ID: 961066665

View in Genome Browser
Species Human (GRCh38)
Location 3:123882471-123882493
Sequence TAACTGGCTAGCTGAGGAGG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 173
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 160}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961066665_961066669 1 Left 961066665 3:123882471-123882493 CCTCCTCCTCAGCTAGCCAGTTA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 961066669 3:123882495-123882517 TACACAAAAGAAACTGAACATGG 0: 1
1: 0
2: 2
3: 78
4: 669
961066665_961066670 2 Left 961066665 3:123882471-123882493 CCTCCTCCTCAGCTAGCCAGTTA 0: 1
1: 0
2: 0
3: 12
4: 160
Right 961066670 3:123882496-123882518 ACACAAAAGAAACTGAACATGGG 0: 1
1: 0
2: 4
3: 39
4: 549

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961066665 Original CRISPR TAACTGGCTAGCTGAGGAGG AGG (reversed) Intronic
901451063 1:9337411-9337433 TCACTGGCTAGGTGGGCAGGTGG - Intronic
903828301 1:26160547-26160569 AAACTGGCTTGGAGAGGAGGGGG - Intronic
904808785 1:33150094-33150116 TAACTGGCCAGAGGAGAAGGAGG + Intronic
905619275 1:39428194-39428216 CAACTGGCTGGCTGAGGTTGAGG + Exonic
906277058 1:44524255-44524277 TATCTGGCCAGCAGAGGCGGTGG - Intronic
906935380 1:50209902-50209924 CACCTGCCTGGCTGAGGAGGAGG + Intergenic
908669803 1:66533791-66533813 TAAGTGGCTCGCTGCGGAGGGGG - Intronic
910938219 1:92504561-92504583 TGACTGGTTTGCTGTGGAGGGGG + Intergenic
912247211 1:107971935-107971957 TAACTGGATGGATGAAGAGGTGG + Intergenic
912413176 1:109491543-109491565 CAACTGCCTCTCTGAGGAGGAGG + Exonic
912467500 1:109883989-109884011 TAACTGGCTGAATGTGGAGGAGG - Intergenic
912664788 1:111569289-111569311 TACCTGGGAAGCTGAGGCGGGGG + Intronic
913008849 1:114662848-114662870 TAACTGGGAGGCTGAGGTGGAGG + Intronic
913065291 1:115246970-115246992 TGAATGGCTAGGAGAGGAGGTGG + Intergenic
915351416 1:155228938-155228960 GAACTAGGTAGCTGGGGAGGTGG + Intergenic
918345388 1:183603174-183603196 CCACAGGCCAGCTGAGGAGGTGG - Intergenic
920034660 1:203058188-203058210 CAGCTAGCTGGCTGAGGAGGAGG + Intronic
923342729 1:233021576-233021598 TAACTAGCTTGCAGGGGAGGAGG + Intronic
923627335 1:235624804-235624826 TAACCAGTTAGCTGAGGAGCTGG - Intronic
924592625 1:245418104-245418126 CAACTGGAAAGCTGAGGATGTGG - Intronic
1067096474 10:43304732-43304754 GAGCTGGAGAGCTGAGGAGGCGG + Intergenic
1067751816 10:48976720-48976742 CAACTGGGTAGCTGAGCAAGTGG + Intronic
1069476838 10:68741762-68741784 GAACTGCATAGCTGAGGAGCAGG + Intronic
1073427847 10:103466872-103466894 AAACTGGTCAGCTGGGGAGGAGG - Intergenic
1075911502 10:126129072-126129094 TCACTTGCTAGATGAGGAAGTGG - Intronic
1077795422 11:5486436-5486458 TTACTGGAGACCTGAGGAGGAGG + Intronic
1078005258 11:7527659-7527681 GGCCTGGCTTGCTGAGGAGGTGG + Intronic
1083144781 11:60750117-60750139 TAGCTGGCTGGCTGGGGAGGAGG - Intergenic
1083618718 11:64038623-64038645 TGTCTGGCTGGCTGGGGAGGGGG - Intronic
1084726935 11:70947983-70948005 AGACTGGCTAGCTGCAGAGGTGG - Intronic
1084858808 11:72005119-72005141 TCACTGACTGGCCGAGGAGGGGG - Intronic
1084861525 11:72021711-72021733 TACTTGGGGAGCTGAGGAGGAGG - Intronic
1089054749 11:115576522-115576544 AAAAGGGCTGGCTGAGGAGGAGG - Intergenic
1089710459 11:120310855-120310877 TCACTGCCTAGCAGAGGAGCAGG + Intronic
1090479992 11:127059610-127059632 AAACTGGGTAGCTGAAGAGGGGG - Intergenic
1092203941 12:6604367-6604389 TATCTGTCTAGCTCAGGAAGTGG - Intronic
1092286200 12:7130449-7130471 AATCTGGGTAGCTGAGGCGGTGG - Exonic
1093200759 12:16183623-16183645 TCACTGGCTAGATAAGCAGGCGG - Intergenic
1093651481 12:21650788-21650810 TAACTGTATACCTGAGTAGGAGG - Intronic
1095102819 12:38201752-38201774 GAACTGGCCAGCTGGCGAGGCGG + Intergenic
1096726357 12:53566260-53566282 TAACTGGATTGCTCAGGAGAAGG + Intronic
1096865507 12:54560521-54560543 TGATTGGCCAGCTGAGGAGTTGG - Intronic
1100343509 12:93704247-93704269 TAACTGCCTAGTTGAAGAGCTGG - Intronic
1101315677 12:103626908-103626930 AATCTGGCTAGCTGGGAAGGAGG - Intronic
1102376034 12:112421735-112421757 TAACCGGAAAGCTGAGGAGGGGG - Intronic
1102998858 12:117369993-117370015 TAAGTGGGTAGATGAGTAGGAGG - Intronic
1103465354 12:121138163-121138185 TAACTGGCCAGTTGAAGAGATGG + Intronic
1103520562 12:121535036-121535058 TAATTGGCAAGCTGTGCAGGTGG - Intronic
1108518091 13:51221754-51221776 AAACTGGCAAGTTGAGGGGGTGG + Intergenic
1115104923 14:29749220-29749242 GAACTGGCTATCTGAAGAGTGGG - Intronic
1120080836 14:80214337-80214359 TAAATGGCAAGCTAAGGAGAGGG + Intronic
1125123431 15:36192056-36192078 ACACTGCCTAGCTGAGGAGAGGG - Intergenic
1127629241 15:60811161-60811183 TAATTGTCTAGCTCAGGAGAGGG + Intronic
1128427047 15:67552582-67552604 TAATTAGCTAGGTGTGGAGGTGG - Intronic
1133111562 16:3551009-3551031 TAAGTGGGTAGGTGAGTAGGTGG - Intronic
1136555535 16:31005660-31005682 TCACTGGACAGATGAGGAGGTGG + Intronic
1138821920 16:60270902-60270924 TTACTGCCTCACTGAGGAGGTGG - Intergenic
1140996555 16:80265495-80265517 TGAATGCCTAGCTGAGGAAGGGG + Intergenic
1142913504 17:3114658-3114680 TTACAGGGTAGCTGAGGATGGGG + Intergenic
1142949664 17:3467857-3467879 TAACAGGCAAGCACAGGAGGGGG - Intronic
1143404936 17:6671176-6671198 TAACTGGCCAGGTGTGGAGCTGG + Intergenic
1145298606 17:21613791-21613813 GCATTGGCGAGCTGAGGAGGTGG + Intergenic
1145351636 17:22089560-22089582 GCATTGGCAAGCTGAGGAGGTGG - Intergenic
1145403844 17:22569302-22569324 GCGCTGGCGAGCTGAGGAGGTGG - Intergenic
1145974919 17:28978382-28978404 TCACAGTCTAGCTGGGGAGGTGG + Intronic
1147731984 17:42609799-42609821 AACCTGGCTAGCTGAGGGGCCGG - Intronic
1147992582 17:44344113-44344135 TAACTGGCAGGTGGAGGAGGAGG - Intergenic
1147993787 17:44350567-44350589 TAACAGGGCAGGTGAGGAGGTGG + Exonic
1148816044 17:50329030-50329052 GAAGTGGCTGGCTGTGGAGGAGG - Intergenic
1149278101 17:55067860-55067882 TTACTGGTTAGGTAAGGAGGAGG + Intronic
1149615244 17:57991826-57991848 TAACTGGCAAGGTGAGGAAAGGG + Intronic
1150642709 17:66960415-66960437 TCCCTTGCCAGCTGAGGAGGTGG - Intergenic
1151295459 17:73182807-73182829 TAGCTGGCTACCTGATAAGGTGG + Intergenic
1161184350 19:2906578-2906600 TTACTGGCCAGCTAGGGAGGGGG - Intronic
1165460388 19:35940584-35940606 CTGTTGGCTAGCTGAGGAGGTGG - Exonic
1167019654 19:46863665-46863687 TAACTTGTTAGCTGGGGGGGAGG - Intergenic
1167416968 19:49379321-49379343 TACCTGGGAGGCTGAGGAGGGGG - Intergenic
927561383 2:24076621-24076643 TAACTGGGGAGCGGAGGAGGCGG + Intronic
927764227 2:25790275-25790297 AAACTAGCTAACTGAGGTGGTGG + Intronic
927864851 2:26581811-26581833 TGACTGCCTGGATGAGGAGGGGG - Intronic
928586520 2:32764173-32764195 TGACTGGTTGACTGAGGAGGAGG - Intronic
930166882 2:48211599-48211621 TTAATGGCTAGGTGAGGAGCTGG - Intergenic
931899244 2:66769661-66769683 TAACAGGCTGGCAGAGGAAGTGG - Intergenic
933851625 2:86371831-86371853 TAAATATCTAGCAGAGGAGGAGG - Intergenic
944682852 2:202092585-202092607 TCACTGGCTAGCCGAGGGGTGGG + Intronic
947564266 2:231184064-231184086 TCACTGGAGAGCTGAGGAGGAGG + Intergenic
947815534 2:233034112-233034134 TCAGTGGCAAGCTCAGGAGGTGG + Exonic
947938522 2:234027721-234027743 TCACTGGCCAGCTTAGAAGGAGG - Intergenic
948281071 2:236748380-236748402 GAAGTGGCTGGCTCAGGAGGTGG + Intergenic
1175455515 20:59109662-59109684 TGACTGGTTAGCCGAGGAAGGGG + Intergenic
1176381465 21:6115747-6115769 AAACTAGCTAGGTGAGGTGGTGG - Intronic
1178302739 21:31466501-31466523 TAACGGCCTAGCTGAGAAGGGGG + Intronic
1179252665 21:39685795-39685817 TAACTGGCAAGATGAGGAGCGGG + Intergenic
1179280324 21:39928384-39928406 CAAATGGCTTGCTGAGGTGGAGG - Intronic
1179742007 21:43422492-43422514 AAACTAGCTAGGTGAGGTGGTGG + Intronic
1179967505 21:44815907-44815929 TCCCTGGATAGCTGAGGTGGAGG - Intronic
1184255010 22:43281607-43281629 TGACAGGGTTGCTGAGGAGGAGG - Intronic
1184369485 22:44073628-44073650 TTTCTGTGTAGCTGAGGAGGTGG + Intronic
949368810 3:3312216-3312238 TAGCTGGGTAACTGAGGAGCTGG - Intergenic
950793594 3:15493191-15493213 TGAAGGGCTAGCTGGGGAGGTGG + Intronic
950795397 3:15506423-15506445 GAACTGGGTAGCTGAGGGAGAGG - Intronic
952481314 3:33764509-33764531 TAATTGGGAAGCTGAGGGGGAGG + Intergenic
953424621 3:42783678-42783700 GAACTGGTTAGTAGAGGAGGAGG + Intronic
955581690 3:60429833-60429855 TAAGAGGCTAAGTGAGGAGGTGG + Intronic
956535097 3:70267088-70267110 AAAATTGCTAGCTGGGGAGGGGG + Intergenic
958003808 3:87786501-87786523 AAAGTGGATAGCTGAGTAGGAGG + Intergenic
959455583 3:106556952-106556974 TGACTGGCTCAATGAGGAGGTGG - Intergenic
961066665 3:123882471-123882493 TAACTGGCTAGCTGAGGAGGAGG - Intronic
961435680 3:126915041-126915063 TGTGTGGCTAGCTGAGGAGCTGG + Intronic
961613475 3:128160064-128160086 AAACTGGCTAGCCCAGGAGCTGG - Intronic
961919562 3:130411822-130411844 GAAATGGGTAGATGAGGAGGGGG - Intronic
962949241 3:140202950-140202972 TTACTGGCTAGACCAGGAGGGGG - Intronic
965783006 3:172307581-172307603 TACCTGGGAGGCTGAGGAGGGGG + Intronic
968324544 3:197801594-197801616 TAAGTGCCTAACTGGGGAGGAGG - Intronic
969627071 4:8311112-8311134 GAACTGGCGAGGTGAGGAGAGGG - Intergenic
971405415 4:26318013-26318035 GAACAGGATAGCTCAGGAGGAGG - Intronic
973207042 4:47572327-47572349 TGTGTGGCTAGCTGAGGAGTGGG + Intronic
973636369 4:52864974-52864996 TAACTGCCCAGTTCAGGAGGCGG - Intronic
974259222 4:59503404-59503426 TAACTGGAGAGATGAGGTGGCGG - Intergenic
974411391 4:61545488-61545510 GAACTGGCTCCCTGAGGCGGAGG - Intronic
975781564 4:77846150-77846172 TACTTGGGTAGCTGAGGGGGAGG - Intergenic
977689228 4:99885976-99885998 TAACTGGTTATCTGAGGACTAGG + Intronic
978106965 4:104914862-104914884 TAATTGGCTAGAAGAGGAGGGGG + Intergenic
979454317 4:120909288-120909310 TCAATGGAAAGCTGAGGAGGTGG - Intronic
979619623 4:122784225-122784247 TAAAGGGCTAGGTGTGGAGGAGG - Intergenic
980542934 4:134218244-134218266 TAATTAGCTATCTGAGGAGAGGG - Intergenic
981630405 4:146811774-146811796 TTTCTGGCAAGGTGAGGAGGAGG + Intronic
981955753 4:150471255-150471277 TATTTGACTAGCAGAGGAGGTGG - Intronic
984836597 4:184028308-184028330 AAACTGTCTAGCTGAGGGGATGG - Intergenic
984942601 4:184946881-184946903 AAACTGGGAAGCTGAGGAGAGGG - Intergenic
986231080 5:5865211-5865233 TCAGTGCCTAGCTGAGGATGAGG - Intergenic
989600060 5:43192480-43192502 GACCTGGGTGGCTGAGGAGGAGG + Intronic
993029183 5:82684470-82684492 AAACTGGCTGGATGAGGAGAAGG - Intergenic
996690390 5:126334048-126334070 TCCCTGGCTAGCTAAGGTGGGGG - Intergenic
997872325 5:137516763-137516785 TGACAGGCTAGTTCAGGAGGAGG + Intronic
1001753736 5:174150557-174150579 TAGAAGGCTGGCTGAGGAGGTGG + Intronic
1004977174 6:20981090-20981112 AAACTGGGTAACTGAGCAGGAGG + Intronic
1006943702 6:37770001-37770023 TAACAGGCTAGCTGAAGGTGGGG + Intergenic
1007130127 6:39464596-39464618 GGCCTGGCTAGGTGAGGAGGAGG - Intronic
1008034588 6:46733119-46733141 TAACTGGGTACCTGAGCAGCTGG - Intronic
1014471537 6:121821201-121821223 TAAATGGCTAGCTGAGGATTAGG + Intergenic
1014627552 6:123747068-123747090 TCAGTGGCTAGCTGTGGAGAGGG - Intergenic
1017713992 6:157195388-157195410 CAACTGGCATGCTGTGGAGGGGG - Intronic
1021619567 7:22537859-22537881 TCACTGACCAGCTGAGGAGAGGG + Intronic
1022475621 7:30707678-30707700 AGACTGGCAAGGTGAGGAGGTGG + Intronic
1022644641 7:32218948-32218970 TTCCTGGCTACCTGAGGATGAGG - Intronic
1023747910 7:43339693-43339715 CAACTGCCTAGCTGAGGACATGG - Intronic
1024320227 7:48059051-48059073 TTTCTGGATAGCTGAGGCGGGGG + Intronic
1025275886 7:57580908-57580930 GCATTGGCGAGCTGAGGAGGTGG + Intergenic
1028371695 7:90099740-90099762 TCACTGACCAGCTGAGGAGAGGG - Intergenic
1035221652 7:157409922-157409944 TCACTGTCTCTCTGAGGAGGAGG + Exonic
1040951015 8:52939347-52939369 TACCTGGCTGGCTGGGGAAGGGG - Exonic
1041656376 8:60354798-60354820 TACCTGGGTAGCTGAGGCAGGGG + Intergenic
1043748949 8:83911084-83911106 GAACTGGCAATCTGAGGAGATGG - Intergenic
1044776000 8:95688536-95688558 TAGCTGGGTAGTTGAGGATGTGG + Intergenic
1045477360 8:102564615-102564637 TAACTGGGTTCCTGAGGATGGGG + Intergenic
1048916168 8:139185054-139185076 TACCTGGCTAGAGGAGGAGGAGG - Intergenic
1052305653 9:27006493-27006515 TACCTGGGTGGCTGAGGTGGGGG + Intronic
1055718588 9:79146174-79146196 TAACAGGATAGGTGAGGAGAAGG - Intergenic
1056609367 9:88114707-88114729 GTGCTGGCGAGCTGAGGAGGTGG + Intergenic
1057542556 9:95989108-95989130 CATCTGGATAGCTGAGAAGGTGG - Intronic
1057729445 9:97596158-97596180 TGACTGGCTGGCTGGGGTGGAGG - Intronic
1058177419 9:101753386-101753408 TGACTGGGTAGCAGGGGAGGTGG - Intergenic
1059435633 9:114274375-114274397 CAACTGGCTAGCGGTGGAGCTGG - Intronic
1062157202 9:135058785-135058807 TAAATGGCCAGCTAGGGAGGAGG + Intergenic
1186696491 X:12039110-12039132 TACCTGGGAAGCTGAGGTGGGGG - Intergenic
1189020721 X:37335780-37335802 CAGCTGGTTAGCTGAGTAGGTGG + Intergenic
1189179525 X:38990170-38990192 TATCTGGCTGGCTGAGAAGAGGG + Intergenic
1189281030 X:39820465-39820487 TTTCTTGCCAGCTGAGGAGGAGG + Intergenic
1189732190 X:44033240-44033262 TTAGTGGCTAGAGGAGGAGGAGG + Intergenic
1190528999 X:51355991-51356013 TGAATGGCTAAATGAGGAGGAGG - Intergenic
1192182025 X:68922104-68922126 TTCCTGGCTGGCTGAGGAGGGGG + Intergenic
1200069778 X:153522468-153522490 TGTGTGGCTACCTGAGGAGGCGG - Intronic