ID: 961062915

View in Genome Browser
Species Human (GRCh38)
Location 3:123847257-123847279
Sequence CCCTTGGGTGTCAAAATCTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 177
Summary {0: 1, 1: 0, 2: 0, 3: 28, 4: 148}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961062915_961062925 12 Left 961062915 3:123847257-123847279 CCACAGATTTTGACACCCAAGGG 0: 1
1: 0
2: 0
3: 28
4: 148
Right 961062925 3:123847292-123847314 CAATCTCCCATGGATAGTGAGGG 0: 1
1: 13
2: 86
3: 254
4: 624
961062915_961062924 11 Left 961062915 3:123847257-123847279 CCACAGATTTTGACACCCAAGGG 0: 1
1: 0
2: 0
3: 28
4: 148
Right 961062924 3:123847291-123847313 CCAATCTCCCATGGATAGTGAGG 0: 1
1: 14
2: 73
3: 253
4: 615
961062915_961062921 2 Left 961062915 3:123847257-123847279 CCACAGATTTTGACACCCAAGGG 0: 1
1: 0
2: 0
3: 28
4: 148
Right 961062921 3:123847282-123847304 GTCCTGGAACCAATCTCCCATGG 0: 22
1: 158
2: 395
3: 670
4: 848

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961062915 Original CRISPR CCCTTGGGTGTCAAAATCTG TGG (reversed) Intronic
901157685 1:7151416-7151438 CCCTTGGGTGTCTGTGTCTGGGG + Intronic
902188904 1:14746697-14746719 TCCTTGAGTGTCAAAATATGGGG + Intronic
902454111 1:16519591-16519613 CCCTCTGACGTCAAAATCTGAGG - Intergenic
902498358 1:16890727-16890749 CCCTCTGACGTCAAAATCTGAGG + Intronic
902515505 1:16987485-16987507 ACCTTGGGGGCCTAAATCTGAGG + Intronic
904452641 1:30625433-30625455 ACCTTGGGTGTCACAGTCTCTGG - Intergenic
904756452 1:32771121-32771143 CCCAGGGGGGTCAATATCTGTGG - Exonic
905761683 1:40563693-40563715 TCCTTGGTTGTAAAAAGCTGTGG + Intergenic
906347066 1:45022774-45022796 CCCTTGGATACCAAAATCTGAGG + Intronic
906843763 1:49168100-49168122 CCCTCGGATATCAAAATCTATGG - Intronic
906946903 1:50302097-50302119 AGCTTGGGTTTCATAATCTGGGG + Intergenic
910386714 1:86691464-86691486 CCTTTTAGTGTCCAAATCTGTGG + Intergenic
915105628 1:153533636-153533658 CCCTTGGGGGTCCAACTTTGTGG - Intergenic
915119612 1:153620935-153620957 CCCTTGGATGCCAAAATCCTTGG - Intronic
921248727 1:213276218-213276240 CCCTTGGGAGGCAGAATCTCAGG - Intergenic
921398794 1:214697329-214697351 CACTTGAGTGTCAAAGTCAGAGG - Intergenic
921434995 1:215108355-215108377 CCCATGGATACCAAAATCTGTGG - Intronic
922359572 1:224809269-224809291 CCCTTGAGTGTCACCTTCTGTGG + Intergenic
922361711 1:224828710-224828732 CCCTTAGGTGGGATAATCTGAGG - Intergenic
923365865 1:233260039-233260061 CCCGTGGATAACAAAATCTGTGG - Intronic
924467724 1:244313435-244313457 CCCTTGTGTTTTAAAATCCGTGG + Intergenic
1065262543 10:23938738-23938760 CCCATGGGTACCAAAATCTGAGG - Intronic
1065323342 10:24529219-24529241 CCATTGGATACCAAAATCTGAGG + Intronic
1065640505 10:27777700-27777722 TCTTTGGATGCCAAAATCTGTGG - Intergenic
1070659793 10:78296717-78296739 CCCATGGATGCCAAAATCCGTGG + Intergenic
1071360493 10:84841691-84841713 CCCTCTGATGCCAAAATCTGTGG + Intergenic
1072291484 10:93969645-93969667 CCCATGGATATCAAATTCTGAGG + Intergenic
1075482162 10:122791170-122791192 CCCAAGGATATCAAAATCTGCGG - Intergenic
1077744659 11:4889205-4889227 CCCAAGGATGCCAAAATCTGAGG + Intronic
1080137741 11:28876641-28876663 CCCTTGGATACCAAAATCTGGGG - Intergenic
1083722478 11:64610214-64610236 CCCTGGGGTTTCAAAATCTAGGG - Intronic
1084559517 11:69895036-69895058 CCTTTGGGTGTGAAAATCTTTGG + Intergenic
1086394849 11:86404203-86404225 CTCTTAGGCCTCAAAATCTGGGG - Intronic
1086990575 11:93299496-93299518 CCTTTGGGAGTGAAAATGTGGGG - Intergenic
1088163494 11:106902908-106902930 CCCATGGGTGCCAAAATCCACGG - Intronic
1088477729 11:110260697-110260719 CCCTTGGATACCAAAAACTGTGG + Intronic
1089424281 11:118358676-118358698 CCCTTGGGTACCAAAATCCAAGG - Intergenic
1090463033 11:126908843-126908865 CTCTTGGGTATCACAATCTGCGG + Intronic
1091576619 12:1742572-1742594 CCCATGGATACCAAAATCTGTGG + Intronic
1095202373 12:39399337-39399359 CCTGTGGGTACCAAAATCTGTGG - Intronic
1098153104 12:67568420-67568442 CCCATGGATACCAAAATCTGCGG + Intergenic
1101547256 12:105727027-105727049 CCCTCGGATACCAAAATCTGCGG - Intergenic
1102396682 12:112591928-112591950 CCCTTGGATACCAAAACCTGTGG + Intronic
1104356264 12:128089753-128089775 GCCTTGGGTGCCAGAAGCTGAGG + Intergenic
1105052692 12:133068888-133068910 CTGTTGGGGGTCAAAATCGGAGG - Intergenic
1105608452 13:21946852-21946874 GTCTTGGTTGTCAACATCTGTGG + Intergenic
1107405640 13:40110226-40110248 CCCTTGGCTGTCAAATTCAGAGG + Intergenic
1108273605 13:48786621-48786643 CCCTTTGGTGTCAAATTTTGAGG + Intergenic
1109849684 13:68045124-68045146 ACCTTCAGTGTCAAAATCTCTGG + Intergenic
1111924106 13:94444694-94444716 CCCTGGGGTGACAAGCTCTGGGG - Intronic
1113352549 13:109543463-109543485 CCCTTGGATACCAAAATCTGAGG + Intergenic
1115029003 14:28773172-28773194 CCTTTGGGAGCCAAAATCTGAGG - Intronic
1117666125 14:58058123-58058145 CCCTTGGATACCAACATCTGAGG + Intronic
1118777355 14:68980994-68981016 CCCATGGATACCAAAATCTGAGG - Intergenic
1122955192 14:105067162-105067184 CCCTTGGGTGGCAGGAGCTGTGG + Intergenic
1129342536 15:74895655-74895677 CCCTTGGAGCTCAAAATCTAGGG - Intronic
1130826175 15:87548441-87548463 CCCTTGGGCTGCAAATTCTGTGG + Intergenic
1131093823 15:89643431-89643453 CCCGTGAATGCCAAAATCTGTGG - Intronic
1132018065 15:98336670-98336692 CCCTTGGTAGACAAAATATGAGG - Intergenic
1132800324 16:1748913-1748935 CCCAAGGATGCCAAAATCTGAGG + Intronic
1137551951 16:49443478-49443500 CTCTTTGCTGTCAAAATCTCAGG - Intergenic
1138647589 16:58436351-58436373 ACCATAGCTGTCAAAATCTGTGG - Intergenic
1140027539 16:71304212-71304234 CACTGGGGTGTCAGTATCTGTGG + Intergenic
1143611972 17:8023404-8023426 CCCTTGGATACCAAAATCTGAGG - Intergenic
1145740924 17:27273899-27273921 CCCTTTGGAGCCAAAATCTCTGG - Intergenic
1147384636 17:40074109-40074131 CCCTTTGGTGGCAACATTTGGGG - Intronic
1149740891 17:59044778-59044800 CCCTTGGATACTAAAATCTGAGG - Intronic
1153985604 18:10348190-10348212 ACCTTGGGTACCAAAATCTGTGG + Intergenic
1155834572 18:30564649-30564671 CCCTTGGGTTTATGAATCTGTGG + Intergenic
1156349286 18:36289196-36289218 CCCTTGGATACCAAAATCCGTGG + Intergenic
1156764877 18:40640698-40640720 CCCCTGGGTGTCAGAATGTGTGG - Intergenic
1159889460 18:73940279-73940301 CCCTTGGGTGTCTGAGTGTGGGG - Intergenic
1160895954 19:1401830-1401852 CGCTGGGGTGTGAGAATCTGAGG + Intergenic
1161342355 19:3750224-3750246 CCCTTGGGACTCAGACTCTGCGG + Intronic
1162507260 19:11093372-11093394 CCCTAGCGTGAGAAAATCTGGGG + Intronic
1163269195 19:16240178-16240200 CCCTTGGATACCAAAATCTGAGG - Intronic
1165149259 19:33751345-33751367 CCCTTGGATGTCTACGTCTGAGG - Intronic
1168526500 19:57092610-57092632 CCCTTAGCTGTAAACATCTGAGG - Intergenic
1168604440 19:57747224-57747246 CCCGCGGGTGTCAAAAACGGGGG - Intronic
926094829 2:10074356-10074378 CCCTTGCTTGTCAAACTCAGTGG + Intronic
926985003 2:18613051-18613073 CCTTTGGGTGGAAAATTCTGGGG - Intergenic
927732556 2:25487489-25487511 TCCTTGGGTTTCCATATCTGTGG + Intronic
927979810 2:27367949-27367971 ACCTTGGGTGACAGAAGCTGGGG + Intronic
932465401 2:71920389-71920411 CCCATGGGTATCAAAATCCATGG - Intergenic
937050224 2:118882487-118882509 CGCTTGGGTCTCAGAAGCTGAGG - Intergenic
940835722 2:158519384-158519406 CCCCTGGGTGTCAGTGTCTGAGG + Intronic
942257933 2:174124926-174124948 CCCTTCCTTGTTAAAATCTGTGG - Intronic
944410177 2:199433284-199433306 CTCTTGTGTGTCATAATTTGAGG - Intronic
945048137 2:205799757-205799779 CCCTTGATTGTCAATATCTCTGG + Intergenic
1175253180 20:57622052-57622074 CCCTTGGCTGCCAAAAGCTGGGG - Intergenic
1176678430 21:9803185-9803207 CCCATTGGTGTCAAAATTGGTGG + Intergenic
1177027429 21:15936661-15936683 CCATTGGGTTTCAAATGCTGGGG - Intergenic
1180616500 22:17131730-17131752 CCCTTGGGTGGCAGCTTCTGTGG - Exonic
1181995624 22:26879410-26879432 CCCATGGATACCAAAATCTGAGG - Intergenic
1182042393 22:27248631-27248653 CCCTTGAGTGTCTTTATCTGGGG - Intergenic
1182993949 22:34795708-34795730 CCCTTAGGTGAGAAAATATGAGG + Intergenic
1184637508 22:45846017-45846039 CGCTTGGATGCCAAAATCTATGG - Intergenic
1185007467 22:48289998-48290020 CCTCTGGGTGTCAGATTCTGGGG + Intergenic
1185231825 22:49688054-49688076 CTCTTGGGTGTCCGAATCTGGGG - Intergenic
950820842 3:15756758-15756780 CCCTTTGTTGTTTAAATCTGGGG - Intronic
951477959 3:23128786-23128808 CCCATGGGTGTCTGAATCTGAGG - Intergenic
952054670 3:29430250-29430272 ACACTGGGTGTTAAAATCTGTGG + Intronic
953245286 3:41185430-41185452 CCCCTGGGTGTCACTAGCTGTGG - Intergenic
953398757 3:42593514-42593536 CCCTTAGATATCAAAATCTGAGG - Intronic
956757063 3:72399081-72399103 CCCACGGGTACCAAAATCTGTGG + Intronic
957235875 3:77590306-77590328 CACTTGGGTGACAAATTATGAGG - Intronic
960981865 3:123236547-123236569 TCCTAGGGTGCAAAAATCTGAGG - Intronic
961062915 3:123847257-123847279 CCCTTGGGTGTCAAAATCTGTGG - Intronic
964566254 3:158056850-158056872 CCTGTGAGTGTCTAAATCTGGGG - Intergenic
965485333 3:169272012-169272034 CACCTGGGTGTCACACTCTGAGG - Intronic
966980051 3:185124201-185124223 CCCGTGGATACCAAAATCTGTGG - Intronic
967204684 3:187108699-187108721 CCCTTGGATACCAAAATCTGTGG + Intergenic
968164138 3:196450847-196450869 CCCTTGGATATCAAAATTTGAGG - Intergenic
968842866 4:3021027-3021049 CCCTTGGATATCAAAATCCAAGG - Intronic
969536555 4:7759950-7759972 CACCTGGGTGGCAAAGTCTGTGG + Exonic
970867020 4:20771108-20771130 CCCATGGATACCAAAATCTGGGG - Intronic
970976844 4:22051421-22051443 CCCATGGATACCAAAATCTGTGG + Intergenic
973231947 4:47849772-47849794 CCCTTGGATATAAAAACCTGAGG + Intronic
974304154 4:60109948-60109970 CCCTTGGATACCAAAACCTGTGG - Intergenic
978130849 4:105195493-105195515 CCCATGGATATCAAAATCTGTGG + Intronic
980947180 4:139332943-139332965 CCCTTGGGTACCAAAATCCAGGG + Intronic
983200225 4:164853021-164853043 CCCATGGATACCAAAATCTGTGG + Intergenic
983271667 4:165569358-165569380 CCCTTAGTTGTCCTAATCTGCGG + Intergenic
984453554 4:179935932-179935954 CCCGTGGATGCCAAAATCTGTGG + Intergenic
984828108 4:183946430-183946452 CCCATGGATACCAAAATCTGAGG + Intronic
984840222 4:184061134-184061156 CCCATGGGTACCAAAATCTGAGG + Intergenic
988791002 5:34607548-34607570 CCCTTGGATATCAAAATCCATGG - Intergenic
989523234 5:42424628-42424650 CACTAGTGTGTCAAAAGCTGGGG - Intronic
990290817 5:54349598-54349620 TCTTTGGGTGTCCAAATCTTTGG - Intergenic
991477346 5:67036518-67036540 CCCTTGGAAACCAAAATCTGAGG + Intronic
992632129 5:78691718-78691740 CCTTTGAGTTTAAAAATCTGAGG + Intronic
993671391 5:90765044-90765066 TCCTTGGGGGTCAATCTCTGTGG + Intronic
997168047 5:131683201-131683223 CCCATGGTTACCAAAATCTGTGG + Intronic
997189942 5:131922550-131922572 CCCTTGGATACCAAAATCTGTGG - Intronic
998773732 5:145574709-145574731 CCTGAGGATGTCAAAATCTGTGG + Intronic
1004054027 6:12116373-12116395 CCCTTGATTCTCAAGATCTGGGG - Intronic
1006885894 6:37382012-37382034 CTCTTGGAAGTGAAAATCTGTGG - Intronic
1007194316 6:40047366-40047388 CCCATGGCTCTCAAAATATGGGG - Intergenic
1010535399 6:77022481-77022503 CCCTGGAATATCAAAATCTGTGG + Intergenic
1012467176 6:99529161-99529183 CCCTTGGATACCAAAGTCTGTGG - Intergenic
1014994916 6:128130775-128130797 GCCTTGGGTATCTAAATCAGAGG - Intronic
1015074523 6:129139555-129139577 CCTGTGGATATCAAAATCTGAGG - Intronic
1015641940 6:135344036-135344058 CCCTTGGACAACAAAATCTGTGG + Intronic
1017676164 6:156816427-156816449 CCATTGGGTGTCAGAAGTTGGGG + Intronic
1018291640 6:162298059-162298081 CCTGTGGGTGTCAACCTCTGAGG - Intronic
1023691714 7:42796107-42796129 AGTTTTGGTGTCAAAATCTGTGG + Intergenic
1030986420 7:116246594-116246616 CCCTTAGGTGTCATAACCAGGGG - Intronic
1032146789 7:129390367-129390389 CCCATGGATACCAAAATCTGAGG - Intronic
1034391869 7:150793446-150793468 CCTTTGGTTGTCAATATCTTGGG - Intronic
1034498295 7:151434607-151434629 CCCTTGGATATCAAAATCCGAGG + Intronic
1036591266 8:10170723-10170745 CCCATAGGTAGCAAAATCTGAGG - Intronic
1036631314 8:10517914-10517936 CCCTTGAGTGCCAAAAGCAGGGG + Intergenic
1038655514 8:29447470-29447492 CCCTTGAATCCCAAAATCTGTGG + Intergenic
1039453581 8:37694595-37694617 CCTTTGGGTGCCGAACTCTGGGG - Intergenic
1042302019 8:67294228-67294250 CCCATGGATACCAAAATCTGTGG - Intronic
1045863647 8:106840549-106840571 CCCTTGGATACCAAAATCTGTGG + Intergenic
1046343232 8:112886717-112886739 CCCTTGGATACCAAAATCTGAGG + Intronic
1046460836 8:114533708-114533730 CTCTTGGGTGTGAAAAATTGTGG - Intergenic
1047974934 8:130120743-130120765 CCCTTAGGTCTCTAATTCTGTGG + Intronic
1050384329 9:5070452-5070474 CCCATGGATACCAAAATCTGAGG + Intronic
1050406320 9:5312174-5312196 GCCATGTGTGTCAAAATCAGGGG - Intergenic
1053605655 9:39655955-39655977 CCCTTGAGTGGGAAGATCTGCGG + Intergenic
1053863573 9:42412585-42412607 CCCTTGAGTGGGAAGATCTGTGG + Intergenic
1054247888 9:62686460-62686482 CCCTTGAGTGGGAAGATCTGCGG - Intergenic
1054562002 9:66720985-66721007 CCCTTGAGTGGGAAGATCTGCGG - Intergenic
1057021882 9:91705779-91705801 CCCATGGATATGAAAATCTGTGG + Intronic
1057535497 9:95899720-95899742 CTCTTGGGTACCAAAATGTGTGG + Intronic
1057799843 9:98184113-98184135 CCCAAGGATATCAAAATCTGTGG - Intronic
1203663597 Un_KI270754v1:5724-5746 CCCATTGGTGTCAAAATTGGTGG + Intergenic
1187367683 X:18677882-18677904 CCCCTGGGGGACAAAATCTTGGG + Intronic
1187781022 X:22825130-22825152 CCTTTGGGAATCAATATCTGTGG + Intergenic
1187951634 X:24476480-24476502 CCCTTGGATATCAAAATCCATGG - Intronic
1188146225 X:26617090-26617112 CACTTGGTTGTCACAACCTGGGG + Intergenic
1192356787 X:70411571-70411593 CCCTTGGGTGTTCCAATGTGTGG - Intronic
1198445890 X:136713994-136714016 CCTTTGGGGAACAAAATCTGAGG + Intronic
1198979810 X:142381913-142381935 CCCCTGGTTCTCAAAATGTGTGG - Intergenic
1201193055 Y:11465389-11465411 ACCTTGTGACTCAAAATCTGGGG - Intergenic