004707 CTGAGGATAGGGCGGGCAGATGG - Intergenic
1081729634 11:45361172-45361194 ATTAGGATGGGGAGAGCAGGTGG + Intergenic
1083481280 11:62949215-62949237 CTGTGGATGGGGATGGCAGCAGG + Intronic
1083673619 11:64313820-64313842 GGGAGGAAAGGGAGAGCAGGGGG - Intronic
1083857435 11:65400095-65400117 CTGAGTGGAGGGAGGGCAGCAGG + Intronic
1083972017 11:66084053-66084075 CTGGGGACAGGGTGGGCAGCAGG + Intronic
1084138637 11:67207812-67207834 CTGAGGAGTTTGAGAGCAGCCGG + Intronic
1084308828 11:68304183-68304205 CTGAGGCTGTGCAGAGCAGCAGG - Intergenic
1084369230 11:68728014-68728036 CTGAGGACAGGGAGAGAGACAGG - Intronic
1084472829 11:69373198-69373220 ATGAGCATAAGGACAGCAGCTGG + Intergenic
1086902426 11:92382972-92382994 CTGGGGGTAGGGAGAGCATCGGG - Intronic
1087266067 11:96062683-96062705 CTTTGGATAAGGAGAGCTGCTGG - Intronic
1088156994 11:106818477-106818499 CTGAGGAGAGGGAGAAGAACTGG - Intronic
1088532928 11:110830173-110830195 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
1088756528 11:112889834-112889856 CAGAGGATGGGGAGGGCAGCAGG - Intergenic
1090206657 11:124887892-124887914 CTGAAGATAGAGCCAGCAGCTGG - Intronic
1090613006 11:128488634-128488656 CTGAGTATAGAAACAGCAGCAGG - Intronic
1091379443 12:46535-46557 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
1091400762 12:179282-179304 ATGAGGACTGGGAGAGCGGCAGG + Intergenic
1091688150 12:2578345-2578367 CCGAGGAAGGGGAGTGCAGCTGG + Intronic
1092511032 12:9157066-9157088 GTGCGGAGAGGGAGAGCATCAGG - Intronic
1092798202 12:12135316-12135338 GTGAGGATGGGGAGAGGAGGGGG + Intronic
1092969262 12:13676197-13676219 GTGGGGAGAGGGAGAGCATCAGG + Intronic
1093173728 12:15887267-15887289 CTGAGGATATGGAAAGTATCAGG + Intronic
1093357719 12:18189091-18189113 GTAAGGAGAGGGAGAGCATCAGG + Intronic
1095773949 12:45991761-45991783 CTGAGGGCAGGCAGAGCAACCGG - Intronic
1096011910 12:48224916-48224938 CTGGGGGGAGGGAGAGCATCAGG + Intergenic
1096573892 12:52540736-52540758 CTGGGGCTGAGGAGAGCAGCAGG - Intergenic
1096655193 12:53085778-53085800 TTGAGGGGAGGGAGAGCATCAGG + Intergenic
1097141945 12:56909339-56909361 CTGAGGCTATGTACAGCAGCGGG - Intergenic
1097353780 12:58578261-58578283 GTGAGGGTAGGGAGAGCGTCAGG - Intronic
1098201289 12:68058654-68058676 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
1098512978 12:71341003-71341025 GTGGGGAGAGGGAGAGCATCAGG - Intronic
1099477490 12:83124868-83124890 CTGAAGATAGGGAGAATAACAGG + Intronic
1101037030 12:100716623-100716645 CTGAGGAGAGGGAAAGGAGTGGG - Intergenic
1103297827 12:119903315-119903337 CTGAGGAAAGGGAGAAAAACGGG - Intergenic
1104759261 12:131287228-131287250 CCGATGAGAGGGAGAGAAGCGGG - Intergenic
1104821350 12:131679268-131679290 CCGATGAGAGGGAGAGAAGCGGG + Intergenic
1105258110 13:18758337-18758359 CTGAGGATGGACATAGCAGCGGG + Intergenic
1105263061 13:18794044-18794066 CTGAGGATGGACACAGCAGCTGG + Intergenic
1105780060 13:23697763-23697785 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1106134805 13:26966161-26966183 CTGAGAACAGAGGGAGCAGCTGG - Intergenic
1106160413 13:27196325-27196347 CTGGGGAGTGGGAGAGGAGCAGG - Intergenic
1107390840 13:39962439-39962461 ATGGGGAGAGGGAGAGCATCAGG - Intergenic
1107853885 13:44595942-44595964 CTGAGGACAAGGAGAGTGGCAGG + Intergenic
1107944843 13:45408948-45408970 GTGAGGATAGGCAGAGAAGAAGG - Exonic
1107993211 13:45836627-45836649 ATGGGGAGAGGGAGAGCATCAGG + Intronic
1108162649 13:47658084-47658106 CTCAGGAAAGGAAGAGTAGCAGG + Intergenic
1108227059 13:48300873-48300895 GTGGGGAGAGGGAGAGCATCAGG - Intergenic
1108499932 13:51060616-51060638 CTGGGGAAAGGAAGAGCAACTGG - Intergenic
1109414503 13:62020567-62020589 GTGAGGAGAGGGAGAGCATCAGG + Intergenic
1109893460 13:68650913-68650935 CTGAGGAGAGGGAGAGAGACGGG - Intergenic
1110766495 13:79285149-79285171 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1110868604 13:80424214-80424236 CTGAGGCTATGAAGGGCAGCAGG + Intergenic
1111716181 13:91881866-91881888 CTTAAGACAGGGAGAGCATCTGG + Intronic
1113317891 13:109203555-109203577 CTGAGGATTAGGAGAGAACCAGG - Intronic
1113713069 13:112483620-112483642 CTGAGAAGAGGGAGAGAGGCTGG + Intergenic
1114612968 14:24054149-24054171 CTGAGGAGCAGGAGAGCACCTGG + Intronic
1114901335 14:27063513-27063535 CTGGGGACAGAGAGAGCAGCAGG - Intergenic
1115261323 14:31457249-31457271 CGGAGGATAACGAGAGCTGCCGG + Intronic
1115386001 14:32797630-32797652 GAGAGGAGAGGGAGAGCATCAGG + Intronic
1115468594 14:33744319-33744341 CTGAGGAGAGGGAGAGAGACTGG + Intronic
1117519542 14:56537095-56537117 CTGAGGAGAGGGAGAGAGACAGG - Intronic
1117612229 14:57496247-57496269 CAGAGGAGATGGAGAGAAGCAGG + Intergenic
1118083322 14:62387252-62387274 CTGAGGCTGCAGAGAGCAGCTGG - Intergenic
1118895519 14:69942561-69942583 CTGGAGATAAGGAGAGAAGCAGG - Intronic
1119661702 14:76456820-76456842 GGGAGGATCGGGAGAGCAGAGGG + Intronic
1120661626 14:87257666-87257688 CTGAGGCTACACAGAGCAGCAGG - Intergenic
1120706588 14:87752233-87752255 CTGAGAACAGGGAGAGCTGATGG + Intergenic
1120939537 14:89934057-89934079 ATGAGGTTGGGGAGGGCAGCAGG + Intronic
1121161846 14:91750388-91750410 CTGGGGAAAGGGAGAGCATCAGG + Intronic
1121504480 14:94466115-94466137 CTGGGGATAGGAAGAGGAGGTGG - Intronic
1121890858 14:97589089-97589111 CTGAGGTTAAGCAGGGCAGCAGG + Intergenic
1122134861 14:99626960-99626982 CTCAGGACAGGGGGAGCACCAGG + Intergenic
1122446513 14:101773573-101773595 GTGAGGGTAGGCAGAGCAGGAGG + Intronic
1122594705 14:102881589-102881611 GTTAGGAGAGGGAGAGCATCAGG + Intronic
1122634579 14:103123962-103123984 CTGAGGAGAGGCCGGGCAGCAGG + Intronic
1122870539 14:104636176-104636198 CTGGGGATTGGGAGAGCTGCTGG - Intergenic
1123096503 14:105769426-105769448 CCGTGGAGTGGGAGAGCAGCGGG - Intergenic
1123137594 14:106044021-106044043 CTGAGCACACAGAGAGCAGCAGG + Intergenic
1123203408 14:106690460-106690482 CTGAGCACACAGAGAGCAGCAGG + Intergenic
1202902290 14_GL000194v1_random:50805-50827 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1124042749 15:26120030-26120052 CTGAGGATTGGTAGGGCAACAGG + Intergenic
1124045955 15:26149806-26149828 CGGGGGTTAGGGAGAGCACCAGG - Intergenic
1125045972 15:35242252-35242274 TTGAGGTTTGGGAGATCAGCTGG - Intronic
1127273453 15:57421810-57421832 GTGTGGACAGGGACAGCAGCAGG + Intronic
1127369826 15:58329403-58329425 CTGAGGGTAGGAAGAGTAGGAGG + Intronic
1127932992 15:63609722-63609744 ATGAGGACAGGGAGAGGAGAGGG - Intronic
1128081206 15:64858002-64858024 CTGTGAATAGGAGGAGCAGCTGG + Intronic
1128189946 15:65682846-65682868 CTGAGGAGAGGGAGAGAGTCAGG + Intronic
1128328875 15:66742821-66742843 CTCAGGCCAGGGAGCGCAGCGGG - Intronic
1128920476 15:71605747-71605769 CTGAGGTTTGGGAGAGCTTCAGG + Intronic
1130678677 15:85977386-85977408 CTGATGTTAGGGAGAAAAGCTGG - Intergenic
1131008738 15:88999918-88999940 CATAGGATAAGGTGAGCAGCTGG + Intergenic
1131261787 15:90891472-90891494 AGGGGGAAAGGGAGAGCAGCAGG - Intronic
1131561549 15:93447788-93447810 GTGAGGGAAGGGAGAGCATCAGG - Intergenic
1131934381 15:97486630-97486652 CTAGGGGTAGGGAGAGCATCAGG + Intergenic
1132532768 16:461522-461544 CTGAGGAACGGGAGAGGAGGTGG - Intronic
1132818336 16:1846811-1846833 GTGAGGGGAGGGAGAGCATCAGG + Intronic
1133183885 16:4081314-4081336 CTGAGGATGGTGACAGCAGGAGG - Intronic
1133447496 16:5874646-5874668 CTGAGAATAAGGAGAGCAGCTGG + Intergenic
1133761108 16:8798799-8798821 CTGAGGATAGTGAGACCATTGGG - Intronic
1134183004 16:12062595-12062617 CTGAGGGCAGGGACAGCAACTGG - Intronic
1134307353 16:13044991-13045013 CTGAGAAGTGGTAGAGCAGCAGG - Intronic
1135147312 16:19973872-19973894 CTGAGGCTTGGGAGATCAGGTGG - Intergenic
1135150874 16:20004678-20004700 CTGAGGGTCGGGGGAGCAGGGGG - Intergenic
1135684820 16:24490424-24490446 GGGAGGACAGGGAGTGCAGCTGG - Intergenic
1135711999 16:24725542-24725564 CTGAGAATGGAGAGAGGAGCTGG - Intergenic
1136372472 16:29844967-29844989 TTGAGGGTAGGGATGGCAGCAGG - Intronic
1137354161 16:47743292-47743314 ATGGGGGTAGGGAGAGCATCAGG - Intergenic
1137371158 16:47907013-47907035 CTTAGGGAAGGGAGAGCAGATGG + Intergenic
1137418900 16:48313460-48313482 GTGAGGGGAGGGAGAGCATCAGG - Intronic
1138424384 16:56920988-56921010 CTGAGGGGAGGGAGAGCATGGGG + Intergenic
1138583390 16:57955985-57956007 ATGGGGACAGGGAGAGGAGCTGG - Intronic
1139380389 16:66527023-66527045 CAGAGGAGAGCGAGAGCAGAAGG - Intronic
1139657877 16:68399912-68399934 ATGAGGCTACGGAGAGAAGCTGG - Intronic
1140657795 16:77158168-77158190 TTGAGGGGAGGGAGAGCATCAGG + Intergenic
1140975271 16:80054109-80054131 CTGGGGAGGGGGAGAGCATCAGG - Intergenic
1142844304 17:2660380-2660402 TTGAGGGGAGGGAGAGCATCAGG - Intronic
1143048374 17:4101172-4101194 CTGAGGAGAGGAGGTGCAGCTGG + Intronic
1143185535 17:5007752-5007774 CTCAGGAGAGGGAGAGGACCTGG + Intronic
1144162061 17:12569406-12569428 ATGCGGATAGGGAGAGGAGATGG + Intergenic
1144275410 17:13663527-13663549 CTGATGCTACAGAGAGCAGCTGG + Intergenic
1147610346 17:41798342-41798364 CTGGGGACAGGGAGAGGAGAGGG - Intergenic
1147758295 17:42782201-42782223 GTGAGGGGAGGGAGAGGAGCCGG + Intronic
1147841543 17:43375323-43375345 CTGGGAATAGGGAGGACAGCAGG + Intergenic
1148636985 17:49156489-49156511 ATGAGGTTGGCGAGAGCAGCGGG + Intronic
1149405759 17:56349238-56349260 CTGGGAAGAGGGAGAGCATCAGG + Intronic
1149523255 17:57334437-57334459 CTGAGGACTGGCAGGGCAGCTGG + Intronic
1149607508 17:57935581-57935603 GGGAGGAAAGGGAGGGCAGCGGG - Intronic
1149809622 17:59655257-59655279 CTGAGGAAAGGGAAAGAAACGGG + Intronic
1149882948 17:60310984-60311006 CAGAGGATAGGAAGAGTAGTGGG + Intronic
1149940918 17:60864893-60864915 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1150359536 17:64519244-64519266 CTGAGGACCTGGAGAGCTGCTGG - Intronic
1150941251 17:69696943-69696965 CTCTGGATATTGAGAGCAGCAGG + Intergenic
1150947982 17:69767855-69767877 CTGAGGAGAGGGAGACCAATGGG - Intergenic
1151036375 17:70805036-70805058 GCGAGGGTAGGGAGAGCATCAGG + Intergenic
1151145233 17:72034405-72034427 CTGTGGATGGGGAGAGGAGGGGG - Intergenic
1152354070 17:79798174-79798196 CAGAGGATGGGGCGAGCGGCTGG + Intronic
1153077842 18:1185707-1185729 CTGGGGAAAGGGAGAGCATCAGG + Intergenic
1153239337 18:3016242-3016264 TAGAGGGTAGGGAGACCAGCTGG - Intergenic
1153351975 18:4091097-4091119 GTGGGGGTAGGGAGAGCATCAGG + Intronic
1153438820 18:5094650-5094672 CTGAGGAAAGAGATACCAGCAGG + Intergenic
1154390184 18:13930090-13930112 CTGAGGGTGGGGAGCTCAGCGGG - Intergenic
1154427981 18:14286742-14286764 CTGAGGATGGACACAGCAGCTGG - Intergenic
1154430694 18:14306252-14306274 CTGAGGATGGACACAGCAGCTGG - Intergenic
1155317051 18:24582288-24582310 CTGAGAATAGTGAGAGAAGATGG - Intergenic
1155325402 18:24659650-24659672 CTAAGGATAAGGTGGGCAGCAGG + Intergenic
1155469960 18:26181377-26181399 CTGAGGAGAGGGAGAGACACAGG - Intronic
1156458593 18:37308518-37308540 CTGGGGGCAGGGAGATCAGCCGG - Intronic
1157114329 18:44849011-44849033 ATGAGAATGGGGAGAGCAGGTGG - Intronic
1157318595 18:46616368-46616390 CTGGGAATGGGGAGATCAGCAGG + Intronic
1157786652 18:50489527-50489549 CTGAAGATGGGGAGAACAACTGG - Intergenic
1158757324 18:60341626-60341648 CTGAGGAAAGGGAGAGAGGCTGG - Intergenic
1159026834 18:63190838-63190860 GCGAGGAGAGGGAGAGCATCAGG - Intronic
1159514497 18:69440119-69440141 CTGAGAAGAGGGAGAGAAGTGGG + Intronic
1159606018 18:70476169-70476191 GTGAGAAAAGGGAGAGAAGCAGG - Intergenic
1159979840 18:74764959-74764981 CTGAGGAGAAGGAAAGCAGGAGG + Intronic
1160504838 18:79421244-79421266 CTGTGCAGAGGGAGAGGAGCTGG - Intronic
1160816143 19:1036643-1036665 CTGAGAGTGGGGAGAGAAGCTGG - Intronic
1160904772 19:1446916-1446938 CTGAGGCTGGGGGGTGCAGCGGG + Intronic
1160972117 19:1774168-1774190 CTGTGGATAGGGGCAGGAGCAGG + Intronic
1160983468 19:1827149-1827171 CTGAGGCTGGGGAGGGCAGAGGG + Exonic
1161364524 19:3870503-3870525 AAGAGGAGAGGGAGAGGAGCAGG + Intergenic
1162973507 19:14195337-14195359 ATGGGGATGGGGAGAGCAACAGG + Intronic
1163469376 19:17487633-17487655 CTGGGGACAGAGAGGGCAGCTGG + Intronic
1163538719 19:17893874-17893896 CTGAGGACAGGGCCAGCCGCGGG + Exonic
1164248023 19:23451277-23451299 GTGAGGAGAGGGAGAGCATAAGG - Intergenic
1164579965 19:29428967-29428989 CTGAGGGTGGGCAGAGCAGTAGG + Intergenic
1165777180 19:38411429-38411451 CTGTGGATTGGCAGGGCAGCTGG + Intronic
1166523266 19:43495388-43495410 CTGACATTAGGGAAAGCAGCTGG - Intronic
1167045241 19:47045648-47045670 CTGAGGACTGGCAGAGCTGCCGG + Exonic
1167586948 19:50380705-50380727 CTGAGGTTGGGGAGAGCTGGTGG + Intronic
1167867105 19:52337256-52337278 CTGATGACAAGGAGAGCAGAGGG + Intronic
1168139677 19:54376840-54376862 CTGGCGACAGGAAGAGCAGCTGG + Intergenic
1168158204 19:54490399-54490421 CTGGCGACAGGAAGAGCAGCTGG - Intergenic
1168445360 19:56406965-56406987 CTGATGATACTGAGAGCTGCAGG + Intronic
925621303 2:5795863-5795885 CTGGGGAGAGGAAGAGCATCAGG - Intergenic
926404600 2:12538315-12538337 CTGAGGATATATAGAGCAGAAGG - Intergenic
926681271 2:15665761-15665783 CTCAGGAGAGTGAGAGCAGAGGG - Intergenic
926935041 2:18078481-18078503 TTGAGGATAGGGAGATTATCTGG - Intronic
927138226 2:20112816-20112838 GAGAGGACAGGGAGAGCAGCGGG + Intergenic
927698244 2:25251930-25251952 CGGGGGACAGGAAGAGCAGCCGG - Intronic
927721699 2:25387379-25387401 CTGAGGAGAGGCAGAGCAGATGG + Intronic
928170997 2:29002879-29002901 GTGAGGATAGGGACAGCACTGGG + Intronic
928427861 2:31193435-31193457 CTGACGATAGGCACATCAGCTGG + Intronic
928603622 2:32924504-32924526 CTGAGGATCCGGAGAGTAGAGGG + Intergenic
928757149 2:34541159-34541181 GTGAGGAGAGTGAGAGCATCAGG - Intergenic
929241334 2:39656788-39656810 GCGAGGAGAGGGAGAGCATCAGG + Intergenic
929781156 2:44957970-44957992 CAGGGGATAGGGTGAGCATCTGG - Intergenic
930170867 2:48250221-48250243 CAGAGAAAAGGGAGTGCAGCCGG + Intergenic
930952767 2:57163292-57163314 ATGAGGATGGAGAGAGAAGCTGG + Intergenic
931556971 2:63516917-63516939 ATGAGGACAGGGAGAGAAACAGG + Intronic
931841541 2:66155394-66155416 CTGAGAATGGGGATACCAGCTGG + Intergenic
932207142 2:69893214-69893236 CTGGGGAGAGGGAGAGCATTGGG + Intergenic
932413134 2:71558938-71558960 CAGCTGATAGGCAGAGCAGCCGG + Intronic
932779308 2:74549918-74549940 TTGAGGAGAAGGAGAGCACCAGG + Intronic
933321153 2:80777267-80777289 CTGAGGAGGTGGAGAGAAGCTGG + Intergenic
933648478 2:84830837-84830859 CTGAGGAGAAAGAGGGCAGCTGG + Intronic
933721860 2:85402037-85402059 CTGGGGATGAGGAGAGCAGTGGG + Intronic
934492844 2:94773558-94773580 CTGAGGATGGACACAGCAGCAGG + Intergenic
934504378 2:94879603-94879625 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
934949305 2:98565578-98565600 CTGAGACTGGGGAGAGTAGCAGG + Intronic
935453610 2:103239430-103239452 ATGAGGGGAGGGAGAGCATCAGG + Intergenic
935763669 2:106343735-106343757 CTCAGGATGTGGAGAGCAGGAGG - Intergenic
935890215 2:107668781-107668803 GTGAGGGTAGGGAGAGCATCAGG + Intergenic
936788814 2:116125744-116125766 CTGAGGCTAGACAGAGCAGCAGG + Intergenic
937577448 2:123441198-123441220 CAGAGGATGGGAAGAGCAGTGGG + Intergenic
937915820 2:127098239-127098261 CTGAGGATGGGGAGGCCTGCAGG + Intronic
937969214 2:127536494-127536516 CTGAGGAGAGGGACCGCACCGGG + Intronic
938418109 2:131121201-131121223 GTGAGGAGAGCGAAAGCAGCAGG - Intronic
938562544 2:132487078-132487100 CTGAGGATAGGGAGAGAGATGGG + Intronic
939092837 2:137799300-137799322 CTGAGGCTACACAGAGCAGCAGG - Intergenic
939486568 2:142819921-142819943 CTGAGGAGAGGGAGAGAGACAGG + Intergenic
939542132 2:143507457-143507479 CTGAAGATGGGGAGAAGAGCAGG - Intronic
939614839 2:144350574-144350596 CTGACAAAAAGGAGAGCAGCTGG - Intergenic
939835535 2:147125417-147125439 CTGAGGCTACACAGAGCAGCAGG - Intergenic
940974365 2:159926860-159926882 CTGAAGCTATGGAGAGGAGCAGG + Intergenic
941201893 2:162521911-162521933 CAGAGGATAGGAAGGGTAGCAGG - Intronic
941277175 2:163503901-163503923 ATGAGGAGAGGGAAAGCATCAGG + Intergenic
941842598 2:170103024-170103046 CTGGGGGGAGGGAGAGCATCAGG - Intergenic
942534124 2:176945547-176945569 CTGAGGAGAGTGAGAGAAGGGGG - Intergenic
943621337 2:190151348-190151370 ATGGGGAAAGGGAGAGCATCAGG - Intronic
943952508 2:194148303-194148325 CTGAGGAAAGGGAGAGGGACAGG + Intergenic
944529572 2:200653999-200654021 CTGAGGAGAGGGAGAGAAATGGG - Intronic
945385574 2:209195863-209195885 AGGAGGGAAGGGAGAGCAGCAGG + Intergenic
946025242 2:216667990-216668012 CTGAGATTGGGGAGAGGAGCGGG + Intergenic
946073007 2:217050503-217050525 CTGAGCATTGGGAGGGCAGCAGG - Intergenic
946435386 2:219648446-219648468 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
947307629 2:228764866-228764888 CCCAGGAAAGGGAGAGGAGCTGG + Intergenic
948280150 2:236740757-236740779 GAGAGGTTAGGGAGACCAGCAGG + Intergenic
948326917 2:237131860-237131882 CTGAGGGTGGGGAGGGGAGCAGG - Intergenic
948664367 2:239525911-239525933 CTGAGAGGAGGGAGAGGAGCAGG - Intergenic
948838340 2:240636946-240636968 CTGAGGAGGGGGAGATGAGCAGG - Intergenic
949038416 2:241832079-241832101 GTGAGGGGAGGGAGAGCATCGGG + Intergenic
949052318 2:241903828-241903850 CTGGGCATGGGGAGGGCAGCTGG - Intergenic
1169492318 20:6081689-6081711 CAGAGCTTGGGGAGAGCAGCTGG + Intronic
1169587950 20:7107586-7107608 CTGAGGATGGGGATAGCATGAGG + Intergenic
1170237780 20:14126871-14126893 CTGAGGACAGGGAAAGAGGCTGG - Intronic
1170368565 20:15623481-15623503 GTGGGGATGGGGAGAGTAGCTGG + Intronic
1171002310 20:21426815-21426837 CAGTGGAGAGGGAGAGCAGAAGG - Intergenic
1171429570 20:25073067-25073089 CTGAGGATGGAGAGGCCAGCAGG - Intronic
1171883917 20:30637777-30637799 CTGAGGATGGACATAGCAGCGGG + Intergenic
1172845169 20:37925828-37925850 AGGAGGACAGGGAGAGAAGCAGG - Intronic
1173021235 20:39269465-39269487 CTGGGGATAGGGTCAGGAGCTGG + Intergenic
1173501854 20:43559662-43559684 GTGAAGACAGGGACAGCAGCAGG + Intronic
1173539430 20:43840533-43840555 CTGAGGCTGGAGAGATCAGCTGG + Intergenic
1175721590 20:61290767-61290789 CAGAGGCTAGGAAGAGTAGCAGG - Intronic
1176621658 21:9065572-9065594 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1176844110 21:13863363-13863385 CTGAGGATGGACATAGCAGCGGG + Intergenic
1176999618 21:15596124-15596146 CAGAGGCTAGGAAGAGTAGCGGG + Intergenic
1177602652 21:23335977-23335999 CTGAGGATGCACAGAGCAGCAGG - Intergenic
1177971328 21:27793487-27793509 ATGGGGGTAGGGAGAGCATCAGG + Intergenic
1180617045 22:17135187-17135209 ATGATGATGGGGAAAGCAGCAGG + Intergenic
1180857559 22:19058030-19058052 CTTAGGAGGGGGAGAGCACCAGG - Intronic
1180917232 22:19497704-19497726 CTGAGTACAGGCTGAGCAGCAGG - Intronic
1180988503 22:19919602-19919624 GGAAGGATAAGGAGAGCAGCAGG + Intronic
1181323457 22:22026099-22026121 CTGAGCAGAGGGTGAGAAGCTGG - Intergenic
1182011830 22:27007474-27007496 CTGAGGTTTGGGAGAGCAGAAGG - Intergenic
1182440106 22:30358050-30358072 CGCAGGAGAGGGAGAGAAGCCGG - Intronic
1182786508 22:32912258-32912280 CTGAGGAAAGGATGAGCAGAAGG + Intronic
1183156539 22:36079995-36080017 GTGAGGGAAGGGAGAGCATCAGG - Intergenic
1183984261 22:41560966-41560988 CTGACGTCAGGGAGAGCAGGAGG - Exonic
1184381601 22:44148233-44148255 ATGAGGCCAGCGAGAGCAGCAGG - Intronic
1184911563 22:47538650-47538672 GTGGGGAAAGGGAGAGCACCAGG + Intergenic
950008076 3:9704189-9704211 CTGATGACAGGGCGAGTAGCTGG + Intronic
951252974 3:20415892-20415914 CTGGGGCAAGGGTGAGCAGCTGG + Intergenic
951848932 3:27116954-27116976 GTGAGGGGAGGGAGAGCATCAGG - Intronic
951903144 3:27677242-27677264 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
952103152 3:30038233-30038255 GTGGGGAAAGGGAGAGCATCAGG - Intergenic
952201187 3:31129577-31129599 CTGAGGAGAGGGAGAGAAACAGG + Intergenic
952411011 3:33049758-33049780 GTGAGGGGAGGGAGAGCATCAGG - Intronic
952520851 3:34155878-34155900 CAATGGGTAGGGAGAGCAGCGGG - Intergenic
952695066 3:36255443-36255465 GGGAGGAGAGGGAGAGCATCAGG + Intergenic
952809959 3:37393103-37393125 CTGAGGAGAGGGAGAGAGACTGG - Intronic
953168958 3:40490061-40490083 ATGAGGAGAGGAAGAGCAACTGG + Exonic
953478766 3:43230428-43230450 GTGGGGAAAGGGAGAGCATCAGG + Intergenic
953761256 3:45689169-45689191 TTGGGGAAAGGCAGAGCAGCGGG - Intronic
953978035 3:47397053-47397075 CTGAGGAGAGGGAGAGAGGCAGG + Intronic
954400487 3:50317125-50317147 CTGAGGAAAGAAGGAGCAGCTGG - Intergenic
954801384 3:53189035-53189057 CTGGCGGTGGGGAGAGCAGCAGG - Intronic
955044359 3:55346109-55346131 ATGAGGACAGGGACTGCAGCTGG - Intergenic
955421065 3:58738323-58738345 GTGAGGGGAGGGAGAGCATCAGG - Intronic
955429606 3:58828923-58828945 CTTAGGATTTGGAGACCAGCTGG + Intronic
956587352 3:70878644-70878666 GATAGGATAGGGAGAGCAGGGGG + Intergenic
956897990 3:73683421-73683443 ATGAGGTTAGGAAGAGAAGCAGG + Intergenic
956906313 3:73769453-73769475 GTGAGGGAAGGGAGAGCATCAGG - Intergenic
958267749 3:91459576-91459598 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
958881898 3:99681595-99681617 TTGAGGAAATAGAGAGCAGCTGG - Intronic
959721693 3:109498020-109498042 CTGAGGAAAGGGAGAGAGACGGG + Intergenic
959759863 3:109947991-109948013 GTGAGGACAGGGAGAGAAGGTGG + Intergenic
960282589 3:115795080-115795102 CTGAGGATTAGTAGAACAGCAGG + Intergenic
961015767 3:123466935-123466957 CTGAGAAGAGAGAGAGGAGCTGG - Intergenic
961061630 3:123833491-123833513 CTGAGGATAGGGAGAGCAGCAGG - Intronic
961171199 3:124799019-124799041 CTGAGGATAGCTAGGGGAGCAGG + Intronic
961905864 3:130262598-130262620 TAGAGCATAGGGAGAGCGGCAGG - Intergenic
962338650 3:134562305-134562327 CTGTGGAGAGAGAGAGGAGCAGG + Exonic
962908803 3:139829129-139829151 CTCAGGAGAAGGAGAGCAGCAGG + Intergenic
962940001 3:140117109-140117131 CTGAGGAATGAGAAAGCAGCAGG - Intronic
963344836 3:144082763-144082785 GTGAGGAGAGGGAGAGCATCAGG + Intergenic
963513315 3:146276300-146276322 ATGATGATAGGGAGAGCCACTGG - Intergenic
964367998 3:155970105-155970127 TGGAGGATGGGGAGAGCTGCAGG + Intergenic
965220519 3:165921092-165921114 CTGAGTGTTGGGAGAGAAGCTGG + Intergenic
965770591 3:172177832-172177854 GTGAGGGGAGGGAGAGCATCAGG - Intronic
966002382 3:174966122-174966144 CTGAGGAAAGGAAGACCAGTGGG - Intronic
966566696 3:181390636-181390658 CTGAGGGGAGGGAGAGCATCAGG - Intergenic
966970210 3:185038715-185038737 CTGAGGATAGGGACAATGGCAGG + Intronic
967206970 3:187132770-187132792 CTGAGGTTAGGAAGACCAACTGG + Intronic
967491847 3:190101140-190101162 CTGAGGACAGGGAGAGAGACAGG - Intronic
967869053 3:194214540-194214562 CAGTGCATAGGGAGGGCAGCTGG + Intergenic
968094743 3:195920966-195920988 CTCAGGATGGGGAGACCACCAGG - Intergenic
968461827 4:730064-730086 ATGAGGACAGGGAGGGCACCTGG - Intronic
968614993 4:1573735-1573757 CTGAGGATGGGGGGAGCTGAGGG - Intergenic
969068307 4:4508691-4508713 CTAGGGAGAGGGAGAGCATCAGG - Intronic
969847995 4:9934791-9934813 CTGAGGGGAGGGAGAGCATTAGG - Intronic
970194313 4:13540666-13540688 CTGAGGAGTGGGCGGGCAGCAGG + Intergenic
971017761 4:22506133-22506155 CTGAAGATGGGGGGAGAAGCAGG + Intronic
971180754 4:24326688-24326710 TTGAGGTTTGGGAGATCAGCTGG - Intergenic
971441266 4:26689768-26689790 CTGAGGAAAGGGAGAGAAATGGG - Intronic
971489635 4:27197955-27197977 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
972281726 4:37608135-37608157 CTGAGGAGAGGGAGAGAGACGGG - Intronic
972652199 4:41028996-41029018 GGGAGTAAAGGGAGAGCAGCAGG - Intronic
973367580 4:49220048-49220070 CTGAGGATGGACATAGCAGCGGG + Intergenic
974498572 4:62666497-62666519 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
974510088 4:62828252-62828274 ATGAGAAAAGGAAGAGCAGCTGG - Intergenic
975219725 4:71800216-71800238 GTGAGGGGAGGGAGAGCATCAGG - Intronic
975472149 4:74782248-74782270 CGGGGGATAGGGAGAGCATCAGG - Intronic
975597130 4:76059000-76059022 CTGAGCATAGGTTGAACAGCTGG + Intronic
975889118 4:79003615-79003637 GTGAGGGGAGGGAGAGCATCCGG + Intergenic
975912955 4:79290451-79290473 CTGATGAGAGAGAGAGCAGAGGG - Intronic
977080376 4:92519766-92519788 CTGAGAATAAGGAGAGCTGATGG + Intronic
977669223 4:99676764-99676786 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
978228322 4:106366011-106366033 CTGTGAATAAGGAGAGGAGCTGG - Intergenic
978629711 4:110730313-110730335 GGGAGGGGAGGGAGAGCAGCAGG - Intergenic
978998683 4:115189146-115189168 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
983811953 4:172073717-172073739 CTGAAGCTAGAGACAGCAGCAGG + Intronic
984573484 4:181421182-181421204 CTGGGGTTAGGGACAGCACCAGG - Intergenic
984682855 4:182630556-182630578 CTGAGGGGAGGGAGAGCATTAGG + Intronic
984754973 4:183316615-183316637 CTGAGGACAGAGAGAGCTGGAGG + Exonic
985773012 5:1824828-1824850 CTGAGGGTGGGGAGGGAAGCAGG + Intergenic
985857488 5:2441624-2441646 CTGAGGTCAGGGAGGGCTGCTGG - Intergenic
985889432 5:2704317-2704339 CTGAGGATGGGGAGCGCTGATGG + Intergenic
986228249 5:5837370-5837392 ATGAGGAGAGGGAGAGTATCAGG - Intergenic
987058637 5:14220344-14220366 CTGAGGAGAGGGAGAGAGGCGGG - Intronic
987431253 5:17836324-17836346 GTAGGGATAGGGAGAGCATCAGG - Intergenic
987696861 5:21343563-21343585 TTGAGGAGAGGGAGAGCATCAGG - Intergenic
987701772 5:21409157-21409179 GTGAGGGTAGGGAGAGCATTAGG + Intergenic
987978072 5:25042147-25042169 CTGAGGAAATGGAGAGCAACAGG - Intergenic
988053794 5:26065443-26065465 CTGAAGAGAGAGGGAGCAGCAGG - Intergenic
988398870 5:30734692-30734714 CTGAGAATGAGGAGAGCAGAGGG + Intergenic
988755344 5:34242984-34243006 TTGAGGAGAGGGAGAGCATCAGG + Intergenic
990133512 5:52617063-52617085 TTGAGGAAAGGGAGAGCATTAGG + Intergenic
990974599 5:61548392-61548414 CTGGGGAGAGAGAGAGCATCAGG - Intergenic
991743580 5:69708712-69708734 TTGAGGAGAGGGAGAGCATCAGG + Intergenic
991754129 5:69846520-69846542 TTGAGGAGAGGGAGAGCATCAGG - Intergenic
991795153 5:70288444-70288466 TTGAGGAGAGGGAGAGCATCAGG + Intergenic
991803754 5:70403279-70403301 TTGAGGAGAGGGAGAGCATCAGG - Intergenic
991822951 5:70583990-70584012 TTGAGGAGAGGGAGAGCATCAGG + Intergenic
991833445 5:70721643-70721665 TTGAGGAGAGGGAGAGCATCAGG - Intergenic
991887518 5:71287966-71287988 TTGAGGAGAGGGAGAGCATCAGG + Intergenic
991973641 5:72164716-72164738 CTGAGGATATGCAGAGGAGCTGG - Intronic
992365898 5:76089161-76089183 CTGAGGGAAGGGAGAGCATTAGG - Intronic
993767581 5:91879880-91879902 CTGAGGCTAGGAAGGGCAGTGGG - Intergenic
993940920 5:94058041-94058063 CCAAGGACAGGGAAAGCAGCAGG + Intronic
994081310 5:95711293-95711315 CTGAGGAGAGGGAGCGTATCTGG - Intergenic
994695783 5:103072038-103072060 GTGAGGGAAGGGAGAGCATCAGG - Intergenic
994732087 5:103504459-103504481 CTGAGGATAGGGAGGTGAGGGGG - Intergenic
994961052 5:106603348-106603370 TTGAGGAGAGGGAGAGCGGTGGG - Intergenic
995144660 5:108773325-108773347 GTGGGGAAAGGGAGAGCATCAGG - Intronic
995477556 5:112563391-112563413 CTGAGGTTGGGCAGAGCAGCAGG - Intergenic
996496845 5:124168140-124168162 CTGGGGAGAGGGAGAGCATCAGG - Intergenic
997199584 5:132001761-132001783 ATGAGGATGGGGAGGCCAGCGGG - Intronic
997505196 5:134411647-134411669 CCATGGAGAGGGAGAGCAGCTGG + Exonic
997712003 5:136013651-136013673 CAGAGGTAAGGAAGAGCAGCAGG + Intergenic
998091696 5:139374827-139374849 ATGAGGAGATGGAGAGCATCTGG - Intronic
999006960 5:147992118-147992140 CTGAGGACAGGGAGGACAGCAGG + Intergenic
999042982 5:148435896-148435918 CTGAGGAAAGGGAGAGAGACAGG + Intronic
999173427 5:149614769-149614791 CTAAGAATAGGCAGAGCAGGTGG - Intronic
1000080917 5:157846027-157846049 CAGAGGAGAGGGAGAGCGGCAGG - Intronic
1000638072 5:163666379-163666401 GTGGGGAGAGGGAGAGCATCAGG - Intergenic
1001237626 5:170043446-170043468 CAGAGGAGAGGGAGGGCTGCAGG - Intronic
1002433138 5:179215615-179215637 CCAAGGATAGGCAGAGCAGGAGG + Intronic
1002679194 5:180948132-180948154 CTAAGGAGAGGGACAACAGCTGG - Intronic
1002684452 5:180997265-180997287 CTGAGGACAGGCAGAGTAACTGG - Exonic
1002685067 5:181003633-181003655 CTAAGGAGAGGGACAACAGCTGG - Intronic
1003243923 6:4368523-4368545 GTGAGGATAGGAAGACTAGCAGG + Intergenic
1003550529 6:7098684-7098706 CTGAGGGTAAGGAGAGAAGAAGG - Intergenic
1003968689 6:11278076-11278098 CTGAGGCTGTGGAGAGAAGCAGG - Intronic
1004021155 6:11776672-11776694 CTAAGGATAGAGAGAACACCGGG + Intronic
1004899234 6:20179077-20179099 GTGGGGAGAGGGAGAGCATCAGG - Intronic
1005152948 6:22773385-22773407 CTAAGGAGAGGAAGAGCAGAGGG - Intergenic
1005553976 6:26954754-26954776 TTGAGGAGAGGGAGAGCATCAGG + Intergenic
1005955331 6:30659630-30659652 TAGAGGGTAGGGAGAGCAGCAGG + Intronic
1006108647 6:31731004-31731026 CTGAGGATGGGGAGAGGAGAGGG + Intronic
1006174133 6:32111682-32111704 CTGAGGTTACAGAGAACAGCCGG - Intronic
1006426615 6:33967310-33967332 CTGAGGATAGGGGGAGGTGGTGG - Intergenic
1006435609 6:34024584-34024606 TTGAGGATGGGGTGAGCAGAGGG + Intronic
1006519534 6:34563317-34563339 CTGAGGGTAGGGAGGGTAGTGGG + Intergenic
1006650388 6:35546183-35546205 CTGTGGGGAGGGAGAGCATCAGG + Intergenic
1006699754 6:35962484-35962506 CTGAGGAAGGGGAGGGCAGAGGG - Intronic
1007472222 6:42098472-42098494 GTGCGGGGAGGGAGAGCAGCAGG + Intergenic
1007601271 6:43083193-43083215 CTGAGGTTAGGGAGAGCAGGAGG - Intronic
1008267389 6:49445505-49445527 CTGTGGATAGGGTGGGCAGTGGG - Intronic
1008268913 6:49466116-49466138 CTAAGGAGAGGGAGAGAGGCAGG + Intronic
1008725522 6:54413608-54413630 GTGAGGATAGTGAGAGCAAAAGG - Intergenic
1008987465 6:57562008-57562030 CTGAGGAGAGGGAGAGAGACAGG + Intronic
1009175420 6:60454565-60454587 CTGAGGAGAGGGAGAGAGACAGG + Intergenic
1009371961 6:62916259-62916281 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
1010160514 6:72848335-72848357 ATGAGGAGAGGGAGAGCATCAGG - Intronic
1010662505 6:78586865-78586887 TTGAGGTTTGGGAGATCAGCTGG - Intergenic
1010809395 6:80281739-80281761 ATGAGGACAGGGAGAGGGGCAGG - Intronic
1010826667 6:80484357-80484379 TTGAGGTTTGGGAGATCAGCTGG + Intergenic
1012940486 6:105409889-105409911 CTGAGGCTGAGCAGAGCAGCGGG + Intergenic
1013033109 6:106355483-106355505 CAGAGGCTAGGTACAGCAGCTGG - Intergenic
1013111948 6:107071142-107071164 CAGGGAATGGGGAGAGCAGCAGG - Intronic
1013367842 6:109448444-109448466 CTGAGGGGAGGAAGGGCAGCAGG + Intronic
1013469565 6:110449820-110449842 ATGAGGTTAGGAAGACCAGCTGG - Intronic
1013919160 6:115380280-115380302 CTGAAGAGAGGGAGAGTAGTGGG - Intergenic
1014142814 6:117963954-117963976 CAGAGGGAAGGGAGAGCATCAGG - Intronic
1014319604 6:119910542-119910564 CTGAGGAGAGGGAGAGAGACAGG - Intergenic
1015174392 6:130290904-130290926 CAGAGGAAAGGGAAAACAGCAGG - Intronic
1015430732 6:133128023-133128045 CTGAGGAAGGGGAGAGCACTAGG + Intergenic
1015581245 6:134727823-134727845 CTGGGGCTAGGGAGACGAGCAGG - Intergenic
1015903232 6:138089107-138089129 GTGAGGATATTGAGACCAGCAGG + Exonic
1017043256 6:150324725-150324747 CTGAGGACAGGCCCAGCAGCTGG + Intergenic
1017090867 6:150757837-150757859 GTGAGGGAAGGGAGAGCATCAGG - Intronic
1017429004 6:154351986-154352008 CGGGGGAGAGGGAGAGCATCAGG + Intronic
1017866609 6:158449362-158449384 CTGAGAAAAGGGACAACAGCGGG - Intronic
1017929305 6:158938510-158938532 AGGAAGGTAGGGAGAGCAGCAGG + Intergenic
1018332482 6:162745395-162745417 GTGAGGGGAGGGAGAGCATCAGG + Intronic
1018414563 6:163590169-163590191 CAGAGCAGAGGGAGGGCAGCTGG - Intergenic
1018788934 6:167131411-167131433 ATGACGATGGGAAGAGCAGCGGG - Intronic
1019170675 6:170131604-170131626 ATGAGGCCTGGGAGAGCAGCAGG + Intergenic
1019952954 7:4388613-4388635 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
1019972725 7:4554589-4554611 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
1020286143 7:6682660-6682682 CTGGGGTCGGGGAGAGCAGCTGG - Intergenic
1021440801 7:20672413-20672435 ATGAGGGGAGGGAGAGCATCAGG + Intronic
1021625966 7:22593433-22593455 GTGAGGGGAGGGAGAGCATCAGG - Intronic
1021667400 7:22998649-22998671 CTGTGGAGATGGAGAGCAGATGG - Intronic
1022253198 7:28629256-28629278 CTGAGGATGGACACAGCAGCAGG + Intronic
1022354594 7:29600912-29600934 CTGAGCAAAGTAAGAGCAGCTGG + Intergenic
1022548893 7:31217651-31217673 CTGAGGAGAGGGAGAGATGAGGG + Intergenic
1024692116 7:51814358-51814380 CTGAGGTTTGGGAGAGAGGCTGG + Intergenic
1026197509 7:68185712-68185734 CAGAGGATAGAAACAGCAGCCGG - Intergenic
1027224990 7:76238072-76238094 CTGAGGATGGGGAGGGCAGGGGG - Intronic
1027395307 7:77747432-77747454 CTGAGGCTGTGCAGAGCAGCAGG - Intronic
1028306829 7:89276176-89276198 GTGAGGGTAGGGAGAGCATCAGG + Intronic
1028735691 7:94209855-94209877 TAGAGGCTGGGGAGAGCAGCAGG - Intergenic
1030165135 7:106547012-106547034 CTGACTAAGGGGAGAGCAGCAGG - Intergenic
1030454347 7:109754377-109754399 ATGAGGAGAGGGAGAGCATTAGG + Intergenic
1030469001 7:109939328-109939350 CTGAGGCTACACAGAGCAGCAGG + Intergenic
1030882026 7:114892136-114892158 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
1031815286 7:126426156-126426178 CTGAGGAAAGGGAGAGAAATGGG + Intergenic
1031920364 7:127595771-127595793 ATGAGGGTTGGGAGAACAGCCGG - Exonic
1032149832 7:129418796-129418818 CTAATGATAGGGATAACAGCAGG + Intronic
1032180888 7:129676488-129676510 CTGAGGAGTGGGAGAGAGGCAGG + Intronic
1032238137 7:130141714-130141736 TGGAGGAGAGGGAGAGCAGTGGG - Intergenic
1032345331 7:131110846-131110868 CTGAAGATGAGGAGAGAAGCGGG - Intronic
1032444276 7:131968144-131968166 CAGAGGAGAGGCAGAGCAGAAGG - Intergenic
1032904426 7:136348015-136348037 CTGATGATACTGACAGCAGCAGG + Intergenic
1033423349 7:141221736-141221758 CTGAAGATGGGGAGGGCAGCAGG + Intronic
1033508664 7:142031869-142031891 CAGAGCATAGGGAGAGGAGGAGG + Intronic
1033542289 7:142368054-142368076 CTGAGGCTGGGCAGAGCAGCAGG + Intergenic
1035167636 7:157000715-157000737 GCGAGGAGAGGGAGAGCAGAGGG + Intronic
1035681444 8:1491407-1491429 CTGAGATCAGGGGGAGCAGCCGG - Intergenic
1036226146 8:6959402-6959424 CTGGGGATACAGAGAGCATCAGG + Intergenic
1036561605 8:9903998-9904020 CGAAGGACAAGGAGAGCAGCGGG + Intergenic
1037181145 8:16006944-16006966 GTGAGGGGAGGGAGAGCATCAGG + Intergenic
1037308829 8:17533896-17533918 CTGAGGGGAGGGAGAGCATCAGG - Intronic
1037319560 8:17630414-17630436 CTGAGGGTAGGGAGATCTGTTGG + Intronic
1038402531 8:27296304-27296326 CTGGGGAGAGGGAGAGCATCAGG - Intronic
1038493729 8:27987490-27987512 GTGAGGATGGTGAGTGCAGCTGG - Exonic
1039311494 8:36322119-36322141 CTGAGGCTAGAGAGTCCAGCTGG - Intergenic
1039460834 8:37742665-37742687 GTGGGGAGAGGGAGAGCATCAGG + Intronic
1039581340 8:38669229-38669251 TTGAGGGGAGGGAGAGCATCAGG + Intergenic
1040036788 8:42878116-42878138 CTGAGGAGAGGGAGAGAGACTGG - Intronic
1040481728 8:47833062-47833084 CTGAGAATGGGGTCAGCAGCAGG - Intronic
1041487040 8:58390876-58390898 CAGAGGCTGGGAAGAGCAGCAGG + Intergenic
1041738917 8:61138712-61138734 CAGAGAAGGGGGAGAGCAGCAGG + Intronic
1042490095 8:69387394-69387416 TGGTGGGTAGGGAGAGCAGCAGG + Intergenic
1042664570 8:71191529-71191551 ATGAGGGTTGGGAGATCAGCTGG + Intergenic
1042807012 8:72781964-72781986 CTGGGGAGAGGGAGAGCATCAGG + Intronic
1044028888 8:87210535-87210557 CTGAGGCTATGCAGGGCAGCAGG - Intronic
1044452433 8:92353349-92353371 GTGAGGAAAGGGAGAGCATTAGG - Intergenic
1044554623 8:93549523-93549545 ATGGGGAAAGGGAGAGCATCAGG + Intergenic
1044940772 8:97340911-97340933 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
1045258029 8:100546309-100546331 CTGAGGCTGCAGAGAGCAGCAGG - Intronic
1045323634 8:101100829-101100851 CTGAGGACAGGTAGAGAAGGGGG - Intergenic
1045547010 8:103138600-103138622 CTGAGGATAGAAAGAGGAGTGGG + Intronic
1046424025 8:114022741-114022763 CTGAGGAGAGGGAGAGAAATGGG + Intergenic
1046795846 8:118370793-118370815 GTGAGGGGAGGGAGAGCATCAGG + Intronic
1047195584 8:122718339-122718361 CTGACCATAGGGAGAAAAGCAGG - Intergenic
1047741446 8:127810090-127810112 CTCTGGAAAGGGAGAGGAGCAGG + Intergenic
1047800218 8:128301358-128301380 CTGATGAGAGGGAGAGCCACTGG + Intergenic
1048033029 8:130651105-130651127 CTCAGGATGGGGAGTGCCGCTGG - Intergenic
1048163121 8:132038940-132038962 CTGAGGATCTGGACAGCAGCTGG - Intronic
1048582060 8:135737459-135737481 GTGAGGAAAGGGAGAGCATCAGG - Intergenic
1048620168 8:136123990-136124012 CTGAGGGGAGGGAGAGCATCAGG - Intergenic
1049151603 8:141038590-141038612 CTGGGGAGGAGGAGAGCAGCGGG - Intergenic
1049856672 8:144866449-144866471 CTGAGGACAGGGAATGCATCTGG - Intergenic
1049888102 9:41815-41837 GTGAGGGGAGGGAGAGCATCAGG - Intergenic
1051099324 9:13502902-13502924 ATGGGGAAAGGGAGAGAAGCAGG - Intergenic
1052176221 9:25466171-25466193 GTGAGAAGAGGGAGAGCATCAGG - Intergenic
1052324974 9:27207969-27207991 GTGAGGATAGTGAGAGGAGAGGG + Intronic
1052949609 9:34198126-34198148 CTGAGGTTAGGAGGGGCAGCTGG + Intronic
1053019230 9:34683482-34683504 CTGTGGATAGGAAGAGGAGAGGG - Intergenic
1053663904 9:40304123-40304145 CTGAGGATGGACACAGCAGCAGG - Intronic
1053839986 9:42182854-42182876 CTGGTGGTAGGGAGAGCATCAGG + Intergenic
1054356356 9:64067066-64067088 CCGAGGAGAAGGAGAGCTGCGGG - Intergenic
1054376030 9:64450357-64450379 CTGAGGATGGACACAGCAGCAGG - Intergenic
1054520709 9:66072162-66072184 CTGAGGATGGACACAGCAGCAGG + Intergenic
1054747099 9:68865592-68865614 GTGAGGATAGGGGGAGCACATGG - Intronic
1055234601 9:74105353-74105375 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
1055760458 9:79601679-79601701 CTGAGGAGAGGGAAAGAAGGGGG - Intronic
1056087735 9:83168993-83169015 CAGAGGCTAGGAAGGGCAGCAGG - Intergenic
1056449695 9:86704950-86704972 GTGAGCAGAGGGAGAGCTGCTGG + Intergenic
1056524569 9:87431316-87431338 GTGAGGAGAGGGAGAGCATCAGG - Intergenic
1056576634 9:87859820-87859842 CTGAGGCTAGAGAGTCCAGCTGG - Intergenic
1056592178 9:87972638-87972660 CTGTGGCTATGGAGAGCAGTGGG + Intronic
1056615753 9:88164122-88164144 TTCAGGATAGGGAGCTCAGCTGG + Intergenic
1056981999 9:91322426-91322448 CTGAAGCTGGGGAGAGAAGCAGG + Intronic
1057082130 9:92181037-92181059 TTGAGGAGAGAGAGAGCTGCAGG - Intergenic
1057234036 9:93344949-93344971 GTGAGGGAAGGGAGAGCATCAGG - Intronic
1057801341 9:98192888-98192910 CTGGGGACAGGCAGAGCCGCGGG + Intergenic
1057918318 9:99074771-99074793 CTGAGGAGGTGGAGAGCAGGTGG - Intergenic
1058542031 9:106021389-106021411 ATGAGGGGAGGGAGAGCATCAGG + Intergenic
1058767128 9:108192467-108192489 CTGAGGGTGGGGAGAGAATCAGG - Intergenic
1059422387 9:114200286-114200308 CTGAGGCTTGGGGGAGGAGCAGG - Intronic
1059710956 9:116867260-116867282 CCGAGGAGAGGGAGAGAAGGTGG + Intronic
1059763353 9:117360502-117360524 CTGGGGATATGGAGATGAGCAGG + Intronic
1060150858 9:121287232-121287254 CTGAGGACAGGGGGAGGAGTGGG + Intronic
1060157300 9:121328776-121328798 GGGAGGAGAGGGAGAGCAGTTGG + Intronic
1060249805 9:121976958-121976980 ATGAGGCTACAGAGAGCAGCAGG + Intronic
1060557493 9:124516174-124516196 CTGAGGAATGGGAAGGCAGCTGG + Intergenic
1061487929 9:130929662-130929684 CTGAGGCTCGGGCCAGCAGCCGG + Exonic
1061950135 9:133931499-133931521 CAGAGGACAGGGAAGGCAGCTGG - Intronic
1203744842 Un_GL000218v1:35982-36004 CTGGGGATTGGGAGAGTGGCCGG - Intergenic
1203565262 Un_KI270744v1:83502-83524 CTGGGGATTGGGAGAGTGGCCGG + Intergenic
1186442379 X:9597311-9597333 CTGGGTTTAAGGAGAGCAGCAGG - Intronic
1186488597 X:9953319-9953341 CTGAGAATATGTAGGGCAGCAGG + Intergenic
1186969867 X:14830093-14830115 CTGATGAGAGGGAGAGAAACAGG + Intergenic
1188535385 X:31190972-31190994 CTGAGGGTAGAGAGAGCAAAAGG + Intronic
1188874452 X:35412820-35412842 GTGGGGGTAGGGAGAGCATCAGG + Intergenic
1189925802 X:45953332-45953354 ATGGGGGTAGGGAGAGCATCAGG - Intergenic
1190035847 X:47023254-47023276 GTGAGGGGAGGGAGAGCATCAGG - Intronic
1190213813 X:48467395-48467417 CTGAGGATGGGGAGTGCTGGAGG + Intronic
1190746114 X:53322360-53322382 CACAAGATAGGGAGTGCAGCAGG - Intergenic
1191245150 X:58222811-58222833 CTGAGGATAGAGACACCTGCTGG + Intergenic
1191776455 X:64819781-64819803 GTGAGGCAAGGGAGAGCATCAGG + Intergenic
1191834466 X:65449163-65449185 GTGAGGAGAGGGAGAGCATCAGG + Intronic
1191969405 X:66797038-66797060 CTGAAGATAGGGAGACCAATAGG + Intergenic
1192021657 X:67399104-67399126 CTGAGAAGAGGAAGAGCAGAAGG - Intergenic
1192198115 X:69045915-69045937 CTGAGGATTAGGAGATCAGTGGG + Intergenic
1192573114 X:72222333-72222355 CTGATGAAAAGGAGAGCATCTGG + Intronic
1192821456 X:74649958-74649980 GCGAGGAGAGGGAGAGCATCAGG - Intergenic
1192973113 X:76254149-76254171 CTCAAGATAGTGAGTGCAGCAGG - Intergenic
1193094998 X:77538043-77538065 TTGAGGGGAGGGAGAGCATCAGG + Intronic
1193774714 X:85627924-85627946 GTCAGGAGAGGGAGAGCATCGGG + Intergenic
1193775975 X:85642075-85642097 CTGGGGAAAAGGAGAGCATCAGG - Intergenic
1193962101 X:87939262-87939284 CTGAGGCAAGGGAGACCACCGGG - Intergenic
1194132630 X:90100693-90100715 GTGAGGAGAGGGAGATCATCAGG - Intergenic
1194388939 X:93292550-93292572 CTGAGCATAGAGGGAGCATCTGG + Intergenic
1195309295 X:103615226-103615248 CTGAGGGAAGGGAGGGAAGCAGG + Intronic
1196976708 X:121166167-121166189 CTGAGGATAGGGTGGGGAGGAGG - Intergenic
1197150836 X:123218253-123218275 CTGAGGATAAGACAAGCAGCTGG + Intronic
1197201375 X:123751723-123751745 CTTAAAATAGGGAGATCAGCTGG + Intergenic
1197272130 X:124436420-124436442 CTCAGGGTAGGGAGAGGAGCTGG - Intronic
1197564436 X:128064408-128064430 GTGGGGAGAGGGAGAGCATCAGG + Intergenic
1197918451 X:131561632-131561654 TTGAGGGGAGGGAGAGCATCAGG + Intergenic
1197982373 X:132230318-132230340 GTGGGGGTAGGGAGAGCATCAGG - Intergenic
1198012613 X:132574093-132574115 CTGAAGATAGAGAGAGATGCAGG + Intergenic
1198249976 X:134870459-134870481 ATGAGGAGAGGGAGAGGAGTTGG + Intergenic
1198405061 X:136304127-136304149 CTGTAGATATGGAGAGCAGATGG + Exonic
1198610164 X:138390170-138390192 CTGAGGATAGGGAGATGACTAGG + Intergenic
1199078581 X:143551505-143551527 CTGAGGTTAGGCAGGGCAACAGG - Intergenic
1200478417 Y:3670772-3670794 GTGAGGAGAGGGAGATCATCAGG - Intergenic
1201158180 Y:11151025-11151047 CTGGGGATTGGGAGAGTGGCCGG - Intergenic