ID: 961067354

View in Genome Browser
Species Human (GRCh38)
Location 3:123886956-123886978
Sequence TTCTGGTTCTCAAGGACAAA AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961067351_961067354 0 Left 961067351 3:123886933-123886955 CCTCTTTTCTTTCATGTAGAGAA No data
Right 961067354 3:123886956-123886978 TTCTGGTTCTCAAGGACAAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961067354 Original CRISPR TTCTGGTTCTCAAGGACAAA AGG Intergenic
No off target data available for this crispr