ID: 961064395

View in Genome Browser
Species Human (GRCh38)
Location 3:123862244-123862266
Sequence CAGATGAACTACAGGGACAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 188
Summary {0: 1, 1: 1, 2: 2, 3: 15, 4: 169}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961064395_961064398 1 Left 961064395 3:123862244-123862266 CCTGTGTCCCTGTAGTTCATCTG 0: 1
1: 1
2: 2
3: 15
4: 169
Right 961064398 3:123862268-123862290 GTATTCAGCAAGTTTTCCTGAGG 0: 1
1: 0
2: 0
3: 13
4: 236
961064395_961064399 2 Left 961064395 3:123862244-123862266 CCTGTGTCCCTGTAGTTCATCTG 0: 1
1: 1
2: 2
3: 15
4: 169
Right 961064399 3:123862269-123862291 TATTCAGCAAGTTTTCCTGAGGG 0: 1
1: 0
2: 0
3: 25
4: 227
961064395_961064402 19 Left 961064395 3:123862244-123862266 CCTGTGTCCCTGTAGTTCATCTG 0: 1
1: 1
2: 2
3: 15
4: 169
Right 961064402 3:123862286-123862308 TGAGGGTCTACTATATTTCTGGG 0: 1
1: 0
2: 0
3: 17
4: 167
961064395_961064401 18 Left 961064395 3:123862244-123862266 CCTGTGTCCCTGTAGTTCATCTG 0: 1
1: 1
2: 2
3: 15
4: 169
Right 961064401 3:123862285-123862307 CTGAGGGTCTACTATATTTCTGG 0: 1
1: 0
2: 2
3: 58
4: 439

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961064395 Original CRISPR CAGATGAACTACAGGGACAC AGG (reversed) Intronic
900725057 1:4210861-4210883 AAGCTGACCTCCAGGGACACAGG + Intergenic
903268510 1:22173191-22173213 AGGATGATCTACAGGGACAGTGG + Intergenic
905529278 1:38663918-38663940 CAGGAGAACTGCAGGGACAGTGG - Intergenic
905920173 1:41714057-41714079 CAGCTGGACTACAGGGGCCCGGG + Intronic
906178595 1:43798427-43798449 CAAATGAACTACAGGGAAATTGG - Intronic
907851119 1:58256033-58256055 CAGCTGAACTCCATGGCCACAGG - Intronic
909406123 1:75291629-75291651 CAGATGAACAACATGGACAAAGG + Intronic
910062692 1:83112734-83112756 CAGAGGAAATAAAGTGACACAGG + Intergenic
910160878 1:84271025-84271047 GAGATAGACTACAGGGACAAGGG + Intergenic
910646306 1:89519108-89519130 CAGCTGAACCACTGGGACTCTGG + Intergenic
916028352 1:160855084-160855106 TAGATGAAGTACATTGACACTGG + Intronic
918787252 1:188777755-188777777 CATATCAACAAAAGGGACACAGG - Intergenic
922576191 1:226662183-226662205 GAGCTGAGCAACAGGGACACAGG + Intronic
924920657 1:248626106-248626128 CAGATCATCTCCAGGGAAACAGG + Intergenic
1062795340 10:341047-341069 CAGGAGAAGTAGAGGGACACGGG + Intronic
1063040498 10:2332660-2332682 CAGATAAACTACTGAGACAGTGG - Intergenic
1063975626 10:11413436-11413458 CAGAGGGAGTTCAGGGACACAGG - Intergenic
1065898079 10:30182058-30182080 CAGCAGAGCTACAGGGACAGTGG + Intergenic
1069859593 10:71462097-71462119 CAGCTGAGCTTCAGAGACACAGG - Intronic
1070394395 10:75999550-75999572 CAGAGGAACTAGAGGCACATTGG - Intronic
1070545776 10:77451331-77451353 CAGATCAACTTCAGGGGCACAGG - Intronic
1071506296 10:86233808-86233830 CAGATCCACTACTGGGACTCTGG + Intronic
1072628760 10:97131435-97131457 CAGGAGTACTACAGGCACACAGG + Intronic
1074261193 10:111855188-111855210 CAGAAAAACTAAAGGGACATAGG - Intergenic
1075719871 10:124578335-124578357 CAGGTGAGCCACAGGGCCACAGG + Intronic
1076885202 10:133258952-133258974 CCTATGCACTGCAGGGACACTGG + Intergenic
1077197595 11:1289065-1289087 CAGTTCCACTTCAGGGACACTGG + Intronic
1079805072 11:24921104-24921126 AGGATTAACGACAGGGACACAGG + Intronic
1082242250 11:49885971-49885993 CAGATAAACTGAAAGGACACCGG - Intergenic
1086279779 11:85171987-85172009 CAGCTGAACCACAGGGACAGTGG - Intronic
1090854960 11:130603076-130603098 CAGAGGAACTGGAGGGACCCTGG + Intergenic
1095974612 12:47930735-47930757 CAGGTGAAGTGCAGGGACCCAGG - Intronic
1096714140 12:53481005-53481027 CTGATAAACTCTAGGGACACTGG - Intronic
1098192043 12:67959805-67959827 AAGTTGAAATACAGGGACACAGG + Intergenic
1100773991 12:97954651-97954673 CAGATGAACTGCAGGGCCTGTGG - Intergenic
1101203768 12:102464666-102464688 TAGAAGAACCACAGGGTCACTGG + Intronic
1101566051 12:105906568-105906590 CAGTTGGCCTACAGGCACACAGG - Intergenic
1104659573 12:130600799-130600821 CAGATGAACTACCGGATCACGGG - Intronic
1106527759 13:30557935-30557957 CACAGGAACCTCAGGGACACTGG - Intronic
1106620023 13:31364013-31364035 CACATTTAGTACAGGGACACAGG + Intergenic
1106989224 13:35396875-35396897 CTGATGTAATACAGGGGCACAGG - Intronic
1108696518 13:52907008-52907030 CAGATGAAAATCTGGGACACAGG + Intergenic
1108817007 13:54304870-54304892 CAAATGAAATACAGGGATAGAGG + Intergenic
1109053845 13:57520122-57520144 GATAGGAACTACAGGGACACCGG - Intergenic
1109187717 13:59290465-59290487 CATATCAACCACAGTGACACTGG - Intergenic
1110608676 13:77464022-77464044 GAGATGAACTAGAGAGACAATGG + Intergenic
1117154279 14:52922411-52922433 CAGGTGAACTACAGTGAAAGAGG + Intronic
1117610319 14:57476377-57476399 TAGATGCACTACTGGGACTCAGG + Intronic
1117673694 14:58133876-58133898 CATATGTACTACAGGGAGATAGG + Intronic
1119901684 14:78265925-78265947 CAGATGAACAAGACAGACACAGG - Intronic
1120108690 14:80526964-80526986 CAGATGAACTGCAGGAATCCTGG + Exonic
1120558245 14:85956927-85956949 GTGATGAAAGACAGGGACACAGG - Intergenic
1121485255 14:94309838-94309860 CAGATGAACTACGTGGGCAATGG - Exonic
1122946525 14:105013140-105013162 CAGATGCACTAGATGGACATTGG + Intronic
1122986231 14:105212879-105212901 CAGATGAACCCTCGGGACACTGG + Intronic
1129257266 15:74340767-74340789 CAGATGAAATACAGAGGCTCAGG + Intronic
1131230123 15:90653603-90653625 CAGACAATCAACAGGGACACAGG - Intergenic
1131317817 15:91356016-91356038 CTGGTGAACAACACGGACACAGG - Intergenic
1131463846 15:92638871-92638893 CACATGACCTCCAGGCACACAGG + Intronic
1131838591 15:96414177-96414199 CAGATGACCTACTGGGTGACAGG + Intergenic
1133518522 16:6533201-6533223 CAGATCAACTATAGTGATACAGG + Intronic
1135513531 16:23110083-23110105 CAAATGCACTACAGTGACATAGG + Intronic
1143102970 17:4514252-4514274 CAGATGGACTCCAGGGCCAAGGG - Intronic
1146037876 17:29423552-29423574 GAATTGAAATACAGGGACACAGG - Intronic
1150724419 17:67640091-67640113 CAGATGGACTTGAGGGAAACGGG - Intronic
1151003974 17:70412427-70412449 GAAATGGACTACAGGGATACGGG - Intergenic
1151517821 17:74607764-74607786 CACATGAACCATATGGACACAGG - Intergenic
1152427111 17:80224067-80224089 AAGATGACCTGCAGTGACACAGG - Intronic
1157257531 18:46152370-46152392 CAGATGCACAACTGGGACCCAGG - Intergenic
1157450921 18:47788447-47788469 CAGAAGAACTACAAGAAAACTGG + Intergenic
1160123323 18:76148990-76149012 CACAGGAACTACAGGAACTCAGG + Intergenic
1161168832 19:2802935-2802957 CAGGTGCATTACAAGGACACAGG - Intronic
1161755035 19:6126603-6126625 CAGAGGAACTCCTGGGACAGAGG + Intronic
1163688106 19:18723771-18723793 CAGTTGCCCTGCAGGGACACTGG + Intronic
1163720794 19:18897265-18897287 CACCTGAACTTCAGGGGCACAGG + Intergenic
1165523472 19:36332302-36332324 CGGAGGACCTACAGGGACACTGG + Intergenic
1165858073 19:38891964-38891986 CAGCTGGAGGACAGGGACACAGG + Intronic
1167600518 19:50451832-50451854 CAGAAGAGATACAGGGACCCTGG - Intronic
1168400836 19:56085431-56085453 CAGGTGAACTACAGGGCCGACGG + Intergenic
925014383 2:510690-510712 CAATAGAACTACAGGGACTCAGG - Intergenic
926321791 2:11753486-11753508 CAGTTTAACCACAGGGACGCTGG + Intronic
927108684 2:19848957-19848979 GAGATGAAGTAGAGGGACAGAGG - Intergenic
933836714 2:86251713-86251735 CAGATGAGCTTCAGGGGCTCTGG + Intronic
934536816 2:95141009-95141031 CAGACGGACTTCAGGGACTCAGG + Intronic
934969765 2:98753799-98753821 CAGGTGGACTACAGGGAGAAAGG - Intergenic
939800350 2:146700099-146700121 CACATGACCTACTGAGACACTGG + Intergenic
940616445 2:156054636-156054658 CAGAGGATCTCCAGGGAAACTGG - Intergenic
943065685 2:183083813-183083835 CAGAGGAACTACATAAACACAGG - Intronic
943655578 2:190505019-190505041 GTGATGAACTAGAGGGAAACTGG + Exonic
945688333 2:213000563-213000585 CAGTTTTACTACAGGGACACAGG + Intronic
946960162 2:224976591-224976613 CAGGTGAACAACAGGTACCCAGG + Intronic
948707539 2:239804429-239804451 TGGATGAGCTACAGGGACATTGG - Intergenic
948709112 2:239814302-239814324 CAGAAGAACTGCTGAGACACGGG - Intergenic
1170202922 20:13764367-13764389 CAGATCAAATACAGGGAAAAAGG + Intronic
1170403095 20:16008808-16008830 CCTAAGAACTACAGGAACACTGG + Intronic
1171023250 20:21606288-21606310 CAGATGAAATGCCGGGGCACGGG - Intergenic
1172292816 20:33788532-33788554 CTGATGAACAACAGGGAGGCTGG - Intronic
1173547858 20:43913460-43913482 CAGATGAAAAAAATGGACACAGG + Intergenic
1174852369 20:54007468-54007490 CAAAAGAACTCCAGGAACACAGG + Intronic
1175093990 20:56527511-56527533 CACATGAACTGCAGGCCCACAGG + Intergenic
1176335887 21:5599850-5599872 GATAGGAACTACAGGGACTCTGG - Intergenic
1176391870 21:6221098-6221120 GATAGGAACTACAGGGACTCTGG + Intergenic
1176469549 21:7095076-7095098 GATAGGAACTACAGGGACTCTGG - Intergenic
1176493110 21:7476854-7476876 GATAGGAACTACAGGGACTCTGG - Intergenic
1176507532 21:7661529-7661551 GATAGGAACTACAGGGACTCTGG + Intergenic
1178448462 21:32667769-32667791 GAGATCAACTATAGGGACACAGG - Intronic
1182012464 22:27012106-27012128 GAGAGGAACTAGGGGGACACTGG + Intergenic
1182880593 22:33729703-33729725 AAGATCAACAACAGGAACACAGG + Intronic
1183315582 22:37135334-37135356 CTGATCAACTGCAGGAACACCGG - Exonic
950161952 3:10766894-10766916 CAGATAAACCACAGGGAAGCAGG - Intergenic
950764101 3:15260550-15260572 CAGATGGATGACAAGGACACAGG + Intronic
951650597 3:24947608-24947630 CAGATGACCTTCAGTGACAGTGG + Intergenic
952978955 3:38719856-38719878 CAGATGAAGGATAGGGGCACTGG - Intronic
954977567 3:54710963-54710985 CAGATGAATGACAGTGACACTGG - Intronic
955082674 3:55672573-55672595 CAGATGAAAATCAGGGACACAGG + Intronic
956045406 3:65190741-65190763 CAGATGAGCTACATGCACAGTGG - Intergenic
956476039 3:69621381-69621403 CAGATGAACTACTGAGACACAGG + Intergenic
958448728 3:94246845-94246867 CAGATGTACAAAAGTGACACTGG - Intergenic
959183893 3:103018909-103018931 CAGATGAGGAACAGGGACACTGG + Intergenic
960428639 3:117541405-117541427 CAGATGAATTACAGTGAAAAAGG + Intergenic
961064395 3:123862244-123862266 CAGATGAACTACAGGGACACAGG - Intronic
961696959 3:128712030-128712052 CAGAGGAACTAGAGGCACAAAGG + Intergenic
962050956 3:131814945-131814967 GAGATGATCTGCAGGGCCACAGG + Intronic
963409239 3:144907554-144907576 TAGATGTCCTACAGGGTCACAGG - Intergenic
964948181 3:162251571-162251593 CAGATGAACTACAGCTTCACAGG + Intergenic
966358242 3:179104889-179104911 CAGATGAAGTACAGGAATTCAGG + Intergenic
967684033 3:192398947-192398969 CTGAAGAACTGCAGTGACACAGG + Intronic
970454950 4:16214320-16214342 TGGATGAACTACATGGATACTGG + Intronic
972133329 4:35862889-35862911 TAGATGTCCTACAGGGACAAAGG - Intergenic
974010905 4:56606522-56606544 CAGAACAGCTCCAGGGACACAGG - Intergenic
976748961 4:88434506-88434528 GAAATGAACTAAAGAGACACAGG + Intronic
976748969 4:88434553-88434575 GAAATGAACTAAAGAGACACAGG + Intronic
982176010 4:152706253-152706275 CAGATGGACTACAAGGATGCAGG + Intronic
982260509 4:153490093-153490115 CAGCTGAAATACACGGACGCAGG - Intronic
986215735 5:5717173-5717195 CAGATAGACTGCAGGAACACAGG - Intergenic
986734248 5:10656448-10656470 CAGATGAACTAAAGGGACACTGG + Intergenic
990813107 5:59751019-59751041 CAGAAGAACAATAGGTACACAGG + Intronic
993731865 5:91432129-91432151 AAGATGTTCTGCAGGGACACTGG + Intergenic
995857012 5:116603954-116603976 CAGATGAAGTCCAAGGAGACTGG - Intergenic
999144246 5:149381963-149381985 CAGATGAGCTACAGGGGAAGGGG + Intronic
999157909 5:149471745-149471767 CAGAAGAAATACAGGGACACAGG - Intergenic
1004478450 6:15996469-15996491 CTGGTGAACAAGAGGGACACAGG - Intergenic
1006145923 6:31959547-31959569 CACATGTACTGCAGGTACACTGG - Intronic
1007622561 6:43223912-43223934 CAGATGGTCTCCAGGGATACGGG - Intronic
1009318394 6:62253720-62253742 AATATGGACTCCAGGGACACAGG - Intronic
1014299841 6:119667539-119667561 CTGAAGAAGTACAGGGACCCAGG - Intergenic
1014965401 6:127741936-127741958 CACATGAAATACAGGGAGAGTGG + Intronic
1016107468 6:140180228-140180250 CAGATGAGGTACTGGAACACAGG + Intergenic
1017298877 6:152833812-152833834 TAGCTGAACTACAAGTACACAGG - Intergenic
1018071770 6:160170926-160170948 TAGATGAACCCCAGGGACCCTGG - Intergenic
1027393515 7:77728861-77728883 CAGATAATCTCCAGGGTCACAGG - Intronic
1028542960 7:91964659-91964681 CAGATGAACTAAAAGAAAACTGG - Intronic
1030781292 7:113603512-113603534 GAGTTGAACAACAAGGACACAGG + Intergenic
1031059722 7:117037204-117037226 CATATGAAATACAAGGTCACAGG - Intronic
1032682560 7:134200588-134200610 TAGATGAACTAGATGGACAGGGG + Intronic
1032719127 7:134536594-134536616 TAGAGGGACTACAGGGACCCTGG - Intronic
1032724097 7:134575364-134575386 TAGAGGGACTACAGGGACCCTGG - Intronic
1032800626 7:135314768-135314790 GAAATGAACAGCAGGGACACAGG + Intergenic
1033877265 7:145837836-145837858 CACATGGACCACATGGACACAGG + Intergenic
1033955258 7:146839842-146839864 CGGATGCTCTACAGCGACACAGG + Exonic
1034514170 7:151561072-151561094 CTGGTGAAAAACAGGGACACAGG + Intronic
1034896556 7:154879936-154879958 CAGATGAACAAGAGGAAAACCGG - Intronic
1039115474 8:34087573-34087595 CAGGTTAACTACAGGGAGAAAGG - Intergenic
1041796174 8:61751289-61751311 CAGATAAAATACAGGGTCCCTGG + Intergenic
1044207301 8:89505523-89505545 CAGATAAACTAAAAGTACACAGG + Intergenic
1044819212 8:96144693-96144715 CTGATGAACTCCATGGACCCCGG - Exonic
1049213331 8:141396613-141396635 CAGCTGCACCACAGGCACACGGG + Intronic
1057976444 9:99610458-99610480 CAAATGCACTAAAGGGTCACAGG - Intergenic
1058247260 9:102642850-102642872 CATATGAAGCACAGGCACACAGG + Intergenic
1060644794 9:125268759-125268781 CAGATGAACTACTTGAACTCAGG - Intronic
1060904347 9:127291517-127291539 CAGAGGAAGTACTGGGACTCGGG - Intronic
1061785854 9:133027848-133027870 CAGACAAACTAGAGGGTCACTGG + Intergenic
1203425751 Un_GL000195v1:35052-35074 GATAGGAACTACAGGGACTCTGG + Intergenic
1185745731 X:2572058-2572080 CCCATGATCTCCAGGGACACCGG + Intergenic
1186194995 X:7100996-7101018 CAGATGATGTGCAGGGACAGTGG - Intronic
1187020285 X:15374384-15374406 GGAATGAACTACTGGGACACTGG + Intronic
1187219311 X:17308257-17308279 CAAATGAAATACAGGGATAGAGG - Intergenic
1188838720 X:34989249-34989271 CAGATGGACTAGAGGGAGAAAGG + Intergenic
1190873895 X:54446259-54446281 CAGAGGAACTACAGCGACGCTGG - Exonic
1198908550 X:141589138-141589160 AACTTGAACTACACGGACACTGG + Intronic
1200372228 X:155739344-155739366 CAGCTGAACTGCAGAGACAGTGG - Intergenic
1201782622 Y:17740253-17740275 GAGATGAGCTCCAGGGACAATGG + Intergenic
1201818931 Y:18165735-18165757 GAGATGAGCTCCAGGGACAATGG - Intergenic
1202173961 Y:22080425-22080447 AAGATGAGCTCCAGGGACAATGG + Intronic
1202190120 Y:22233460-22233482 CAGATGACTTACAAGGACAATGG + Intergenic
1202217399 Y:22505957-22505979 AAGATGAGCTCCAGGGACAATGG - Intronic
1202325787 Y:23690102-23690124 AAGATGAGCTCCAGGGACAATGG + Intergenic
1202544984 Y:25979952-25979974 AAGATGAGCTCCAGGGACAATGG - Intergenic