ID: 961064381

View in Genome Browser
Species Human (GRCh38)
Location 3:123862094-123862116
Sequence CTGGTGACGCTGAGCCAGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 277
Summary {0: 1, 1: 0, 2: 2, 3: 28, 4: 246}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961064381 Original CRISPR CTGGTGACGCTGAGCCAGCA TGG (reversed) Intronic
900226169 1:1534555-1534577 CTGGTGACCCTGAGAGAGGAGGG + Exonic
900437368 1:2637565-2637587 CTGGTGCCTCACAGCCAGCATGG - Intronic
901795205 1:11675808-11675830 GGGGTGCTGCTGAGCCAGCAAGG - Intronic
902224546 1:14988384-14988406 CTGCTCAGGCTGAGCCAGCAGGG - Intronic
902928036 1:19710212-19710234 CTTGGGACGCTGAGGCAGGAGGG - Intronic
903433899 1:23331724-23331746 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
904519866 1:31086537-31086559 CTGGGGAGGCTGAGACAGGAAGG + Intergenic
906979381 1:50612822-50612844 TTGGCTAGGCTGAGCCAGCAAGG - Intronic
907882691 1:58565874-58565896 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
915229495 1:154435040-154435062 CAGGTGACACTGAGCCAGCGGGG - Exonic
916589418 1:166176043-166176065 GGGGTGATGCTGAGCCTGCAGGG - Intergenic
916642683 1:166747759-166747781 CTGGTAAGGCTGAGGCAGCCAGG - Intergenic
919754116 1:201056133-201056155 CTGGGGGCGCTGAGCTAGCGAGG - Intronic
919928783 1:202208029-202208051 AGGGAGAGGCTGAGCCAGCAGGG - Intronic
920221166 1:204402513-204402535 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
920385273 1:205567161-205567183 CTAGAGGAGCTGAGCCAGCAAGG + Intergenic
920458152 1:206116703-206116725 CTGCTGACCCTGGGCCAGCTGGG - Exonic
922857544 1:228788024-228788046 CTGGTGACGTTGGACAAGCAAGG - Intergenic
923506135 1:234608548-234608570 CTGCTGGCGCTGCACCAGCACGG - Exonic
1062980181 10:1715751-1715773 CTGGTGCCGCTGAGGAAGCCAGG + Intronic
1065179041 10:23106695-23106717 CTGGTGAGGCTGCACCTGCAGGG - Intronic
1067078338 10:43200562-43200584 CTAGTCACACTGAGCCATCAGGG - Intronic
1067412097 10:46073875-46073897 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
1071345709 10:84690194-84690216 CTGGAGAAGCTGAGCCTGCTGGG + Intergenic
1072605248 10:96975905-96975927 CTTGGGAGGCTGAGCCAGGAGGG + Intronic
1072986989 10:100149573-100149595 CTGGTGATCTTGGGCCAGCAGGG - Intergenic
1073430181 10:103480780-103480802 TTCGTGACCCTGAACCAGCAGGG + Intergenic
1075257770 10:120939182-120939204 CTGGTGACACTGAGGCAGGAGGG - Intergenic
1075485910 10:122821999-122822021 CAGGGGAAGCTGAGCCAGCCAGG - Intergenic
1075676050 10:124296357-124296379 CAGGTGATGCTGAGCCGGCTGGG + Intergenic
1076200688 10:128555390-128555412 CTGAGAAGGCTGAGCCAGCATGG + Intergenic
1076219871 10:128724589-128724611 CTGGTGAGGCTCAGCAAACATGG - Intergenic
1076889892 10:133278291-133278313 CTGCCGACGCTGAGCTACCAGGG + Intergenic
1077022662 11:425834-425856 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1077392497 11:2306701-2306723 ATGGTGGCCCTCAGCCAGCAAGG + Intronic
1078057014 11:8017290-8017312 CTGCTGGTTCTGAGCCAGCATGG + Intergenic
1078219878 11:9342914-9342936 CTCGGGAGGCTGAGGCAGCAGGG + Intergenic
1081724809 11:45320869-45320891 CTGGAGAAGCTGAGGCAGCATGG + Intergenic
1081870156 11:46379679-46379701 CTGGGAAACCTGAGCCAGCAGGG + Intronic
1082266150 11:50120717-50120739 CTGGTAAGGGTGAGCAAGCAAGG + Intergenic
1082289939 11:50357855-50357877 CTGGTAAGGGTGAGCAAGCAAGG - Intergenic
1082820401 11:57541037-57541059 CTGGAGCCGCTGAACCAGGAAGG + Intergenic
1083635627 11:64119337-64119359 CTGGCCAAGCTGAGCCAGGATGG - Intronic
1084030131 11:66476257-66476279 CTGGTGTGGCTGTGCCAGCAGGG - Exonic
1084274017 11:68042796-68042818 CTGGTGCAGCTGGGCCCGCAGGG - Exonic
1089073919 11:115721770-115721792 CTGGGGGCACTGTGCCAGCATGG + Intergenic
1090704357 11:129323050-129323072 CTGGGGACGCTTCGTCAGCAAGG + Intergenic
1091922892 12:4320080-4320102 CTCGGGAGGCTGAGCCAGAATGG + Intergenic
1095098540 12:38160348-38160370 AAGGTGACGTTGAGGCAGCAGGG + Intergenic
1095583343 12:43824819-43824841 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1098236064 12:68419621-68419643 CTGGAGAGGCTGAGACAGGAGGG + Intergenic
1099587857 12:84544634-84544656 CTGGAGAGGCTGAGGCAGAATGG - Intergenic
1102096507 12:110245668-110245690 CAGGGGGCACTGAGCCAGCAGGG - Intergenic
1103638423 12:122328687-122328709 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1103682493 12:122705675-122705697 CTCGGGAGGCTGAGGCAGCATGG - Intergenic
1103684224 12:122719100-122719122 CTCGGGAGGCTGAGGCAGCATGG - Intergenic
1106498325 13:30303455-30303477 CTGGGGAGGCTGAGACAGGAAGG + Intronic
1108495350 13:51019278-51019300 CTGGTGACGCTGAGTGGGTAGGG - Intergenic
1110670321 13:78169540-78169562 CTGGTGGGGCTAAGACAGCAGGG + Intergenic
1113616475 13:111684205-111684227 CTGGTGGGGCCCAGCCAGCATGG + Intergenic
1113622005 13:111769476-111769498 CTGGTGGGGCCCAGCCAGCATGG + Intergenic
1113679991 13:112236690-112236712 CTGGTGACGCTGCTCCAGCCAGG + Intergenic
1114341549 14:21750649-21750671 CTGGTAAGGCTGAGGCAGCCAGG - Intergenic
1114516578 14:23303437-23303459 CTAGTGACCTTGAGCAAGCAAGG + Intronic
1114856073 14:26445766-26445788 CTGCTGACTCTGAGACAGCATGG + Intronic
1116562287 14:46395627-46395649 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1117139649 14:52775772-52775794 CTGGGGAGGCTGAGGCAGGAGGG + Exonic
1117689836 14:58295255-58295277 CTGGGGAGGCTGAGGCAGAATGG + Intronic
1121112949 14:91324745-91324767 CTGGTGCCGGGGAGCCAGCCTGG - Intronic
1121311306 14:92936572-92936594 CTGGTGAGTCTGAGCAGGCAAGG + Intergenic
1122045177 14:99017863-99017885 CTGGAGACTCCTAGCCAGCAAGG + Intergenic
1122278650 14:100608873-100608895 CTGGTGAGGCTGAGCCAGACCGG - Intergenic
1122589661 14:102838713-102838735 GAGGGGATGCTGAGCCAGCAGGG + Intronic
1122828397 14:104383447-104383469 CTGGGGGCGCTGAGCCAGGAGGG - Intergenic
1122886653 14:104713307-104713329 CTGGTGAGGCTGGGCCGGCTGGG + Exonic
1202837105 14_GL000009v2_random:86441-86463 CTGGTTGCTCTGAGCCAGCTTGG - Intergenic
1124101021 15:26693306-26693328 CTAGGAACGCTGAGCCAGCTTGG - Intronic
1124604425 15:31160236-31160258 TAGGTGACTCTGAGCCAGCCTGG - Intronic
1125159440 15:36626843-36626865 ATGGCTAAGCTGAGCCAGCATGG + Intronic
1125709657 15:41774608-41774630 CTGGTGAGGCTGGGCCCGAACGG + Exonic
1126045460 15:44635496-44635518 CTGGGGATGCTGAGGCAGGAGGG + Intronic
1126410122 15:48364834-48364856 CTGGAGAGGCTGAACCAGCAGGG - Intergenic
1127144686 15:56012139-56012161 CTCGTGAGGCTGAGGCAGGAAGG + Intergenic
1127523009 15:59761937-59761959 CTGGGGAGGCTGAGGCAGGAAGG - Intergenic
1128079877 15:64850490-64850512 GTGATGACACTGAGCCACCAGGG - Intronic
1130050373 15:80479202-80479224 CTGGGGTCCCTGAGCCAACATGG - Intronic
1132592839 16:733862-733884 CTGAAGACACTCAGCCAGCAGGG - Intronic
1132686497 16:1164437-1164459 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1132749091 16:1449127-1449149 CACGTGACCCTGAGCCAGGAGGG - Intronic
1133703315 16:8329761-8329783 CCGGTGCCACTGAGCCAGCTGGG - Intergenic
1138389548 16:56660283-56660305 TTGGTGACACTGGGCCAGCCAGG - Intronic
1138538022 16:57670054-57670076 TTGCTCACGGTGAGCCAGCAGGG + Intronic
1139563917 16:67761016-67761038 CTGGTGTCGGTGAGCTGGCAGGG - Intronic
1141557058 16:84843163-84843185 CTGGGGAGGCTGAGCCTTCATGG + Intronic
1141612074 16:85187484-85187506 CAGGTGACACTGAGCAAGAATGG - Intergenic
1145772024 17:27500113-27500135 CTGGGGGAGCTGAGCCAGGATGG + Intronic
1146184924 17:30718527-30718549 CTTGGGAGGCTGAGGCAGCAGGG - Intergenic
1146222497 17:31036955-31036977 CTTGTGAGGCTGAGGCAGAATGG - Intergenic
1147132121 17:38415680-38415702 CTGGTGCAGCTGAGGCTGCAGGG - Intergenic
1147192652 17:38747039-38747061 CTGGGGAGACTGAGGCAGCATGG + Intronic
1147218758 17:38915847-38915869 CTGGAGGCGCTGAGCCTGCCAGG - Intronic
1147392631 17:40119827-40119849 CTGGGGAGGCTGAGGCAGAATGG + Intergenic
1148208659 17:45795055-45795077 CTGGAGGAGCTGACCCAGCAGGG + Intronic
1149506475 17:57198093-57198115 ATTGTGATGCTGAGCCAGCCTGG + Intergenic
1149758193 17:59205592-59205614 CTGGGAAGGCTGAGCCAGAATGG + Intronic
1149758342 17:59206929-59206951 CTGGGAAGGCTGAGCCAGAATGG + Intronic
1150108234 17:62478060-62478082 CTGGAGACGCTCTGCCAGCCAGG + Intronic
1150441423 17:65194855-65194877 CAGGTGACACTGACCCAGCTGGG + Intronic
1152287413 17:79421077-79421099 CTGGGGAGGCTCACCCAGCAGGG - Intronic
1152534409 17:80942128-80942150 CTGGAGACGCTCATCCAGCAGGG - Intronic
1152627000 17:81392463-81392485 CTGGTGAGGCTGAGCCAGAAGGG + Intergenic
1155152336 18:23133260-23133282 CTGGGGAGGCTGAGGCAGGAGGG - Intergenic
1160527660 18:79546907-79546929 CACGGGACGCTCAGCCAGCAGGG - Intergenic
1160777940 19:865013-865035 CTCGGGACGCTGAGGCAGAATGG + Intergenic
1161868025 19:6848899-6848921 CTGGGGAGGCTGAGCTAGGAGGG - Intronic
1161936555 19:7375960-7375982 CTGGTGGCGCTTACCCACCATGG + Intronic
1162398924 19:10432930-10432952 CTGGAGACACTGAGCCAGGCAGG - Intronic
1162973850 19:14197162-14197184 CTCGGGAGGCTGAGGCAGCAGGG + Intronic
1163025796 19:14511151-14511173 CTAGGGAAGCTGAGCCAGGAGGG + Intergenic
1163274811 19:16276913-16276935 CAGGTGACACGGAGCCAGCAGGG + Intergenic
1163488609 19:17604372-17604394 CGGCTGGAGCTGAGCCAGCAAGG - Exonic
1163729904 19:18942879-18942901 GTGGTGGCGCTGAGCCTGGAAGG - Intergenic
1164484929 19:28647203-28647225 CTGGGGAGGCTGAGACAGGAGGG - Intergenic
1165716942 19:38052512-38052534 CTGGTGAGGCTCAGCCAACAGGG - Intronic
1165898215 19:39155966-39155988 CTGGTGAGGCGGCGCCAGCATGG + Intronic
1166292780 19:41873721-41873743 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1166703757 19:44896944-44896966 CTGGGGACGCTGAGCTGGCAGGG + Intronic
1166997479 19:46726642-46726664 CTGGTGCCGCTCACCCAGCAGGG + Intronic
1167073349 19:47233476-47233498 CTGGGGAGGCTGAGGCAGAAAGG - Intergenic
1167221743 19:48203907-48203929 CTGGTGGCGCTCAGCCGGCTGGG - Intronic
1168062916 19:53903633-53903655 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1168223814 19:54980301-54980323 CTGGGGAGGCTGAGGCAGAATGG - Intronic
1202635529 1_KI270706v1_random:40910-40932 CTGGTTGCTCTGAGCCAGCTTGG + Intergenic
928108789 2:28489953-28489975 CTCTTGATTCTGAGCCAGCAAGG - Intronic
928437384 2:31263656-31263678 AGGGTGAGGCTGAGCCAGGAAGG - Intronic
929502921 2:42505504-42505526 GAGGTGGTGCTGAGCCAGCATGG - Intronic
929551386 2:42895323-42895345 CTGGTGTCCCTGAGTCAGAAGGG - Intergenic
929804226 2:45130579-45130601 CTCATGAAGCTGAGCCAGGAGGG - Intergenic
930827002 2:55704983-55705005 ATGCTGAAGCTCAGCCAGCACGG + Intergenic
931285511 2:60828621-60828643 CTGCGGAGGCCGAGCCAGCAGGG - Intergenic
932015632 2:68023893-68023915 CTGGAGAGTCTGTGCCAGCAGGG - Intergenic
932494887 2:72141347-72141369 CTGGTGGTCCTGGGCCAGCAGGG - Intronic
932751005 2:74371656-74371678 CTGCTGACGCTGAGCCAGAGGGG + Exonic
934053469 2:88231006-88231028 CTGCTGACACTGAACCAGCAGGG + Intergenic
934720417 2:96571422-96571444 CTGGTGATGCTGAGTCAGGCAGG - Intergenic
935298199 2:101669180-101669202 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
938478090 2:131634331-131634353 CTGGTTACTCTGAGCCAGCTTGG + Intergenic
940356938 2:152753802-152753824 CTCGTGAGGCTGAGGCAGAATGG - Intronic
943470168 2:188285285-188285307 CTGTTGATGCAGAACCAGCATGG + Intergenic
945950214 2:216032483-216032505 CTGGTAATGCTAACCCAGCATGG + Intronic
946833057 2:223744706-223744728 CTGGTCACACTGACACAGCATGG + Intergenic
947570272 2:231228282-231228304 ATGGTGATGATGAGCCTGCATGG + Intronic
948015087 2:234682596-234682618 CTCGTGGAGCAGAGCCAGCAGGG - Intergenic
948244145 2:236464053-236464075 TCGCTGACTCTGAGCCAGCAAGG + Intronic
948832272 2:240603909-240603931 CTGGGGAGGCTGAGCCAGGCAGG - Intronic
948902075 2:240961131-240961153 ATGGTGACCCTGGGCCAGCCTGG - Intronic
1168902788 20:1379361-1379383 CTGCTGCTGCTGAGCCAGCATGG + Intronic
1169398210 20:5254645-5254667 CTTCTGACGCTGCTCCAGCAGGG - Intergenic
1170131235 20:13022528-13022550 CTGGAGAAGCTGGGCCAGGAGGG + Intronic
1170649952 20:18230073-18230095 CTGGTAATGCTGAGTCAGAAAGG - Intergenic
1173225403 20:41159737-41159759 CTGAAAACGCTGAGCCTGCAAGG + Exonic
1174352128 20:49976045-49976067 CTTGGGAGGCTGAGGCAGCATGG - Intergenic
1174577566 20:51547447-51547469 CTGGGGACGCAGAGCCACCTTGG - Intronic
1175841305 20:62029437-62029459 CTGGTGCTGCAGAGCTAGCAGGG - Intronic
1179917809 21:44489039-44489061 CTGGTGAATTTGGGCCAGCAAGG + Intergenic
1180057232 21:45365223-45365245 CTGGTGACGCTGCGCCTGTCAGG - Intergenic
1180365179 22:11932317-11932339 CTGGTTGCTCTGAGCCAGCTTGG - Intergenic
1181821907 22:25483030-25483052 ATGGAGACGCTCAGCCTGCATGG - Intergenic
1182580599 22:31307706-31307728 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1184119640 22:42441437-42441459 CTGGTGATGCTGAACCACCTGGG + Intergenic
1185235068 22:49707558-49707580 CTGGAGAAGCTGGCCCAGCAGGG - Intergenic
949541882 3:5038919-5038941 CTTGTGAGGCTGAGGCAGGAAGG + Intergenic
950485885 3:13273814-13273836 GGGGTGAGGCAGAGCCAGCAGGG - Intergenic
952757227 3:36881342-36881364 CTGGGGAGGCTGAGGCAGAATGG + Intronic
953042800 3:39269726-39269748 CTGGGGACTCTGAGACAGCAGGG - Intronic
953340334 3:42129104-42129126 CTGGTGACGCTCTGCCAGTTTGG - Intronic
953404089 3:42651981-42652003 CTGGAGACGCTCACCCAGCAAGG - Intergenic
953702632 3:45208520-45208542 CAGATGAGGCTGAGGCAGCAAGG + Intergenic
955171281 3:56567795-56567817 CTGGGGAGGCTGAGGCAGAATGG - Intronic
956060330 3:65342259-65342281 CTGGTGGCCCTCAGCCACCAAGG - Intergenic
959968188 3:112379923-112379945 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
961064381 3:123862094-123862116 CTGGTGACGCTGAGCCAGCATGG - Intronic
961080621 3:124024297-124024319 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
961824146 3:129589994-129590016 GTGGAGACGCAGAGCCAGCCGGG - Intronic
967758133 3:193193455-193193477 CTGGGGGTGCTGAGCCAGCTGGG - Intergenic
968959129 4:3734126-3734148 CTGGGGAAGGTGAGGCAGCATGG + Intergenic
969800897 4:9564445-9564467 CTGGTGATTCTGACCCAGTAGGG + Intergenic
970867278 4:20773477-20773499 CTGTTGACTCTGAGCAAGCTGGG + Intronic
971455401 4:26839624-26839646 GTGATGAAGTTGAGCCAGCAAGG - Intergenic
972495408 4:39629697-39629719 CTGGGGAGGCTGAGGCTGCAGGG - Intronic
973991919 4:56417676-56417698 CTTGTGAGGCTGAGGCAGGAAGG + Intronic
979455164 4:120919075-120919097 CTGAAGTCGCTGAGCCAGCCAGG - Intronic
979915501 4:126427994-126428016 CTGGAGATGCCGACCCAGCAGGG + Intergenic
982979336 4:162112348-162112370 CTGGGGAGGCTGAGACAGGAGGG - Intronic
983531450 4:168813700-168813722 CTGGTGAGGCTGAGGCAGGAGGG - Intronic
984920559 4:184760737-184760759 GTGGTGACGCTGAATAAGCACGG - Intronic
1202762846 4_GL000008v2_random:126789-126811 CTGGTTGCTCTGAGCCAGCTTGG + Intergenic
988582103 5:32477374-32477396 CTGGGGAGGCTGAGGCAGGACGG - Intergenic
988606920 5:32686518-32686540 CTGGGGAGGCTGAGGCAGGAGGG + Intergenic
989110314 5:37900937-37900959 CTGGTGGGTCTGTGCCAGCAGGG - Intergenic
992512160 5:77448116-77448138 CTGGCACCACTGAGCCAGCATGG - Intronic
992908560 5:81372561-81372583 CTGATGAGGCAGAGCCAACAAGG - Intronic
995100337 5:108292981-108293003 CTGGGGAGGCTGAGGCAGAATGG + Intronic
998335050 5:141364388-141364410 CTGGGGACGCTGTGCGAGCCAGG + Exonic
999551236 5:152689414-152689436 CTGGTGAGACTGAGACAGCCTGG - Intergenic
1001844026 5:174904723-174904745 CTGGAGACTCCAAGCCAGCAGGG + Intergenic
1002448889 5:179307965-179307987 CTGGTGACGTGGACCCAGCAAGG - Intronic
1002449504 5:179310798-179310820 CTGGGGACGCAGAGGCATCAGGG + Intronic
1002858894 6:1062273-1062295 CTGGTACCCCTGAGACAGCAAGG + Intergenic
1002876267 6:1213085-1213107 TTGGTGACACTGCACCAGCAGGG + Intergenic
1003126943 6:3363240-3363262 CTGGTGAGGATGGGCCAGCCAGG - Intronic
1004845881 6:19641307-19641329 ATGGTCACGAGGAGCCAGCATGG - Intergenic
1005529810 6:26691640-26691662 CTGGTGAGGGTGAGCTAGAAGGG - Intergenic
1005540986 6:26810007-26810029 CTGGTGAGGGTGAGCTAGAAGGG + Intergenic
1006044568 6:31283748-31283770 CTCGGGAGGCTGAGCCAGAATGG - Intronic
1006305562 6:33216227-33216249 CTGGTGATGCTGCACCAGCCTGG - Intergenic
1009011801 6:57852096-57852118 CTGGTGAGGGTGAGCTAGAAGGG + Intergenic
1010506129 6:76661757-76661779 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1013952224 6:115797031-115797053 ATTGTGATGCTGACCCAGCAGGG - Intergenic
1014889340 6:126823660-126823682 CTTGGGACGCTGAGGCAGGAAGG - Intergenic
1015580572 6:134719987-134720009 CAGTTGACCCTGAGCCAGAATGG - Intergenic
1015928682 6:138335028-138335050 CTGGGGACGCTGAAGCAGCGGGG - Exonic
1016776125 6:147906578-147906600 CTGTTGATGCTTAGTCAGCAGGG + Intergenic
1018103288 6:160460172-160460194 CTGTTTAGGCTGAGCCAGAAAGG + Intergenic
1019082476 6:169444491-169444513 CTGGTGGAGCTGGGACAGCAGGG - Intergenic
1019625023 7:2011576-2011598 CTGGTCCCGCTGAGGCAGAAAGG + Intronic
1023056922 7:36298253-36298275 CTGGGGAAGCTGAGCCAACAGGG + Intronic
1023612232 7:41982592-41982614 CTTGTGAGGCTGAGGCAGGAGGG + Intronic
1024619708 7:51146971-51146993 ATGGTGATGGGGAGCCAGCAGGG + Intronic
1026633217 7:72057046-72057068 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1027085410 7:75260218-75260240 CTCGGGAGGCTGAGGCAGCAGGG - Intergenic
1029035227 7:97512970-97512992 GAGGTGACGCTGAGTCAACAAGG + Intergenic
1032037280 7:128530594-128530616 CTGGAGACGCTCTGCCAGCCAGG + Intergenic
1032081642 7:128861762-128861784 CTCGAGAAGCTGAGGCAGCAGGG - Intergenic
1034395913 7:150824842-150824864 AGGGTGACGCTGGGCCAGGAGGG - Intronic
1034499347 7:151439964-151439986 GGGGCGGCGCTGAGCCAGCAGGG - Exonic
1036596487 8:10217582-10217604 CTGTGGAAGCTGAGCGAGCAAGG - Intronic
1037902002 8:22693968-22693990 CTGGAGCCGCTGAGGTAGCAGGG - Intergenic
1041186389 8:55305293-55305315 CTGATGGCGTTGTGCCAGCAGGG + Intronic
1041739885 8:61146746-61146768 CTGGTGAAGCTCAGCCAGCATGG - Intronic
1042037616 8:64553305-64553327 CTGGTTAGGCTGAGGCAGAATGG - Intergenic
1046380655 8:113445555-113445577 ATGGTGACCCTGACCCAGAAAGG - Intergenic
1049254088 8:141604782-141604804 ATGGTCAGGCTGGGCCAGCAAGG - Intergenic
1049363364 8:142224861-142224883 CTGATGAGGCTGAGCCCGCGGGG + Intronic
1049719393 8:144108613-144108635 CTGCTGTGGCTGAGCGAGCAGGG + Exonic
1049783667 8:144440357-144440379 CTGGGGACGCTGGGCCTGCTGGG + Exonic
1049785674 8:144449523-144449545 CTGGGGACGCTGGGCCCTCAAGG + Intergenic
1050725430 9:8643726-8643748 CTGGGGGTGCTGAGGCAGCAAGG - Intronic
1053806110 9:41803629-41803651 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1053912814 9:42922833-42922855 CTGGTTGCTCTGAGCCAGCTTGG - Intergenic
1056850774 9:90081887-90081909 TAGGTGACGTTGAGCCAGCAGGG + Intergenic
1056912758 9:90718286-90718308 ATGGTGACTGTGGGCCAGCATGG + Intergenic
1057124848 9:92608989-92609011 GTGCTGCCGCTGAGCCAGCCTGG + Intronic
1057211810 9:93204611-93204633 GTGCTGACTCTGAGCCATCACGG + Intronic
1060022729 9:120146255-120146277 CTGGTGATGCTGAGCACTCATGG + Intergenic
1060302654 9:122384333-122384355 CTGGTGACTCAGAGCGAACATGG - Intronic
1060958940 9:127665264-127665286 CTGGATTAGCTGAGCCAGCAGGG - Exonic
1061136724 9:128738787-128738809 CTGGGGAGGCTGAGGCAGGAGGG - Intronic
1061451567 9:130669873-130669895 GGGGTGAGGCTGAGCCAGGAAGG + Intronic
1061639880 9:131944637-131944659 CTTGGGAGGCTGAGGCAGCAGGG - Intronic
1062050280 9:134443503-134443525 CTGGCGACGCTGGGACAGCGCGG + Intergenic
1062370573 9:136236750-136236772 CAGGTGACGCTGGCCCAGGACGG - Intronic
1062370802 9:136237608-136237630 CAGGTGACGCTGGCCCAGGATGG - Intronic
1062713451 9:137989337-137989359 GTGGTGGGGCTGAGCCAGCTGGG + Intronic
1203543609 Un_KI270743v1:111670-111692 CTGGTTGCTCTGAGCCAGCTTGG + Intergenic
1187046044 X:15648033-15648055 CAGGTGACGCTGTGGAAGCAAGG + Intronic
1187052023 X:15704335-15704357 CAGGTGACGCTGTGGAAGCAAGG + Intronic
1189281352 X:39821747-39821769 CGGGCGAGGCTGAGGCAGCATGG - Intergenic
1189611264 X:42738697-42738719 GTAGTGACCCTGAGCCACCATGG - Intergenic
1190210337 X:48441871-48441893 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1190762890 X:53451280-53451302 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1190835257 X:54094787-54094809 CTGGGGAGGCTGAGGCAGGAGGG + Intronic
1193513114 X:82430675-82430697 CTGGGGAGGCTGAGGCAGAATGG - Intergenic
1198633024 X:138663297-138663319 GTGGTGAGGCTAAGCCAGCCTGG + Intronic
1200135084 X:153870912-153870934 CGGGTGACGATGGGCCAGAACGG - Exonic
1201763943 Y:17562981-17563003 ATGGGGACGCTGAGGCAGCACGG - Intergenic
1201837610 Y:18343009-18343031 ATGGGGACGCTGAGGCAGCACGG + Intergenic