ID: 961069469

View in Genome Browser
Species Human (GRCh38)
Location 3:123908516-123908538
Sequence CAATGATATTTTAAGTTGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 236
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 216}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961069469_961069473 17 Left 961069469 3:123908516-123908538 CCCACCAACTTAAAATATCATTG 0: 1
1: 0
2: 2
3: 17
4: 216
Right 961069473 3:123908556-123908578 TATTAATCAATAATATACCATGG 0: 1
1: 0
2: 1
3: 29
4: 402

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961069469 Original CRISPR CAATGATATTTTAAGTTGGT GGG (reversed) Intronic
900614486 1:3558865-3558887 CAATTTTTTTTTAAATTGGTTGG + Intronic
901133093 1:6975008-6975030 TATTGATAATTTAAGTTGGCAGG - Intronic
903080066 1:20803386-20803408 CAATAGAATTCTAAGTTGGTTGG - Intergenic
904749322 1:32731267-32731289 CAATAATCTGTAAAGTTGGTAGG - Intergenic
906248365 1:44292937-44292959 CACTGATATTTAAAGCTGATGGG - Intronic
908655678 1:66385722-66385744 CAATCATATTTTGACATGGTTGG + Intergenic
911435326 1:97848534-97848556 CAATTATATTTTATGTTATTAGG + Intronic
911841023 1:102682163-102682185 TAAAAATATTTTTAGTTGGTTGG + Intergenic
913065052 1:115243546-115243568 AAATGCTTTTCTAAGTTGGTGGG + Intergenic
913266770 1:117052812-117052834 CAATGCTTATTTAAGATGGTAGG - Intergenic
913687910 1:121251267-121251289 CCATGGTATTTCAAATTGGTGGG + Intronic
914039766 1:144038907-144038929 CCATGGTATTTCAAATTGGTGGG + Intergenic
914149691 1:145029013-145029035 CCATGGTATTTCAAATTGGTGGG - Intronic
914665583 1:149829743-149829765 CTTTGGAATTTTAAGTTGGTTGG + Intergenic
914670182 1:149864051-149864073 CTTTGGAATTTTAAGTTGGTTGG - Intronic
916981400 1:170141642-170141664 TTATGATATTTTAATTTGATAGG + Intergenic
917608048 1:176656125-176656147 AGATGATATGTTAAGTTGCTGGG - Intronic
918601478 1:186368227-186368249 CAGTGATATTCTAAGTTATTAGG - Intronic
920475233 1:206269765-206269787 CCATGGTATTTCAAATTGGTGGG + Intronic
920925900 1:210341373-210341395 AAATGATATTGGAAGTTGCTGGG + Intronic
1063191518 10:3698926-3698948 CAATGATATTTTGTGTCTGTAGG + Intergenic
1064608831 10:17075405-17075427 GGATGATATTCAAAGTTGGTAGG + Intronic
1065015036 10:21454978-21455000 CAGTGCTGTTTTAAGTTGGACGG + Intergenic
1065274394 10:24070912-24070934 CAATGAGTATTCAAGTTGGTTGG + Intronic
1065357870 10:24859956-24859978 CAGTCATATTTTAATTTGGTGGG - Intronic
1065604801 10:27406730-27406752 CCAAGATATTTTAATTTGATAGG + Intronic
1068070834 10:52193005-52193027 CTATAATATTTTTAGTTGGCAGG + Intronic
1068405214 10:56579280-56579302 CAATCATACTTTAAGTATGTGGG - Intergenic
1071929195 10:90447081-90447103 CAATGATACATTAAGTTGGCTGG + Intergenic
1074139288 10:110657844-110657866 CAATGATATTTTAACCTTTTAGG + Intronic
1075794477 10:125109350-125109372 CAAAGATGTTTTCAGTGGGTTGG - Intronic
1076060555 10:127410949-127410971 GAATGATATTTTTTGTTGTTTGG - Intronic
1079979185 11:27131450-27131472 CAATGAAAATGTAATTTGGTTGG + Intergenic
1080129648 11:28779516-28779538 CAATGAGATTTTAAGTTCCCTGG - Intergenic
1081155256 11:39681950-39681972 CACTGAGATTTTGAGTTGGTTGG - Intergenic
1087901515 11:103646587-103646609 ACATGGTATTTTAAGTTGATGGG - Intergenic
1088839828 11:113616428-113616450 AAATGATATTTAATGTTGGCAGG - Intergenic
1089086966 11:115828418-115828440 CAATTATATCTTAATTTGGGAGG + Intergenic
1090535706 11:127639208-127639230 CAATGTTACTTTTAGTTGGAAGG + Intergenic
1093625037 12:21335955-21335977 CAATGAAAGTTTAAGTTCCTTGG - Intronic
1094281687 12:28747077-28747099 CATGGATATTTTAATTTAGTGGG + Intergenic
1095793177 12:46189451-46189473 CAGTGATAAGCTAAGTTGGTAGG - Intronic
1095893530 12:47257783-47257805 AGATTATATGTTAAGTTGGTAGG + Intergenic
1097889420 12:64762042-64762064 CAATGAGCATTTAAGGTGGTGGG + Intergenic
1098616194 12:72526452-72526474 AATTGATATTTTATGTTGTTGGG + Intronic
1098757221 12:74380238-74380260 CATTGATAAAATAAGTTGGTAGG - Intergenic
1098895551 12:76056529-76056551 CATTGCTATTTTATGTTGTTTGG - Intronic
1099356495 12:81643135-81643157 TAATGATATTTTAAGTAATTTGG - Intronic
1099620491 12:84997024-84997046 CAATGAGATTTTATGGTTGTAGG - Intergenic
1100289080 12:93196833-93196855 CAATGATATTATAACTATGTAGG - Intergenic
1101787723 12:107900195-107900217 CAATTATATTTTTAATTGGGTGG + Intergenic
1106051175 13:26191120-26191142 AAAAGACATTTTAAGTTGGAGGG + Intronic
1108785869 13:53900470-53900492 CAACTTTATTTTAAGTTGATGGG - Intergenic
1108959319 13:56203744-56203766 TAATTATATTTTAAGTGGATTGG - Intergenic
1109071096 13:57770197-57770219 CAATAATATTTTGAGTTCTTCGG + Intergenic
1109921707 13:69072299-69072321 CAATGATATTTTATGTAGAATGG - Intergenic
1110045478 13:70823672-70823694 CAATGTTATGTTAACTTGTTGGG - Intergenic
1110127251 13:71961053-71961075 GAATGTTATGTTAACTTGGTAGG + Intergenic
1111669207 13:91306846-91306868 CAATGAGATTTCAAAGTGGTTGG - Intergenic
1111727961 13:92036915-92036937 CTATAGTATTTTAAGTTGGAGGG - Intronic
1113169604 13:107485548-107485570 CAATATTATTGTAAGTAGGTTGG + Intronic
1114135039 14:19838042-19838064 CAAGGCTTTTTTAGGTTGGTAGG - Intergenic
1114829358 14:26120750-26120772 CCATGGCATTATAAGTTGGTTGG + Intergenic
1115575925 14:34711806-34711828 CAATGGTATTTTATATTAGTTGG + Exonic
1116085123 14:40227301-40227323 CAATGATAATTAACGTTGCTCGG - Intergenic
1116310732 14:43323249-43323271 AAATGATCTTTTAATTTGGGAGG + Intergenic
1116591932 14:46787993-46788015 TCAAGATATTTTAAGTTGATGGG - Intergenic
1117138494 14:52762274-52762296 AAATGATATTTCAAATCGGTAGG - Intronic
1117762357 14:59043017-59043039 CACTGAAATTTTATGTTGTTAGG + Intergenic
1118628102 14:67677070-67677092 CAATTATATTTTAACTTTGGTGG - Exonic
1118966007 14:70586209-70586231 CCATGACTTTTAAAGTTGGTAGG + Intronic
1124724102 15:32139883-32139905 TAATGATATTTTATGCTGGGTGG - Intronic
1125839702 15:42788203-42788225 CTTTGATATTTTAATTTTGTTGG + Intronic
1126511724 15:49483746-49483768 CAATTATATTTTATTATGGTGGG - Intronic
1126609072 15:50510368-50510390 CAATCAAGTTTTAATTTGGTTGG - Exonic
1127065992 15:55239398-55239420 AAATAAAATTTTAAGTTTGTTGG - Intronic
1130082367 15:80745301-80745323 CAATGATGTTTAATTTTGGTAGG + Intronic
1131128254 15:89874898-89874920 GAGTCGTATTTTAAGTTGGTGGG + Intronic
1131209052 15:90477603-90477625 GAAGGATCTTTTAAGTTGATGGG + Intronic
1134642548 16:15840744-15840766 TAATGATTTTTTTAGTTGTTTGG - Intronic
1135378899 16:21976382-21976404 CAATTATATCTTTAGGTGGTAGG - Intronic
1137043857 16:35638747-35638769 CATTGAAATTTCAAGTAGGTGGG + Intergenic
1137468861 16:48736534-48736556 CAATTATATTTTAAGCAGATGGG + Intergenic
1137809724 16:51341426-51341448 CCTTGATATTTAAAGTTGGGTGG - Intergenic
1137852783 16:51763052-51763074 CAATTATTTTTTAAGGTTGTGGG + Intergenic
1140549987 16:75855344-75855366 AAATGATTTTTTGAGGTGGTGGG + Intergenic
1148014978 17:44515320-44515342 CAGTGATATTCTAAAATGGTAGG - Intergenic
1149030530 17:52077974-52077996 ACATAATTTTTTAAGTTGGTTGG - Intronic
1149420407 17:56504967-56504989 CAAAGATACTTTAAGTGGGCTGG - Intronic
1154952188 18:21221236-21221258 CACAGAGATTTTAATTTGGTGGG + Intergenic
1155850786 18:30771026-30771048 CAATAATCTTTAAAGTTGTTTGG - Intergenic
1157515992 18:48311947-48311969 CAAAGATGTCTTAAGTAGGTGGG - Intronic
1159190051 18:65029629-65029651 TTAAGATATTTTAGGTTGGTAGG - Intergenic
1160170649 18:76550382-76550404 CAATTATATTTTATGTTGGTAGG + Intergenic
1162207568 19:9067183-9067205 CAAGCATATTCTAAGTTGATAGG - Intergenic
925764505 2:7218047-7218069 CAATAATTTTTTAATGTGGTTGG + Intergenic
926774942 2:16412726-16412748 TTATTATACTTTAAGTTGGTAGG + Intergenic
930972831 2:57418401-57418423 CAAATATATTTTAAGTTTATGGG - Intergenic
932727749 2:74194078-74194100 AAATGATATTTTAAGAGAGTGGG + Intergenic
933605894 2:84383193-84383215 AAATGAGATTTGTAGTTGGTTGG - Intergenic
936266552 2:111014664-111014686 CAATGTTTTTTGAAGTTGTTTGG - Intronic
938798171 2:134735897-134735919 CAATGTTTTTTTAATTTGCTGGG + Intergenic
939201244 2:139037782-139037804 GAATGATATTTGAAGTAGCTAGG - Intergenic
939864305 2:147455891-147455913 CAATGATAATGTAAGTTTATTGG + Intergenic
940939936 2:159548548-159548570 CACTGATTTTTTAAGATGCTAGG - Intronic
941081540 2:161066618-161066640 CATTGATATTTTATGATGGAGGG - Intergenic
941189047 2:162353821-162353843 CAATGATATTTTCTGTTTCTTGG + Intronic
943013447 2:182480802-182480824 CAATCATCTTTTTAGTAGGTGGG - Intronic
943760561 2:191603595-191603617 CAATGATATTGTAAATTCCTTGG + Intergenic
944807727 2:203298736-203298758 CAAGAATATTTTAAGTAGGCTGG + Intronic
945422464 2:209656217-209656239 CAATAATAATTTAAATTGGCTGG + Intronic
946529597 2:220557591-220557613 CTATGATTTTGTAAGTTGGCGGG + Intergenic
947000120 2:225444753-225444775 CCATGATATTTTAGCCTGGTTGG - Intronic
947063230 2:226190523-226190545 CTATCAGATTTAAAGTTGGTAGG - Intergenic
948167631 2:235875287-235875309 CGATGGTATTTTAAATTGTTGGG + Intronic
1169501580 20:6165818-6165840 CCCTGATTTTTTAGGTTGGTAGG - Intergenic
1169721870 20:8687007-8687029 TAATAATAATTTAAATTGGTAGG - Intronic
1169786515 20:9365016-9365038 TAATAATATATTAAGGTGGTGGG - Intronic
1170735830 20:19013447-19013469 GAAAGATATTTTAAGATGGAGGG + Intergenic
1171516054 20:25737328-25737350 AAATGATATTTTAATTTTGATGG + Intergenic
1173352540 20:42258137-42258159 CAAAGATATTTTAATCTGGCTGG - Intronic
1174920091 20:54692610-54692632 CAATGAAATTCTCAGTTGATAGG - Intergenic
1178231578 21:30791042-30791064 CACTGAAATTTTAAGGTTGTCGG + Intergenic
1178890188 21:36514457-36514479 CAATGATGGTTTCAATTGGTTGG + Intronic
1181756924 22:25030668-25030690 TAATGATATTCTAAGTCGGTTGG + Intronic
949150282 3:758471-758493 CAATGATATTTGTGGTGGGTGGG - Intergenic
949564459 3:5232108-5232130 AAATTATCTTTTAATTTGGTGGG - Intergenic
951262305 3:20524247-20524269 TAATGATATTATAAGTGGATGGG - Intergenic
951614406 3:24525264-24525286 CAATGATAGTTTTTCTTGGTTGG + Intergenic
951901000 3:27657460-27657482 CAGTGACGTTTCAAGTTGGTTGG - Intergenic
957623207 3:82622820-82622842 CAATTATATTTTAAGTTCTGGGG + Intergenic
958534550 3:95382095-95382117 CCATGTTGTTTTAAGTTGCTAGG - Intergenic
958746246 3:98138741-98138763 CAAAGCTATTTCAAGTTTGTTGG - Intergenic
959164957 3:102765204-102765226 CAATGATATTTAAAATTATTTGG + Intergenic
960216638 3:115046948-115046970 TAATTAAATTTTAAGTTGGAAGG - Intronic
961069469 3:123908516-123908538 CAATGATATTTTAAGTTGGTGGG - Intronic
961173676 3:124816896-124816918 CAATCACATCTTAAGTAGGTAGG + Intronic
962897175 3:139726092-139726114 CTAAGATATTTTTATTTGGTAGG + Intergenic
963030583 3:140970660-140970682 AAAGGATATTCTAAGTAGGTTGG + Intronic
963259050 3:143176036-143176058 CATTGACATTTTGTGTTGGTGGG - Intergenic
965203276 3:165688558-165688580 TAAGGATATTTTCAGTTTGTAGG + Intergenic
966092774 3:176159954-176159976 CTATAATATCTTGAGTTGGTTGG - Intergenic
967224847 3:187281498-187281520 CAGTGATATTTTAAGTTTCTTGG + Intronic
967501427 3:190202663-190202685 AAGTGACATTTTAAGTTGGTGGG + Intergenic
969139462 4:5055824-5055846 GAATGACATTTTAAGTAGGGTGG - Intronic
970328348 4:14952697-14952719 AAAAGATATTTTAAGTTGTTTGG + Intergenic
970729352 4:19084585-19084607 CATTGAGATTATAATTTGGTTGG + Intergenic
971256670 4:25020587-25020609 CATAGATATCTTAAATTGGTTGG - Intronic
971588733 4:28439391-28439413 ATGTCATATTTTAAGTTGGTTGG - Intergenic
971596932 4:28541215-28541237 CAATGATATTTTATTTTATTTGG - Intergenic
971916466 4:32876010-32876032 CATTGGTATTTTTAGATGGTTGG - Intergenic
972142434 4:35977279-35977301 CAATGATTTCTTGTGTTGGTAGG - Intronic
972729316 4:41777564-41777586 CAATGAAATTTGAAGTTGGCTGG - Intergenic
972821814 4:42710359-42710381 AAATGATATTTTAAGTTGCAGGG - Intergenic
974783861 4:66591852-66591874 AAATAATTTTTTAAGTTAGTGGG - Intergenic
975206850 4:71654061-71654083 CAATGAAATTTTAAGTAAGTAGG - Intergenic
975710430 4:77156475-77156497 CAATGTTATAATAATTTGGTGGG + Intergenic
977759096 4:100709662-100709684 CAATCTTTTTTTAATTTGGTAGG - Intronic
979281005 4:118867592-118867614 CACTGATTTTTTAAATCGGTAGG - Intronic
979611580 4:122694695-122694717 CCATGATATTTACAGTTGGGAGG + Intergenic
981595414 4:146415849-146415871 CTATGATATTTCAAGCTGGTTGG - Intronic
985201661 4:187490561-187490583 GAAAGATATTTCAAGTTGGCTGG + Intergenic
985804297 5:2029994-2030016 AAATTTTATTCTAAGTTGGTGGG - Intergenic
988104966 5:26733033-26733055 GAATTTTTTTTTAAGTTGGTAGG - Intergenic
988215489 5:28267167-28267189 TTATACTATTTTAAGTTGGTTGG - Intergenic
993445212 5:88003545-88003567 CAATGATTTTTTTATTAGGTGGG - Intergenic
994389554 5:99175458-99175480 CAATTATTTTTTAAGTCGTTCGG - Intergenic
994752871 5:103760649-103760671 CAATGATTTTTTAAAAAGGTTGG - Intergenic
995792728 5:115909097-115909119 AAAAGATATTTTAAGATGGTAGG + Intronic
996487724 5:124056495-124056517 CAGAGGTATTTTCAGTTGGTGGG + Intergenic
997757769 5:136416006-136416028 GAAAGATATTTTATGTTGGGGGG + Intergenic
998950150 5:147385568-147385590 CAGTGATATTTTAAATAAGTAGG - Exonic
999330194 5:150668570-150668592 AAATGGTATTTTAAGCTGGGAGG - Intronic
1001779458 5:174355418-174355440 CAATAAGATTGTAAGTTGGGAGG + Intergenic
1003329247 6:5116063-5116085 GACTGATATTTTTAGTTGTTAGG - Intronic
1003675605 6:8201807-8201829 GAATGATATTTTAAGCAGCTTGG - Intergenic
1004059449 6:12178236-12178258 CAATTATTTTACAAGTTGGTCGG + Intergenic
1004265680 6:14146482-14146504 CAATAATATTTTCAGTTGGTTGG + Intergenic
1004762526 6:18684569-18684591 TAATGATGTTTTAAGTTTATAGG + Intergenic
1007906009 6:45461356-45461378 CAGAGATATTTTGATTTGGTGGG + Intronic
1009679847 6:66878228-66878250 CCATGAAATTTAAAGTTGTTAGG + Intergenic
1009682093 6:66908627-66908649 CAATGACATTGGAACTTGGTAGG + Intergenic
1010941575 6:81925185-81925207 TAATGATATTTTTTGTTGCTGGG - Intergenic
1012160810 6:95883422-95883444 GCATAATATTTTAAGTTTGTAGG - Intergenic
1012843378 6:104358713-104358735 AAATGATAACATAAGTTGGTTGG + Intergenic
1012861308 6:104562859-104562881 CAAAGAAATTTTAAGCTGTTTGG + Intergenic
1014020154 6:116577618-116577640 TGATGATATTTTAAGTTGGCAGG - Intronic
1018164520 6:161080655-161080677 CAATAATATGTTAAATTGCTGGG + Intronic
1018636149 6:165861123-165861145 CAATGCTGTTTCCAGTTGGTGGG - Intronic
1019933777 7:4241018-4241040 CAATTATTTTTTATGTTGTTCGG + Intronic
1023530920 7:41153292-41153314 CAATGTAATTTTAATTTGGAAGG - Intergenic
1023583203 7:41703625-41703647 AAATAATAGTGTAAGTTGGTTGG - Intergenic
1024018430 7:45341365-45341387 CAATGAAATTTGAATTTTGTGGG + Intergenic
1024748583 7:52435971-52435993 AAATGACATTTTTATTTGGTGGG - Intergenic
1027621936 7:80498506-80498528 AAATGAGATTTTAAGTAGATAGG - Intronic
1027852796 7:83470159-83470181 AACTTATATTTTAAGTTTGTTGG + Intronic
1028743659 7:94304164-94304186 CATTGCCATTTTAAGTTGTTTGG - Intergenic
1029194111 7:98792454-98792476 GAAGGATTTTTTAAATTGGTAGG - Intergenic
1029806079 7:102997958-102997980 CAATTCTATTTTCAGTTGTTAGG + Intronic
1029857548 7:103532930-103532952 CAAGGAGCTTTTAATTTGGTAGG - Intronic
1031220391 7:118958020-118958042 CTATAATGTTTTAAGTTGGTTGG + Intergenic
1032624452 7:133575420-133575442 CAATTATTTTTTAACTGGGTGGG - Intronic
1033111144 7:138578458-138578480 CATTGATTGTTTTAGTTGGTAGG - Intronic
1034536140 7:151727252-151727274 CAATGGTATTTGGTGTTGGTGGG + Intronic
1035017210 7:155776991-155777013 CAATGATAAAGTAAGTCGGTAGG - Exonic
1037201335 8:16256374-16256396 GAAAGATATGTTAACTTGGTTGG + Intronic
1038600875 8:28940769-28940791 CAATGACCTGTTAAGTAGGTAGG - Intronic
1038989602 8:32853615-32853637 CAAATATATTTTTAGATGGTTGG - Intergenic
1040514278 8:48121901-48121923 AAGTGATTTTTTAAGGTGGTGGG + Intergenic
1040601019 8:48883889-48883911 CAATGAGATTTTCTGTTGTTAGG + Intergenic
1041435323 8:57832606-57832628 CAGTCATATTTTGAGTTGCTGGG + Intergenic
1041793379 8:61721249-61721271 CAATCTTATTTGTAGTTGGTTGG + Intergenic
1042696703 8:71561452-71561474 CAATGTTTATTTTAGTTGGTTGG - Intronic
1043221149 8:77666178-77666200 CACTGTTATTTTAAGGTTGTTGG + Intergenic
1044071641 8:87767993-87768015 AAATGGTATATTAATTTGGTAGG + Intergenic
1045042479 8:98239152-98239174 GAATGAGATTTTAAGGTAGTAGG + Intronic
1047077175 8:121417289-121417311 CAGTGATATTTTAAAATGGGAGG + Intergenic
1047187046 8:122643059-122643081 CAATGATAAAATAAGTTTGTGGG - Intergenic
1048663976 8:136640516-136640538 AAGTGATATTTTAGGTTTGTAGG - Intergenic
1051569495 9:18539841-18539863 CAAATATATATTAAGTTGCTTGG + Intronic
1052383810 9:27801633-27801655 CAATGTTTTTTTAAGCTGGTGGG + Intergenic
1057233750 9:93342340-93342362 CAATGAAAATTAAAGGTGGTAGG - Intronic
1058206196 9:102111386-102111408 CAGGGATTTTTTTAGTTGGTAGG + Intergenic
1059156445 9:111993024-111993046 CAATAGTATTTTAATTTGGTGGG - Intergenic
1186022644 X:5273608-5273630 CAAGAATATTTTATGTTGGCTGG + Intergenic
1187463689 X:19510103-19510125 CTAGGATTTTTTTAGTTGGTAGG - Intronic
1188298820 X:28483096-28483118 AAATGCTATGTTCAGTTGGTGGG + Intergenic
1190798401 X:53766030-53766052 AAATTATATTTAAAGTTGCTTGG + Intergenic
1193679869 X:84505073-84505095 CAATGCTATTTTAAATTGATTGG - Intergenic
1194879350 X:99231642-99231664 CAATGTTAGTTTATGTTGTTTGG + Intergenic
1196650160 X:118160336-118160358 CAATTGTATTGTAAGTTGTTGGG - Intergenic
1196963708 X:121031994-121032016 TAACAATATTTTAGGTTGGTGGG + Intergenic
1198782520 X:140252846-140252868 AAATGATATTTTAATTCAGTGGG + Intergenic
1198929750 X:141841572-141841594 CAATAATATTTTATGCTAGTGGG - Intronic
1199523944 X:148770424-148770446 CACTGATATTTCAAGTGTGTGGG - Intronic
1201421187 Y:13800947-13800969 AAATGATAGATTAAGTTGGATGG - Intergenic