ID: 961065593

View in Genome Browser
Species Human (GRCh38)
Location 3:123872723-123872745
Sequence CTGAGATGCTGGCAAGGTGC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 317
Summary {0: 1, 1: 0, 2: 0, 3: 27, 4: 289}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961065593_961065597 21 Left 961065593 3:123872723-123872745 CCAGCACCTTGCCAGCATCTCAG 0: 1
1: 0
2: 0
3: 27
4: 289
Right 961065597 3:123872767-123872789 CTCTCCAAACCCCTTTGATTAGG 0: 1
1: 1
2: 7
3: 41
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961065593 Original CRISPR CTGAGATGCTGGCAAGGTGC TGG (reversed) Intronic
900304344 1:1996629-1996651 CTGAAATACTGGCCGGGTGCGGG + Intronic
900627803 1:3617273-3617295 CTGAGCTGCTAGCATGGTGGCGG - Intergenic
900891957 1:5456006-5456028 CTGTGAAGCTGGAAGGGTGCAGG - Intergenic
902626636 1:17680307-17680329 CTGAGATGTCGCCAAGGGGCCGG - Intronic
903220556 1:21867004-21867026 CTGACTTTCTGGCAAGTTGCAGG + Intronic
904013527 1:27403852-27403874 CTGAGAGGCAGACAAGATGCCGG + Intergenic
904015951 1:27420830-27420852 CTGAGCTTCTTGCAAGGTGAAGG + Intronic
904313749 1:29646492-29646514 CTGAGCTTCTGGAAAGGAGCAGG - Intergenic
904631848 1:31848445-31848467 CTGAGATGCTGGAGTGGGGCTGG - Intergenic
904933596 1:34110193-34110215 AACAGATGCTGGCAAGGTGGTGG + Intronic
904938010 1:34145474-34145496 GGGAGATGCTGCCAAGGGGCAGG - Intronic
907712615 1:56898286-56898308 CAGAGAGGATGGCAAGCTGCAGG + Intronic
909490672 1:76222899-76222921 CTCAGATGCTGGCAAGGTTGTGG + Intronic
909904195 1:81175681-81175703 CTGAGATGCTGTCCTGGAGCTGG - Intergenic
913009642 1:114670234-114670256 CCGAGGTCCTGGCAAGGTTCTGG - Intronic
916928923 1:169553797-169553819 AAGAGATGCTGGCAAGGTCATGG + Intronic
916998052 1:170322828-170322850 AATAGATGCTGGCAAGGTGATGG - Intergenic
917805337 1:178608009-178608031 CTGAAATGGTGGCAAGATACCGG + Intergenic
921087595 1:211810525-211810547 GTGAGATGCTGGCATGATGATGG - Intronic
921794927 1:219331866-219331888 CTCACATGATAGCAAGGTGCAGG - Intergenic
922972700 1:229756474-229756496 CTCAGCTGCTGGTAAGTTGCAGG + Intergenic
924337558 1:242998942-242998964 CTGAGAAGGTGGGAATGTGCCGG + Intergenic
924632221 1:245751901-245751923 CTGGGCTGCTTGCAAGGTGGGGG - Intronic
1063433030 10:6007720-6007742 CTGATGTGGTGGTAAGGTGCAGG + Intergenic
1064276778 10:13913642-13913664 CTGAGGTCCTGGCATGTTGCAGG - Intronic
1065798344 10:29328037-29328059 CAGAAATGCTGGCATGGAGCAGG - Intergenic
1066679374 10:37922175-37922197 CTAACATGCTGGCAAGGTTGTGG + Intergenic
1067161365 10:43827530-43827552 CTGAGATGATGGAAAAGTTCTGG - Intergenic
1069600884 10:69706969-69706991 CTGAGATGCCTGCAATTTGCAGG - Intergenic
1069842834 10:71350612-71350634 CTCATATGCAGGCATGGTGCTGG + Intronic
1069857678 10:71450704-71450726 CAGAGAGGCTGGGAAGGGGCGGG - Intronic
1071202004 10:83229664-83229686 CTGAGATGCTGACAATATTCAGG - Intergenic
1072824054 10:98588281-98588303 CTGTGATGCAGGCAATGTCCTGG - Intronic
1074126213 10:110530590-110530612 CTGAGATCCTGGGCAGGTCCAGG - Intergenic
1074186521 10:111103274-111103296 CAGAAAAGCTGGAAAGGTGCAGG - Intergenic
1074777287 10:116775648-116775670 CTCGGATGCTGGGAAGGTGCTGG + Intergenic
1076079098 10:127561842-127561864 GTGATATGCTGGCAGGGTGTTGG - Intergenic
1076398503 10:130160244-130160266 CTAAGATGCTGGCAAGCAGCTGG - Intronic
1076425293 10:130363231-130363253 CTGGGAGGCTGCCATGGTGCTGG - Intergenic
1077079334 11:717479-717501 CAGAGAGGCTGGGCAGGTGCTGG + Intronic
1077123450 11:921707-921729 CTGAGAGCCTGTGAAGGTGCTGG + Intergenic
1077162949 11:1121877-1121899 CAGTGATGCTGGCAAGGCCCAGG - Intergenic
1077456776 11:2686092-2686114 CTGAGTTGATGGCAAAGTGTAGG + Intronic
1077791311 11:5443261-5443283 ATTAGATGGTGACAAGGTGCTGG + Intronic
1078550222 11:12275111-12275133 CAAAGATGCTGGCGAGGTGTTGG + Intergenic
1079880029 11:25915560-25915582 CTGACATGCTGGCAAGTTGATGG + Intergenic
1080087121 11:28296906-28296928 CAACGATGCTGGCAAGCTGCTGG - Exonic
1081211900 11:40346048-40346070 CACAGATGCTGGCAAGGTTGTGG + Intronic
1081533184 11:43978503-43978525 CTGTGATCCTGGCAAGGTACAGG + Intergenic
1081775051 11:45670959-45670981 CTCAGAATGTGGCAAGGTGCAGG + Intergenic
1081833527 11:46134992-46135014 CTGTGATGCTTGCAAGCTGAGGG - Intergenic
1083259617 11:61516085-61516107 CTGGGATGGTGGCAAGGCTCCGG + Intronic
1083336651 11:61925745-61925767 CTGAGCTCCTGGCAAAGTGAAGG - Intergenic
1083505191 11:63150105-63150127 CTGAGAACCTGGGAAGCTGCTGG - Intronic
1083987643 11:66226782-66226804 CTTAGATGCAGGGAAGGTACTGG - Intronic
1087294123 11:96350015-96350037 AACAGATGCTGGCAAGGTGGTGG + Intergenic
1088835895 11:113577813-113577835 CTGACATGCTGAAAAGGTGAGGG + Intergenic
1090425905 11:126606908-126606930 CTCAGATGATGGGAAGGGGCGGG + Intronic
1090776328 11:129969005-129969027 CCAGGAGGCTGGCAAGGTGCTGG + Intronic
1091107849 11:132939559-132939581 GTGAGATGGAGGCAAGGTGGTGG - Intronic
1093931556 12:24959719-24959741 CTAAGATAATGGCAAGGTTCTGG - Intergenic
1095734979 12:45546934-45546956 CTGAGCTGCTACCAAGATGCTGG + Intergenic
1096185927 12:49580571-49580593 GTGAGTTCCTGGGAAGGTGCAGG - Intronic
1097885309 12:64722945-64722967 CTGACAACATGGCAAGGTGCTGG - Intronic
1098868530 12:75789070-75789092 AAGAGATGCTGGCAAGGTTGTGG - Intergenic
1099370070 12:81818042-81818064 ATCAGATGCTGGCAAGGTTGTGG + Intergenic
1100610123 12:96184922-96184944 CTGACATGCTGAGAAGGTCCTGG - Intergenic
1102421856 12:112809587-112809609 CAGAGCTCCTGGCATGGTGCTGG - Intronic
1104056360 12:125233873-125233895 CGTAGATCCTGGCATGGTGCTGG + Intronic
1104658816 12:130593957-130593979 CTGAGATGCTGGTGTGGAGCTGG - Intronic
1104879774 12:132062501-132062523 CTGAGAAGCTGGAAATGTGCAGG - Exonic
1105310098 13:19198900-19198922 CTTAGATGTTGGGAAGGTGAAGG + Intergenic
1106224375 13:27774003-27774025 CTGAGGTGCTGGAAGGGAGCAGG + Intergenic
1106364505 13:29065271-29065293 AAGAGATGCTGGCAAGGTTGTGG - Intronic
1106482688 13:30148616-30148638 CTGAGATGCTGTCAGGGTGGAGG + Intergenic
1108225551 13:48285467-48285489 CTGAGAGGTTGGCAAGGTCAAGG - Intergenic
1109105569 13:58245851-58245873 CACAGATGCTGGCAAGGTTGAGG + Intergenic
1109213044 13:59556909-59556931 AAGAGATGCTGGCAAGGTTGTGG + Intergenic
1109715773 13:66220187-66220209 CTGAGGTGCTGGCCAGCTGCCGG - Intergenic
1110474270 13:75895251-75895273 CTGACATGCTGGCTGGTTGCTGG - Intergenic
1111725320 13:92000716-92000738 CTCAGATGCTGGCAGGTAGCAGG + Intronic
1113599276 13:111556936-111556958 CTGTGATGCTCGCATGGTGACGG + Intergenic
1113975401 13:114224417-114224439 CTGAGATGCCGGCATCGGGCCGG + Intergenic
1114273022 14:21115750-21115772 ATAAGATGCTGACCAGGTGCAGG + Intergenic
1114532543 14:23404755-23404777 CTGCAATGCTGGCAAAGTACTGG + Exonic
1115163882 14:30426270-30426292 CTGAGGAGGTGGCATGGTGCGGG + Intergenic
1116423566 14:44762467-44762489 CTTAGTTGCTTGCAAGGTCCTGG - Intergenic
1117080532 14:52147548-52147570 CACAGATGCTGGCAAGGTTGTGG + Intergenic
1118720475 14:68590408-68590430 CTGCCATGCTGGCAAGCTGGGGG - Intronic
1120301388 14:82711834-82711856 CTGAAATGCTGGCAAAATGAAGG - Intergenic
1121407377 14:93727472-93727494 CTGAGATGCCAGAATGGTGCTGG + Intronic
1121840241 14:97127959-97127981 ATGAAATGCTGGGATGGTGCAGG + Intergenic
1122977546 14:105177119-105177141 CTGGGCTGCTGGCAAGGAGGTGG - Intronic
1122987062 14:105217365-105217387 TTGAGACACTGTCAAGGTGCCGG + Intronic
1130096568 15:80860713-80860735 CTGGGGTGCAGGCAAGGTGGGGG - Intronic
1130375006 15:83321421-83321443 CTGGCATGCTGGCAAGGCCCTGG + Intergenic
1131220973 15:90583767-90583789 CAGAGAGGCTGGCTGGGTGCTGG + Intronic
1131704985 15:94984036-94984058 CATAGATGCTGGCAAGGTTGTGG + Intergenic
1132079345 15:98851525-98851547 CTGAGATTCTGGCAAGGCCCCGG - Intronic
1132826455 16:1907822-1907844 GTGAGAGGCGGGCAAGCTGCTGG + Intergenic
1133280734 16:4663791-4663813 CTGAGAGGATGGCACTGTGCTGG + Intronic
1137441692 16:48503803-48503825 CTGAGAGGCTGGCAGGGGGATGG + Intergenic
1137477196 16:48818992-48819014 CTCAAATGCTTGCAAGGTCCAGG + Intergenic
1137594274 16:49713548-49713570 CTGAGAACCTGCCAGGGTGCGGG - Intronic
1137679916 16:50332492-50332514 AAGAGATGCTGGCAAGGTTGTGG + Intronic
1138659357 16:58508479-58508501 CAGAGCTGCTGGGAAGCTGCAGG + Intronic
1139322353 16:66125758-66125780 CTGAGATGGTGGCTAGGAGAGGG + Intergenic
1139778963 16:69335051-69335073 CTGAGAAGATGGCACGGTACTGG + Exonic
1139968189 16:70757139-70757161 CTGAGATGCTGGGAAGACTCTGG + Intronic
1141422068 16:83923939-83923961 CTGACATTCTGGCAAGGGGGCGG + Exonic
1146020718 17:29276351-29276373 CTAAGATGGGGGCAAGGTGAGGG - Intronic
1146288879 17:31594155-31594177 CTTAGATCCTGGCCTGGTGCTGG - Intergenic
1146561046 17:33870987-33871009 CTGAGATGCTGGCATGAAGCTGG + Intronic
1146622525 17:34410406-34410428 ATAAGATGCTGGCAAGGTTGTGG + Intergenic
1146930666 17:36775437-36775459 AAGAGATGCTGGCAAGGTTGTGG + Intergenic
1147254504 17:39174083-39174105 CTGGGATGCTGGGGAGGGGCAGG + Exonic
1147378193 17:40035455-40035477 CTGAGAAGCTAGCAAAGTCCTGG + Intronic
1147565780 17:41535820-41535842 CAGAGATGCTGGCCAAGTCCTGG + Intergenic
1148237233 17:45976953-45976975 CTGAGTTTCTGACAAGGTGATGG - Intronic
1149299841 17:55295015-55295037 CTGAGGGCCTAGCAAGGTGCTGG + Intronic
1151550639 17:74820672-74820694 CTGAGAGGCAGGCAAGCTCCTGG - Intronic
1151976032 17:77483931-77483953 CAGAGGTGCAGGCAAGGTGGAGG + Intronic
1152267485 17:79304797-79304819 CTAAGATTCTCGGAAGGTGCTGG + Intronic
1152295496 17:79464819-79464841 CTCAGATGCCAGCAACGTGCTGG + Intronic
1153953978 18:10080603-10080625 CTGTGATGCGGGCAACCTGCAGG - Intergenic
1156368932 18:36455254-36455276 CTGGGCTTCTGGCAAGATGCTGG + Intronic
1157700883 18:49761110-49761132 CTGAGGTGCTGCCTAGGGGCAGG + Intergenic
1159548315 18:69869003-69869025 ATTAGATGCTGGCAAGGTTGTGG + Intronic
1159667536 18:71180223-71180245 CTGAGATAGAGCCAAGGTGCAGG + Intergenic
1160845772 19:1165374-1165396 CTGAGATGCGAGCAGGGTGCCGG + Intronic
1161488431 19:4548318-4548340 CTGAGGTGCTGGCATTGGGCCGG + Exonic
1161505543 19:4641461-4641483 GGGAGATGCTGGGAAGGGGCAGG - Intronic
1162391962 19:10395349-10395371 GGAAGATGCTGGCAAGGTGCTGG + Intronic
1162490489 19:10988354-10988376 CTCAGATGCTCCCAAAGTGCTGG + Intronic
1163209262 19:15828623-15828645 CTGAGATGCCCACAAGCTGCCGG - Intergenic
1163369072 19:16892085-16892107 CAGAGATGCTGGCAGGGCCCAGG - Exonic
1163980843 19:20898535-20898557 CTGAGTGGCTGGCAAGGAACAGG - Intergenic
1165794539 19:38511339-38511361 CTGGGATGCTGGGGAGGTGAGGG - Intronic
1166944785 19:46390188-46390210 CTGAGACCCTGGTAAGGGGCAGG + Intronic
1168570128 19:57459864-57459886 AACAGATGCTGGCAAGGTGGTGG - Intronic
1168639226 19:58019765-58019787 CTGGGGTCCTGGCAAGGCGCAGG + Intergenic
925034350 2:674333-674355 GTGAGATGCTGGCAGAGGGCAGG - Intronic
925599867 2:5597305-5597327 GTGAGCTGCTGGAGAGGTGCAGG + Intergenic
925906999 2:8545581-8545603 CTGAGAGGCTGACAGGGTGGTGG - Intergenic
926620567 2:15043318-15043340 CTGAGATCCTTGGAAGGTGGAGG - Intergenic
927078629 2:19605106-19605128 AACAGATGCTGGCAAGGTGGTGG - Intergenic
927144925 2:20157295-20157317 CTGAGAGGTTGGCAGGGTGAGGG + Intergenic
929460810 2:42101220-42101242 CCCAGATGCTGGCAAAGTGGCGG + Intergenic
930571204 2:53089071-53089093 ATCAGATGCTGGCAAGGTTGTGG - Intergenic
931933334 2:67166403-67166425 AAGAGATGCTGGCAAGGTTGTGG + Intergenic
932334405 2:70921733-70921755 CTGAGATGAAGGGAAGGTGATGG - Intronic
932409195 2:71535167-71535189 CTGGGATACTGGCAGGATGCTGG - Intronic
932904861 2:75738697-75738719 CTGAGGAGCTGGCAAGGCCCCGG + Intergenic
932941896 2:76176803-76176825 ATCAGATGCTGGGAAGGGGCAGG - Intergenic
933134755 2:78719348-78719370 CTGAGAAGCAGGAAAGGTGATGG + Intergenic
935211294 2:100941125-100941147 CTGAGATGTTGGCAGTGTGAAGG - Intronic
935502317 2:103856643-103856665 CTTAGGTTCTGGCCAGGTGCTGG + Intergenic
935545260 2:104394518-104394540 CTGAGAGCCTGGCTTGGTGCTGG - Intergenic
936565996 2:113583387-113583409 CTGGGGTGATGGAAAGGTGCTGG - Intergenic
937094261 2:119225239-119225261 CAGAGGGGCTGGCAAGGAGCAGG + Intronic
937108306 2:119340025-119340047 TAGAGATGCAGGCTAGGTGCTGG - Intronic
937362286 2:121237623-121237645 CTGAGAAGCTGGCAAAGAGCCGG + Exonic
937896420 2:126979767-126979789 CTGTGAGGCTGCCAAGTTGCAGG + Intergenic
938903382 2:135817364-135817386 CAGAGATGCCGGGAGGGTGCTGG + Exonic
940368181 2:152871994-152872016 CTGAGATTCTGGCAAAGAGCTGG - Intergenic
940812563 2:158261863-158261885 AAGAGATGCTGGCAAGGTTGTGG + Intronic
941481850 2:166025189-166025211 TTGAGATGATGTCAAGGTGTTGG + Intronic
942486731 2:176447614-176447636 CTTACATGCTTACAAGGTGCAGG - Intergenic
943256225 2:185596652-185596674 AATAGATGCTGGCAAGGTTCTGG + Intergenic
943383707 2:187178154-187178176 CTCAGATGCTGCCACGGGGCTGG - Intergenic
944167366 2:196737285-196737307 AACAGATGCTGGCAAGGTGGTGG - Intronic
944342337 2:198616882-198616904 ATTAGATGCTGGCAAGGTTGTGG + Intergenic
948337944 2:237225453-237225475 CTGGGTTCCTGCCAAGGTGCTGG + Intergenic
948705582 2:239790273-239790295 ATAAGATGCTGGCAGGGTGCTGG - Intronic
948931468 2:241135013-241135035 CTGAGCTCCTGGTAAGGAGCAGG - Intronic
1169202100 20:3716371-3716393 CAGAGATACTGGCAAGGAGGTGG - Intergenic
1169878953 20:10326603-10326625 CTGAGCTCTGGGCAAGGTGCTGG + Intergenic
1171405179 20:24907841-24907863 CACAGATGCTGGCAAGGTTGTGG + Intergenic
1172027150 20:31956439-31956461 CTCATATGCTGGGAAGCTGCTGG + Intergenic
1172135767 20:32685688-32685710 CTGAGATGCTGGGAATATGTCGG - Intergenic
1172184807 20:33024738-33024760 CTGAGAGAGTGGCAAGGGGCAGG + Intergenic
1173871268 20:46343621-46343643 ATGACAAGCTGCCAAGGTGCAGG + Intergenic
1175069750 20:56323438-56323460 CTGATATTCTGTCAAGGAGCAGG - Intergenic
1175468453 20:59208779-59208801 CTGAGACGCTGGCAGAGAGCTGG + Intronic
1176017864 20:62945886-62945908 ATGAGATGCTGCCGAGATGCTGG - Exonic
1177894318 21:26843113-26843135 CTGGGCTGCTGCCAAGGGGCCGG + Intronic
1179073742 21:38098569-38098591 CTGATGTGATGGTAAGGTGCAGG + Intronic
1179915675 21:44476654-44476676 CAGAGATGAAGGCAAGGTGAGGG + Intergenic
1180257935 21:46646145-46646167 CTGACATGCTGGCAGTGTTCTGG + Intronic
1180955790 22:19740649-19740671 CAGAGCTGCTGGCAGGGTGGGGG + Intergenic
1181025164 22:20123632-20123654 CTGAGAAGGTGGCCAGGTCCTGG + Intronic
1181160266 22:20956086-20956108 TTGAGATGCTGGCCAGGTGGTGG - Intergenic
1182627270 22:31656704-31656726 CTGAGAGGCTGACAAGATGTGGG - Intronic
1183352531 22:37342272-37342294 CTGAAATGCTGGGGAGGAGCTGG - Intergenic
1183475834 22:38035306-38035328 CTGAGAATCAGGCAAGGTGAGGG - Intronic
1184123883 22:42472961-42472983 CTGAGATGCTGCTAGGGTGCGGG - Intergenic
949147247 3:717279-717301 CTGGGATGCTGGAAAACTGCAGG + Intergenic
950211607 3:11127304-11127326 GTGAGATGGTGGGGAGGTGCTGG + Intergenic
951310219 3:21116631-21116653 CAGAGATGCTGTCTAGGTGCTGG + Intergenic
952223563 3:31350503-31350525 CTGAGAGACAGGCAAGCTGCTGG + Intergenic
954519793 3:51214757-51214779 CTGAGAAGCTGGCCAGGTAGTGG - Intronic
958178238 3:90023821-90023843 CAGAGATGTTGGCAGGGTTCAGG - Intergenic
960871932 3:122258854-122258876 CTGAGATGCAGCCTAGGTGTCGG + Intronic
961008029 3:123417889-123417911 CTGGGATGCCTGCAATGTGCTGG + Intronic
961065593 3:123872723-123872745 CTGAGATGCTGGCAAGGTGCTGG - Intronic
963582986 3:147150257-147150279 AACAGATGCTGGCAAGGTGGTGG + Intergenic
963864106 3:150341836-150341858 CTGCAATGCTGGCAAAGTGTAGG - Intergenic
965071749 3:163923876-163923898 CAGAGATGCAGGCAAGGTTAGGG - Intergenic
966111585 3:176408832-176408854 CTGAGATGCTGGCTATGGGGGGG + Intergenic
966155102 3:176907641-176907663 AATAGATGCTGGCAAGGTGGTGG - Intergenic
974242915 4:59274510-59274532 CTGAGAAGCTGGCATGATGTTGG - Intergenic
974535133 4:63164689-63164711 AAGAGATGCTGGCAAGGTTGTGG - Intergenic
975107133 4:70580369-70580391 AAGAGATGCTGGCAAGGTTTTGG + Intergenic
975989594 4:80243750-80243772 GGGAGATGTTGGCAAGGTACCGG - Intergenic
977896533 4:102371867-102371889 AACAGATGCTGGCAAGGCGCTGG - Intronic
980197718 4:129613082-129613104 ATCAGATGCTGGCAAGGTTGTGG + Intergenic
981071653 4:140546776-140546798 CCGAGATGGTGTCAGGGTGCTGG - Intronic
982333629 4:154209784-154209806 CTTAGATGCTGGCACTGTGCTGG - Intergenic
982345898 4:154357993-154358015 CTGAGTAGCTGGTAAGGTGCTGG + Intronic
983447321 4:167869814-167869836 CTGTGATCCTTGCAAAGTGCTGG + Intergenic
984940178 4:184924444-184924466 CAGAGATGCTTGCAAGGGGCTGG + Intergenic
985921894 5:2984028-2984050 CTGTGATGCTGGCATTCTGCAGG + Intergenic
986272068 5:6241982-6242004 AAGAGATGCTGGCAAGGTTGAGG + Intergenic
986300680 5:6476244-6476266 CTGAGGTGCTGCTGAGGTGCAGG - Intronic
986321512 5:6635596-6635618 CTAAAATGCTTGCATGGTGCTGG + Intronic
988599557 5:32626954-32626976 CCGAGGTGATGGGAAGGTGCGGG + Intergenic
988786617 5:34571043-34571065 CTTAGATGTTGCCAAGGGGCAGG - Intergenic
989545740 5:42671198-42671220 CCCAGAAGCTGGCCAGGTGCTGG - Intronic
991142142 5:63257191-63257213 CTGAGATGCAGGAAATGTCCTGG + Intergenic
991194250 5:63913360-63913382 ATAAGATGCTGGCAAGGTTGTGG - Intergenic
992046316 5:72893885-72893907 CTGAGATGATGGCAAGCTCAAGG - Intronic
992734611 5:79706137-79706159 CTGCGATGCTGCCAATGTGCTGG + Intronic
992810481 5:80382813-80382835 TTGAGATGTTGGCAAGGTTGCGG - Intergenic
999261918 5:150243699-150243721 CTGAGAGCTTAGCAAGGTGCTGG - Intronic
1002448139 5:179302545-179302567 CGGTGCTGCTGGCAAGGTGGAGG - Intronic
1002696617 5:181096446-181096468 CTGCAATGCTTGCAAAGTGCAGG - Intergenic
1002698005 5:181102927-181102949 CTGCAATGCTTGCAAAGTGCAGG + Intergenic
1002782571 6:378875-378897 CTGAGATGCAGCCAGGGAGCAGG + Intergenic
1002935978 6:1672842-1672864 CTGAGATGCTAGTCAGATGCTGG + Intronic
1006031167 6:31177672-31177694 CCGGGATGGTGACAAGGTGCTGG + Intronic
1006297450 6:33176224-33176246 CTGAGGTGCTGGGAAGCTGGGGG + Intronic
1006452835 6:34114987-34115009 CTGAGATGCTGGCAACCTGGAGG - Intronic
1007461766 6:42024498-42024520 CTGAGATCCTCACAAGATGCAGG - Intronic
1007482925 6:42162036-42162058 CTGAAATGCTGGGTAGGTGGAGG + Intronic
1008023839 6:46611120-46611142 CTGAGATGCTTGGAAGAAGCTGG - Intronic
1008285979 6:49651054-49651076 CTGATATTCTGTCAAGGTGGGGG + Intergenic
1008637050 6:53420912-53420934 TTGAGATGATGGAAATGTGCAGG - Intergenic
1009355653 6:62740649-62740671 GGGCGATGCTGGCAAGGGGCAGG - Intergenic
1012054194 6:94384241-94384263 CTGAGAACCTGGAGAGGTGCTGG - Intergenic
1012744855 6:103073154-103073176 CTGAGATGCTGTCAAATTGGGGG + Intergenic
1013459874 6:110364740-110364762 CTGAGATGAGTGGAAGGTGCAGG - Intergenic
1015555786 6:134459946-134459968 CTGAGATGGTGGCATGCTGGGGG - Intergenic
1015707295 6:136102029-136102051 TGGAGATGCTGGCCACGTGCAGG + Intronic
1016523946 6:144978015-144978037 AAGAGATGCTGGCAAGGTTGTGG + Intergenic
1018653397 6:166009891-166009913 CTGATTTGCTGGCGAGCTGCTGG + Intergenic
1019478733 7:1256371-1256393 CAGAAGTGCTGGCAAGGTACGGG - Intergenic
1020404962 7:7822526-7822548 CTGATATGCATGCAAGGTGGAGG + Intronic
1021168714 7:17372221-17372243 CTGGGCTACTGTCAAGGTGCTGG + Intergenic
1021895211 7:25227483-25227505 CAGAGATGCTGGCCAGGTTTTGG + Intronic
1022685686 7:32594097-32594119 CTGAGATGCAGGGGAGGAGCAGG + Intergenic
1023689317 7:42769956-42769978 CTGAGATGCTTGGAAGGAGAAGG - Intergenic
1024004726 7:45216983-45217005 GTGAGATGCTGGCCAGATGCTGG - Intergenic
1025121353 7:56306667-56306689 CTGAAATGCTGTCAAGTTTCAGG + Intergenic
1026482150 7:70788789-70788811 CTGCCATGCTGGCTTGGTGCTGG - Intronic
1027822508 7:83064959-83064981 CTGAGATGCTGGAAAGGGCAAGG - Intronic
1029324874 7:99797178-99797200 CTGAATTGCTGGCAAGATGGCGG - Intergenic
1033370665 7:140704537-140704559 CTGACATCCTGGCAAAGTCCTGG - Intronic
1035114270 7:156509734-156509756 TGGAGAAGGTGGCAAGGTGCGGG - Intergenic
1037023306 8:14000735-14000757 CATAGATGCTGGCAAGGTTATGG - Intergenic
1039401025 8:37269284-37269306 CTGAGATTCTGTCATGGGGCAGG + Intergenic
1040871863 8:52107977-52107999 CACAGAGGCTGGTAAGGTGCTGG + Intergenic
1042488753 8:69375874-69375896 CTGGCATGCTGCCAAGGTACTGG - Intergenic
1044238040 8:89854800-89854822 CTGAGAAGATGGCAAGGAGAGGG + Intergenic
1044567385 8:93679367-93679389 CTGAGATGCTGGCAAGTTTGTGG - Intergenic
1045403918 8:101846315-101846337 CTGAGATGTTGGCAAGATTGTGG - Intronic
1048158310 8:131985034-131985056 CTAACATGCTGGCAAAATGCAGG - Exonic
1048999118 8:139813559-139813581 CGGTGCTGCTGCCAAGGTGCTGG - Intronic
1049258256 8:141625249-141625271 CTGAGATGCTGGCTCAGAGCAGG + Intergenic
1049277057 8:141725208-141725230 CTTGGAGGCTGGCAAGGGGCAGG - Intergenic
1049379684 8:142305721-142305743 GGGATTTGCTGGCAAGGTGCTGG + Intronic
1049646470 8:143738055-143738077 CTGAGGTGCTGGCTCGATGCTGG + Intergenic
1050928110 9:11291373-11291395 ATAAGATGCTGGCAAGGTTGTGG - Intergenic
1051594420 9:18810012-18810034 CAGAGATGCTGGTGAGATGCAGG + Intronic
1052041971 9:23749025-23749047 CTGGGATGATGACAAGGTACTGG + Intronic
1053427200 9:38017933-38017955 TTCAGATGCTGGTCAGGTGCAGG + Intronic
1053449194 9:38179230-38179252 CTGAGATGATGGCAGTGTGGAGG + Intergenic
1055567580 9:77584578-77584600 CTCAGATGATGCCAAGGGGCAGG + Intronic
1056688451 9:88785715-88785737 CAGAAATGCTGGAAAGGTGGAGG + Intergenic
1056734054 9:89189994-89190016 CTACGCTGCTAGCAAGGTGCAGG - Intergenic
1056781629 9:89555168-89555190 CTGATAGCCTGCCAAGGTGCTGG + Intergenic
1058198988 9:102014943-102014965 CACAGATGCTGGCAAGATGTCGG + Intergenic
1058902648 9:109455858-109455880 CTCAGACTGTGGCAAGGTGCTGG - Intronic
1060665315 9:125429051-125429073 CTGAGATGGTGGCCAGCTGCTGG + Intergenic
1061193360 9:129094759-129094781 CTGAGAGGCAGGCAGGGTGGGGG - Intergenic
1061419259 9:130464379-130464401 CGGAGAGGCTGTCCAGGTGCTGG + Intronic
1061820794 9:133226308-133226330 CTGGGAGGCTGGAAGGGTGCAGG - Intergenic
1062190625 9:135246110-135246132 CTCAGGTCCTGGCAAGCTGCTGG + Intergenic
1062238483 9:135523758-135523780 CTGGGAGGCTGGGAGGGTGCAGG + Intronic
1062352471 9:136145832-136145854 CAGGGCAGCTGGCAAGGTGCAGG - Intergenic
1062401333 9:136373998-136374020 CTGAGATGCTGGCGAGGGCGAGG - Intergenic
1185929207 X:4183451-4183473 AAGAGATGCTGGCAAGGTTGTGG + Intergenic
1186091359 X:6052197-6052219 CAGAGATGCTATCAAGGTGTCGG - Intronic
1186455528 X:9707429-9707451 CTGTGCTGGTGGCAAGGTCCTGG - Intronic
1186679616 X:11858053-11858075 AACAGATGCTGGCAAGGTGGTGG + Intergenic
1186976383 X:14910720-14910742 ATGCGATGCTGGCAAGGAGGTGG - Intronic
1188353546 X:29161706-29161728 TTGAGATGCTGGCAAGGCTGTGG + Intronic
1190637711 X:52452513-52452535 CTGAGCAGCTGGCAAGTTTCAGG + Intergenic
1190639683 X:52471789-52471811 CTGAGCAGCTGGCAAGTTTCAGG + Intergenic
1190647938 X:52540511-52540533 CTGAGCAGCTGGCAAGTTTCAGG - Intergenic
1190652350 X:52579522-52579544 CTGAGCAGCTGGCAAGTTTCAGG - Intergenic
1190678934 X:52807947-52807969 CTGAGCAGCTGGCAAGTTTCAGG - Intergenic
1195548246 X:106137759-106137781 CTGAAATTCTGGCAAGGGCCGGG + Intergenic
1196198531 X:112860063-112860085 CTGAGATGCTGATGAAGTGCAGG + Intergenic
1198884228 X:141316233-141316255 AAGAGATGCTGGCGAGGTGGTGG - Intergenic
1199256343 X:145722668-145722690 AAGAGATGCTGGCAAGGTTGTGG + Intergenic
1199437698 X:147831637-147831659 CACAGATGCTGGCAAGGTTGTGG + Intergenic
1199666377 X:150099576-150099598 CTGAGATGCTTGCAAGGTCAGGG + Intergenic