ID: 961071722

View in Genome Browser
Species Human (GRCh38)
Location 3:123936038-123936060
Sequence CTGCAGATACAGAAGATAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 368
Summary {0: 1, 1: 0, 2: 1, 3: 32, 4: 334}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961071722 Original CRISPR CTGCAGATACAGAAGATAAA GGG (reversed) Intronic
900779128 1:4606144-4606166 CAGCAGATACAGCAGGTACAGGG - Intergenic
901667409 1:10834633-10834655 CTGCAAAAACAGAAAATGAAGGG + Intergenic
901744931 1:11366082-11366104 CTGCCCAGACAGAAGATAAAAGG + Intergenic
902954764 1:19917980-19918002 CTGCAGAAACAGAAAACACAGGG - Intergenic
905470392 1:38187467-38187489 CTGCAGATGCAGCAGACATAGGG + Intergenic
905646781 1:39630309-39630331 CTGCGGGTACAGAAGACAGAAGG + Intronic
906249153 1:44297940-44297962 CAGCAGAAAAGGAAGATAAAAGG + Intronic
906477398 1:46178972-46178994 CTGAAGAGACAGAAGAGAGAGGG - Intronic
908096979 1:60749492-60749514 CTGCAGATATTGAAGATTATGGG - Intergenic
908401735 1:63777618-63777640 CTCAAGATACAGAAGAGAAAGGG - Intronic
910060634 1:83087561-83087583 TTGCAGATACTGAGGTTAAATGG - Intergenic
910097284 1:83538211-83538233 GTGTAGATACAGAAGAAAAGAGG + Intergenic
910097516 1:83540303-83540325 GTGTAGATACAGAAGAAAAGAGG - Intergenic
911406797 1:97451344-97451366 CTACAGTTGCAGAGGATAAAAGG + Intronic
912672967 1:111648564-111648586 CTGCAGATGGAGCAGCTAAACGG - Intronic
912782450 1:112564465-112564487 CGGCATATATAAAAGATAAAAGG - Intronic
914505652 1:148286902-148286924 CTGCAGATACAGTGGGAAAATGG + Intergenic
914506904 1:148297249-148297271 CTGCAGATACAGTAGGAAGATGG - Intergenic
915137267 1:153741558-153741580 CTCCAGATTCTGAAGCTAAATGG + Intronic
918199559 1:182254518-182254540 CTGCAGAACCAGAAGAGGAAAGG + Intergenic
919098608 1:193066219-193066241 CTGAAGATACAGTAGAGAAGGGG - Intronic
919329528 1:196152481-196152503 CTGCAAATGCACAAGATAAAGGG + Intergenic
920276845 1:204812920-204812942 CTGTAGCAATAGAAGATAAAGGG - Intergenic
921782827 1:219188214-219188236 ATGTAGAGACAGAAAATAAAAGG + Intronic
921795380 1:219337610-219337632 CTTCACATACAGAACAGAAATGG - Intergenic
923115233 1:230930474-230930496 CTTCAGAGACAGGAGATAAAAGG + Intronic
923642819 1:235782661-235782683 GTGCATATACAGAAGTCAAATGG - Intronic
924646511 1:245882364-245882386 CTGCGAATACATAAGATATATGG - Intronic
1062978573 10:1703149-1703171 CTCCAGATACAGCAATTAAAAGG + Intronic
1063473020 10:6303989-6304011 CGGCAGAGACACAAGATGAAAGG + Intergenic
1064707938 10:18092171-18092193 CTGAAGATACACAAGAGAAGGGG - Intergenic
1065850903 10:29787375-29787397 CTGCAAAAAGAGAAGGTAAAAGG + Intergenic
1065990556 10:31005547-31005569 CTGCAGATACGCAGGATAAAGGG + Intronic
1066789733 10:39049192-39049214 CTGCTGAGACAGAAAATATAAGG - Intergenic
1067383574 10:45797562-45797584 CTGCAGATGCAGATGATTAGAGG + Intergenic
1067880604 10:50041238-50041260 CTGCAGATGCAGATGATTAGAGG - Intergenic
1067891277 10:50138131-50138153 CTGCAGATGCAGATGATTAGAGG + Intergenic
1070421450 10:76241654-76241676 CTACAGGTACAGAGGATGAAGGG - Intronic
1071404621 10:85318133-85318155 CTACAGGGACAGAAGAGAAAAGG - Intergenic
1071409484 10:85374699-85374721 CTGCAGAAGCTGAAGATCAAGGG + Intergenic
1071480107 10:86058704-86058726 CTGCAGATTAAGAAGTTTAATGG - Intronic
1071884886 10:89939025-89939047 CTATAGATACAATAGATAAATGG - Intergenic
1072191797 10:93081829-93081851 CTGGAGAAACATAAGGTAAATGG - Intergenic
1073120721 10:101121278-101121300 CTGCAGAAATAGACGATAAATGG + Intronic
1073317838 10:102595396-102595418 TTGCATATGCAGAAGATACAAGG - Intronic
1073932942 10:108597794-108597816 CTGGAGATTCAGAAGGTACAGGG - Intergenic
1074385730 10:113015234-113015256 CTGCAGAGACAGCAGAGGAATGG - Intronic
1075993705 10:126859598-126859620 CTGAAGATGCAGGAGAGAAAGGG - Intergenic
1076030219 10:127151093-127151115 CTGCAGGAAGAGATGATAAAGGG - Intronic
1076397898 10:130154793-130154815 CTGAGGATACAGAACATTAAGGG + Intronic
1077004993 11:350643-350665 CTCCAGAGAAAGAAGTTAAAAGG - Intergenic
1078165396 11:8878844-8878866 CCACAGAGACAGAAGATAAATGG + Intronic
1079118963 11:17664058-17664080 ATGTAGATACACAAGAGAAATGG + Intergenic
1079145680 11:17849554-17849576 CTGTAGATATAGAAGGTACAAGG - Intronic
1079380412 11:19933153-19933175 CTGCAGAGACAGAAGAGAGGAGG - Intronic
1080453374 11:32397093-32397115 CTGCACTTCCACAAGATAAAGGG - Intronic
1080971354 11:37280781-37280803 GTGAAGATACAGAAGAGAGAAGG - Intergenic
1083225817 11:61283953-61283975 CTGCAGAGTCAGCAGTTAAAAGG + Intronic
1083341106 11:61958957-61958979 CTGCAGAAACCAAAGATAACTGG - Intronic
1085534333 11:77208974-77208996 CTGAAGAATCAGAAGATACAAGG - Intronic
1085582247 11:77663564-77663586 TTACAGATTCAGAGGATAAAGGG - Exonic
1086606256 11:88700135-88700157 CTGCAAATAAAATAGATAAAAGG + Intronic
1086682369 11:89688289-89688311 CAACAAATACAGATGATAAATGG + Intergenic
1088159924 11:106856424-106856446 CTTCAGATTCAGAAAAAAAAAGG - Intronic
1088386817 11:109267648-109267670 TTGCAGATACAGAAGCAATAGGG - Intergenic
1089861406 11:121593212-121593234 CTGCAGAAACACAAGGTACATGG - Intronic
1090340160 11:126010993-126011015 CTGCAAATATAGAACATATAAGG + Intronic
1091718831 12:2797706-2797728 CTGCAGGTACAGAAGCAAACAGG - Intronic
1094476369 12:30843718-30843740 AGGCAGATAGAGAAGGTAAAAGG + Intergenic
1095719859 12:45388533-45388555 CAGTAGACACAGGAGATAAATGG + Intronic
1095901441 12:47332716-47332738 TTGCAGAAATAGAAGAGAAAAGG - Intergenic
1096373275 12:51086127-51086149 CTGTGCATACAGAAGACAAAAGG + Intergenic
1096449511 12:51726185-51726207 TTGCTGAAGCAGAAGATAAAGGG + Intronic
1098579901 12:72087386-72087408 CTGAAGACACAGAAGAAAGATGG + Intronic
1098659239 12:73072214-73072236 CAGCAGGTACATAACATAAAGGG - Intergenic
1098855417 12:75647312-75647334 CAGAATATACAGAATATAAAGGG + Intergenic
1099277031 12:80589907-80589929 GTGCTGATAAAGAAGAGAAAAGG - Intronic
1099984450 12:89646907-89646929 CTGATGATACAGGAGATGAAGGG + Intronic
1101059891 12:100959820-100959842 ATGGAGATACAGAAGAAAAGGGG - Intronic
1101166826 12:102045937-102045959 TCACAGATACAGAAGTTAAATGG + Intronic
1102008974 12:109606603-109606625 CGGCAGAGCCAGCAGATAAAGGG + Intergenic
1103501617 12:121407379-121407401 CTGCAAATTCAGAAGCCAAAAGG + Intronic
1106864200 13:33945904-33945926 CTGGATATATAGAAGATAAATGG - Intronic
1107729372 13:43332838-43332860 ATGTATATACAGAAGAAAAAAGG + Intronic
1108875948 13:55051301-55051323 CTGGAGATTCAGAAGAGAGAAGG + Intergenic
1109915385 13:68978555-68978577 CTGCAGATAATGCAGAGAAAAGG - Intergenic
1110213223 13:72997092-72997114 CTACAGATAAATAAGGTAAAGGG - Intronic
1110368372 13:74713213-74713235 CTGAAGATTCAGAAGATCATTGG - Intergenic
1110424953 13:75356414-75356436 CTGTTGATACATAAAATAAAAGG + Intronic
1111452846 13:88441543-88441565 CTGCAGCTGCAGGAGATAAGGGG - Intergenic
1111880900 13:93955838-93955860 CTGGAGAAAAAGAAGATAGAAGG - Intronic
1112889890 13:104216516-104216538 CTCCACAGACAGAAAATAAATGG + Intergenic
1114342505 14:21759942-21759964 ATACATATACAGAAGATACAAGG + Intergenic
1116010823 14:39349907-39349929 CTTCAAATACAGATGATTAAAGG - Intronic
1116308294 14:43287513-43287535 CTGCAGATAAAACAGGTAAAGGG - Intergenic
1117768264 14:59106289-59106311 CTGAAGTTACAGGAGAAAAAAGG - Intergenic
1118051897 14:62038268-62038290 CTTTTGATACAGAAGATACATGG + Intronic
1118650120 14:67882411-67882433 GTACAGATATAGAAGAGAAAAGG - Intronic
1119652999 14:76396960-76396982 CCGCAGAGACACAAGATTAATGG - Intronic
1121386319 14:93530082-93530104 CTTCAGATGTAGAAAATAAATGG + Intronic
1202895485 14_GL000194v1_random:5265-5287 CTGCAGAGACAGAATTAAAAGGG + Intergenic
1123432280 15:20228878-20228900 CTGCACATAGAAAAGAAAAAGGG + Intergenic
1125512198 15:40298121-40298143 CTGAAGCTAGAGAAGATGAATGG - Intronic
1125783219 15:42290387-42290409 CTGCAGCTACAGAAGATATGAGG - Intronic
1126178452 15:45761515-45761537 CTGCAGATACAGTAGCAAACAGG - Intergenic
1126359205 15:47828441-47828463 CTGCAGAAAGAAAAGATGAAGGG + Intergenic
1127148897 15:56053723-56053745 CTGCAGCTCTAGATGATAAAAGG + Intergenic
1130637566 15:85639465-85639487 CTGCAGCTCCAGAAAATGAATGG - Intronic
1131307322 15:91256828-91256850 CTGCAGGAACAGCAGATAATTGG + Intronic
1131769577 15:95720932-95720954 CTGTAAATACAAAAGATAACAGG - Intergenic
1132170676 15:99650853-99650875 CTGCAGATTCAGAAGGTCTAAGG - Intronic
1134275535 16:12772635-12772657 CTGCATTTTCAGAAGTTAAAAGG - Intronic
1136865732 16:33751648-33751670 CTACACATACAGCAGATAAGGGG - Intergenic
1137398063 16:48131140-48131162 CTGTTGATACAGAAGGGAAAAGG + Intronic
1139241775 16:65399630-65399652 ATGAAAATACAGAAGTTAAAAGG - Intergenic
1139408724 16:66741031-66741053 CTGGAGACACAGTAAATAAAAGG - Intronic
1140985911 16:80157799-80157821 GAGAAGATACAGAAGATACAGGG - Intergenic
1142000587 16:87662086-87662108 CCGTAGGTACAGAAAATAAAAGG - Intronic
1203106422 16_KI270728v1_random:1364455-1364477 CTACACATACAGCAGATAAGGGG + Intergenic
1203127092 16_KI270728v1_random:1597913-1597935 CTACACATACAGCAGATAAGGGG - Intergenic
1143182402 17:4991599-4991621 ATGAAGACAGAGAAGATAAAGGG - Intronic
1143355967 17:6328830-6328852 CTGCAGATTCAAGAGATAGATGG + Intergenic
1143968998 17:10778889-10778911 CTGAAGATACAGGAGAGAAGGGG + Intergenic
1144349466 17:14380894-14380916 GTGCAGAAACAGAAGAGAGAAGG + Intergenic
1148778129 17:50107132-50107154 CTGGAGATCCAGGAGATCAATGG + Exonic
1149578868 17:57733802-57733824 CTTCACAAACAGAAGACAAAAGG + Intergenic
1150965643 17:69964929-69964951 AGGCAGATGCAGAAGATGAAAGG - Intergenic
1153602730 18:6797525-6797547 CTGCTATTACAGAAGACAAAAGG - Intronic
1153799802 18:8659137-8659159 CTGCAGATGATGAAGTTAAAAGG + Intergenic
1155257112 18:24008415-24008437 CTGCATAAACAGAAGGCAAATGG - Intronic
1155790926 18:29969924-29969946 AAGCAGATACAAAAAATAAAGGG + Intergenic
1156176072 18:34548065-34548087 CTCAAGAAACAGAAGGTAAAAGG - Intronic
1156966075 18:43094182-43094204 TGGAAGATACAGAAGATCAAGGG + Intronic
1157656209 18:49391646-49391668 CTGGAGAGACAGAAGAATAAAGG + Intronic
1158289056 18:55918288-55918310 CTGCAGACACAGGAGCTAAATGG + Intergenic
1159240079 18:65730872-65730894 CAGCAGATACAAAATAAAAAAGG + Intergenic
1160078788 18:75703577-75703599 CAGCAGGTACAAAAGGTAAAAGG + Intergenic
1162605005 19:11699884-11699906 CTGCTGAAACAGAGGAAAAAGGG - Intergenic
1165635066 19:37333758-37333780 CTGTGGATACAGAATTTAAAGGG + Intronic
1165951076 19:39474211-39474233 CTGCAGAGACAGGAGAGAAGGGG - Intronic
1166276555 19:41758038-41758060 CTGCGGATGCACAAGACAAAAGG - Intronic
1166278432 19:41772830-41772852 CTGAAGAGAAAGAAGATGAAAGG - Intergenic
1166715036 19:44961500-44961522 GTGCAGAAACAGAAGATTAGAGG - Intronic
1167172106 19:47840006-47840028 AAGCAGATTCAGAAGAGAAAGGG - Exonic
1167517820 19:49933358-49933380 AAGCAGAGACAGAGGATAAAAGG - Exonic
1168448316 19:56443070-56443092 CTACAGAGACAGAAGATAAGTGG + Intronic
926783493 2:16497673-16497695 GTGCAAATACAGAGGAGAAAGGG - Intergenic
927745075 2:25611555-25611577 CTGCAGATACAGAGGGCCAAGGG + Intronic
930303060 2:49641456-49641478 CTGAAGATATAGAAGTAAAATGG - Intergenic
931381282 2:61755799-61755821 ATGTAGATAGAGAAGAGAAAAGG - Intergenic
931815516 2:65896890-65896912 CTGAGGATACAGCAGAGAAAAGG - Intergenic
932703302 2:74004976-74004998 CTGGAGATACAGAGGAGAGAGGG - Intronic
934634251 2:95968510-95968532 CTACACATACAGCAGATAAGGGG - Intronic
934799380 2:97136729-97136751 CTACACATACAGCAGATAAGGGG + Intronic
934834061 2:97566741-97566763 CTACACATACAGCAGATAAGGGG - Intronic
935244897 2:101210161-101210183 CTGCAGAGAAAGAACATAGAGGG + Intronic
936043583 2:109168886-109168908 CTGAAGATACAGCAGAGAACAGG - Intronic
937018254 2:118626813-118626835 CTGCATAAACAGAACAGAAAAGG + Intergenic
937720048 2:125083886-125083908 CTGCAGATCAAGTAGATACATGG + Intergenic
939228845 2:139400127-139400149 CTGCAGATCCAGAATCTATAAGG + Intergenic
940251819 2:151686259-151686281 CTGCAGACACAGAATATGAATGG - Intronic
940375930 2:152958727-152958749 CTGCAGATATACAAGATTAGGGG - Intergenic
940390153 2:153123044-153123066 GTGAAGATACAGAAGACACAGGG + Intergenic
940390159 2:153123112-153123134 ATGAAGATACAGAAGACACAGGG + Intergenic
940497082 2:154444822-154444844 CTGCAAATAAAAAAGTTAAATGG + Intronic
941254921 2:163217017-163217039 TTGCAGAAACAGAAAAAAAAGGG + Intergenic
942913656 2:181276716-181276738 CTGCAGAAAAAGTAGAGAAAGGG + Intergenic
943219244 2:185083567-185083589 CCACAGATAAAGAAGATAACAGG + Intergenic
943375734 2:187074423-187074445 ATGAGGAAACAGAAGATAAAAGG + Intergenic
943718915 2:191182437-191182459 CTGCAGCTGCAGTAGATAAGAGG + Intergenic
944600378 2:201297340-201297362 CGGGAGATAAAGAAGATAAGTGG + Intronic
945071844 2:205998352-205998374 TTGCAGATATATAAAATAAAAGG - Exonic
945538822 2:211056605-211056627 GTGCAGATAGAGATGAAAAATGG - Intergenic
946533924 2:220606502-220606524 ATGCAGATTCAGAATATATACGG + Intergenic
947267379 2:228298681-228298703 CTGGGGATACAGAAGTTGAAAGG - Intergenic
948028971 2:234800938-234800960 TTGCAGATACAGCAGAGAATGGG - Intergenic
1170319610 20:15080562-15080584 GCGAAGATACAGAAGAAAAAGGG - Intronic
1170587045 20:17742676-17742698 CTGCAGATAGAGAAGAAGGAGGG + Intergenic
1170740424 20:19051080-19051102 TTGCAGATACCGCAGAGAAACGG - Intergenic
1173410653 20:42806677-42806699 CTGCAGAGACAATGGATAAATGG + Intronic
1173965444 20:47109073-47109095 CCACAGATAAAGAAGGTAAAGGG + Intronic
1174598167 20:51701540-51701562 CTGCAAACACAGAGGATTAAAGG - Intronic
1176009722 20:62886447-62886469 CTCAAGAAACTGAAGATAAAAGG + Intronic
1177165306 21:17595404-17595426 GTTAAGATAAAGAAGATAAAGGG - Intronic
1177438963 21:21093731-21093753 CTGCAGACAAAGAACATCAAGGG - Intronic
1177996629 21:28107793-28107815 CAGATGATACAGAAGAGAAAGGG + Intergenic
1180208613 21:46279546-46279568 CTGCAGCTACAGGAGATCCAGGG - Intronic
1182235428 22:28871911-28871933 CTGTATATACAGTAGATATAAGG - Intergenic
951772082 3:26269700-26269722 CAGCACCTACAGAAGATCAATGG - Intergenic
952146275 3:30536411-30536433 CTGTAGAGACAGCAGATTAATGG + Intergenic
952266109 3:31787937-31787959 ATGCACAAACAGAATATAAATGG + Intronic
952319203 3:32259934-32259956 CTGCAGATAGAGCAGCTCAACGG + Intronic
953500667 3:43430734-43430756 CTTCTGATAAAGAAGAAAAATGG - Intronic
954111530 3:48436263-48436285 CTCCAGATACAGAATAGAAAGGG + Intronic
955834185 3:63036286-63036308 TTGGAGATAAAGAAGATAATTGG - Intergenic
956232674 3:67034824-67034846 CTGCAGTCAAAGAAGGTAAAGGG - Intergenic
956892710 3:73627820-73627842 GTGCAGAATCAGATGATAAAAGG - Intergenic
957013498 3:75035590-75035612 CTGTTGAAACAGAAAATAAAAGG - Intergenic
957527301 3:81393517-81393539 CTGCAGTTACACATTATAAATGG + Intergenic
957553338 3:81734985-81735007 GTGTAGATACATCAGATAAAGGG - Intronic
958615577 3:96490046-96490068 CGGCAGAGACAGAACAAAAAAGG - Intergenic
958935946 3:100255602-100255624 CTACAGACACATATGATAAAGGG + Intergenic
961071722 3:123936038-123936060 CTGCAGATACAGAAGATAAAGGG - Intronic
963120169 3:141769608-141769630 CTGCAGATACAGATCAGAGAAGG - Intergenic
963256948 3:143154445-143154467 TTGCAGATACAGCAGATCAGTGG - Intergenic
963626000 3:147673383-147673405 CTCTGAATACAGAAGATAAATGG + Intergenic
963776081 3:149442398-149442420 CTGAAGATAGTGAAGATATATGG + Intergenic
964951947 3:162306414-162306436 TTGCTGACACAAAAGATAAAGGG - Intergenic
965664540 3:171078913-171078935 CTGCTGCAACAGAAGATGAAAGG - Intronic
965905789 3:173704067-173704089 CTGCAGGTAAAAAAAATAAAAGG - Intronic
970592345 4:17570405-17570427 CTGCAGATAGAGAGGAAAAGGGG - Intergenic
973717350 4:53690448-53690470 CTCAAGATACAGTAGTTAAATGG - Intronic
974720989 4:65737620-65737642 TTGCAGATCCAAATGATAAATGG - Intergenic
974740486 4:65999675-65999697 CTGCAGAAGCAGAAAATAAAAGG + Intergenic
975320024 4:72999411-72999433 CAGCATATATAGAAGAGAAAGGG + Intergenic
975649635 4:76579779-76579801 CTGGAGATGAAGAAGATAACTGG - Intronic
975740990 4:77428786-77428808 CTGCAGCTATAGCAGATAAAGGG - Intronic
976546207 4:86338371-86338393 CTTGAGATACACAAGACAAAAGG - Intronic
977150667 4:93507662-93507684 GTGCAGACAGAGAAGATAAGGGG - Intronic
977375133 4:96193330-96193352 CTGAAGAAGCAGAAGATAATTGG - Intergenic
977503365 4:97869529-97869551 ATGCAGTTATAGGAGATAAATGG + Intronic
977940835 4:102856859-102856881 CTACAGAGACAAAAGATAATTGG + Intronic
978002074 4:103568218-103568240 GTGTAGATAGAGAAGAGAAAAGG + Intergenic
978152346 4:105451957-105451979 CTGAAAATAAAAAAGATAAAAGG + Intronic
978508522 4:109488304-109488326 CTGTAGAGACAGAGGATTAATGG - Intronic
978890483 4:113820659-113820681 CTGCAGAGACAGAAGAATGAAGG + Intergenic
979868789 4:125790363-125790385 CTGCTGCCCCAGAAGATAAAGGG + Intergenic
980418281 4:132521990-132522012 CTGCAGCTAGAGGAGAAAAAAGG + Intergenic
980792656 4:137638981-137639003 TTGCAGAAACAGAAAATAATTGG + Intergenic
982344692 4:154344644-154344666 TTGCAGAAACAGAAGGAAAAAGG + Intronic
982465475 4:155724721-155724743 GTTCAGATACAGAAGATAACAGG - Intronic
982618476 4:157673738-157673760 TTGAAGACACAGAAGATACAAGG + Intergenic
982643846 4:157997418-157997440 CTGTAGCTAGAGAAGACAAAAGG + Intergenic
983341854 4:166470096-166470118 CTACACATACAGCAGAAAAAAGG + Intergenic
983810878 4:172060517-172060539 ATGCAGATTCAGATCATAAAGGG - Intronic
984074368 4:175156744-175156766 TGTCAGATACAGCAGATAAAGGG + Intergenic
984201636 4:176728492-176728514 CTGCAGCTACATAAAATACAAGG + Intronic
984493199 4:180462371-180462393 GTGGAGATACTGAAGATAATTGG + Intergenic
987424602 5:17758361-17758383 CTACAGATACAGAAAATACTAGG - Intergenic
989076573 5:37569943-37569965 CTGGAAATACAGAAGAAATAGGG + Intronic
989228493 5:39058973-39058995 CTGAAGACACAGAAGAGAAATGG + Intronic
990303261 5:54470472-54470494 ATCAAGAGACAGAAGATAAAAGG + Intergenic
994236342 5:97368180-97368202 CTGCAGAATCAGTAAATAAATGG - Intergenic
994412160 5:99420263-99420285 ATGCAGACAGAGAAGATCAATGG + Intergenic
994475801 5:100267336-100267358 CCACAGATACAGAAGATATCTGG + Intergenic
994481661 5:100344990-100345012 ATGCAGACAGAGAAGATCAATGG - Intergenic
995044408 5:107628933-107628955 CTGCAAATACAGAAAATAAATGG + Intronic
995215407 5:109589301-109589323 CTGCAGATGGAGAAGGTCAATGG + Intergenic
995693710 5:114856783-114856805 CTCCAGGTTCAGATGATAAATGG - Intergenic
998009975 5:138687158-138687180 ATGTAGATAGAGAAGAGAAAGGG - Intronic
998758636 5:145407635-145407657 CAGCAGCTACAGGAGTTAAAGGG - Intergenic
998986915 5:147769049-147769071 CCTCAAATACAGAAGTTAAAGGG + Intronic
999691883 5:154153722-154153744 CTGTAGAGACAGTAGATAAATGG + Intronic
1000797406 5:165682281-165682303 CTGCATATACAGCAGAAATAAGG - Intergenic
1002721279 5:181262553-181262575 CTGCAGAGACAGAAGACAGAAGG - Intergenic
1002780355 6:360343-360365 CTACAGAAACAGAAGTGAAAAGG + Intergenic
1002909580 6:1479178-1479200 CTGGAGAGAAAGAAGATAAATGG + Intergenic
1003655427 6:8002829-8002851 CCCCAGATACAGAAGAGAAGAGG + Intronic
1004496888 6:16172878-16172900 ATGGAGAGACAGAAGAGAAAAGG - Intergenic
1004679009 6:17874223-17874245 CTGCAGAGACAGAAGGGGAAAGG - Intronic
1004840765 6:19581647-19581669 CAACTGATACAGCAGATAAAGGG + Intergenic
1005449255 6:25957061-25957083 AGGCAGATTCATAAGATAAAAGG + Intergenic
1007099483 6:39235590-39235612 CTTCAGATACCGCAGATAAGTGG - Intergenic
1007556046 6:42767437-42767459 CTGCAAACACAGATGATAGATGG + Intronic
1007801098 6:44394059-44394081 TTGAAGAAACAGAAGATGAAGGG - Intronic
1008596310 6:53045309-53045331 TTGAAGATAAAGAAGAAAAAGGG - Intronic
1008906815 6:56686821-56686843 CTCCAGAAACAGAAGACAAAAGG + Intronic
1010122849 6:72399030-72399052 CTGCTGATACAAAGGATCAAGGG - Exonic
1012149514 6:95729660-95729682 CAGAAGATACAGAACCTAAAAGG - Intergenic
1012424655 6:99100673-99100695 CTTTAGACCCAGAAGATAAATGG + Intergenic
1012914684 6:105156769-105156791 GTGTAGATTCAGAAGAAAAATGG - Intergenic
1014156420 6:118115223-118115245 CTGCAGCAACAGGAGATGAAGGG + Intronic
1015782168 6:136879937-136879959 CTGAAGAAACACAAGAAAAAAGG - Intronic
1016223505 6:141705527-141705549 CTGGAGATACAGAAATGAAAAGG - Intergenic
1016529416 6:145041489-145041511 CTGCAGGTGCAGAAAATATAAGG - Intergenic
1017013195 6:150078856-150078878 CAACAGAGACAGAAGATACATGG - Intergenic
1018569431 6:165193261-165193283 CTGCAGCTACCAAAGAGAAAAGG - Intergenic
1018601186 6:165543468-165543490 GTGCAGAGACAGTAGAGAAATGG - Exonic
1019727623 7:2611740-2611762 CTGCAGAAACAGAAGCTAAGTGG - Exonic
1020395018 7:7704980-7705002 TTACAGATACAGAAGAGGAAGGG + Intronic
1020411292 7:7894735-7894757 GAGCAGATACAGAAGATGTAGGG - Intronic
1020778196 7:12483496-12483518 CTAAAGCTAAAGAAGATAAACGG + Intergenic
1020947864 7:14638124-14638146 CAGCAGGTAGAGAATATAAAGGG - Intronic
1020985020 7:15122345-15122367 CTGCAGATACAGAAGTACACAGG - Intergenic
1021194614 7:17661445-17661467 CTTCTAATACAGAAGAAAAAAGG - Intergenic
1021285291 7:18773503-18773525 CTGCAGTTGCTGAAGGTAAATGG + Intronic
1022339757 7:29456917-29456939 CTGCAGATGGGGAAGATGAAGGG - Intronic
1023235270 7:38080025-38080047 ATGCAGAAACAGAAAATAACCGG + Intergenic
1025230600 7:57201338-57201360 CTGCAGACACAGGAGATATGGGG + Intergenic
1025730395 7:64102418-64102440 CTGCAGACACAGGAGATATGAGG - Intronic
1025928907 7:65979912-65979934 CTGCAGACACAGGAGATACGGGG + Intronic
1026555475 7:71404989-71405011 CTGCAGATTCAGAAGAAAATGGG + Intronic
1026839007 7:73658267-73658289 CTCCAGATACCGCATATAAATGG - Intergenic
1029910634 7:104143539-104143561 CTGAAGATGCAGCAGCTAAAAGG + Intronic
1030064693 7:105650577-105650599 CAGCAGAGACAAAAGAAAAATGG + Intronic
1030524056 7:110632476-110632498 CTGCAGACACAGCAGTTGAATGG + Intergenic
1030963242 7:115953523-115953545 CTGCAGACACAGAAGAGAGAAGG + Intronic
1031275744 7:119720960-119720982 CAGCATATAAAAAAGATAAAAGG - Intergenic
1032914952 7:136479372-136479394 ATGCAGATTCAAATGATAAATGG - Intergenic
1033002670 7:137524646-137524668 CTGCACACACAGCAGATAAAAGG + Intronic
1034862785 7:154614097-154614119 CTGCAAAGAGAGAAGAGAAAGGG - Intronic
1035043238 7:155946092-155946114 ATGCAGAGACAGAAGTTCAAGGG + Intergenic
1035189236 7:157151297-157151319 CTACTGATACAGAAGGTAAGAGG - Intronic
1036098127 8:5747512-5747534 CTACAGTTGCAGAAGATGAAAGG - Intergenic
1036127651 8:6078024-6078046 CTGCAGAAACAGAGAATAAGAGG + Intergenic
1036481083 8:9140249-9140271 GTGCAGCTGCAGAAGAGAAATGG - Exonic
1036501075 8:9314306-9314328 CTACATATACATAAGATAAAAGG - Intergenic
1037422949 8:18723592-18723614 CTGGAGATACAGAAGGAACAGGG - Intronic
1039231178 8:35449959-35449981 TTGTGGATAAAGAAGATAAATGG - Intronic
1039312353 8:36330965-36330987 GTCCAGTGACAGAAGATAAATGG + Intergenic
1039571209 8:38587860-38587882 CTGCACCTGCAGAAGATGAAGGG - Intergenic
1040730244 8:50436849-50436871 CTGCATATACAAAAGCAAAAAGG - Intronic
1040835134 8:51723349-51723371 TTGCAGCTACAGATGAGAAAAGG + Intronic
1041306846 8:56470591-56470613 TTGCAGATACTCCAGATAAAAGG - Intergenic
1042303988 8:67312765-67312787 CTACAGAGAGGGAAGATAAAAGG + Intronic
1044372805 8:91433236-91433258 CTGCAGATACAACAAATAATGGG + Intergenic
1045121524 8:99042490-99042512 CTGTAGGTACATGAGATAAAAGG - Intronic
1045703808 8:104897149-104897171 CTGCAGATGCACAAGAAACAAGG + Intronic
1045740460 8:105352614-105352636 CAGCAGATCCAGATAATAAAAGG - Intronic
1045814043 8:106258748-106258770 CAAAAAATACAGAAGATAAATGG - Intergenic
1046347732 8:112956899-112956921 ATACAGATGCAGAAGATGAAAGG + Intronic
1046496875 8:115025495-115025517 CTGCAGTTACAGAGCATAAATGG + Intergenic
1046705258 8:117442216-117442238 CTGCAGATGAAGCAGAGAAAAGG - Intergenic
1048438932 8:134445549-134445571 CTGCAGATAAAGTAGAAAATTGG + Intergenic
1048499627 8:134963890-134963912 CTGCAGATGCAGGAGAAAAAGGG - Intergenic
1048509935 8:135053171-135053193 CTGCAGATACAGAGGGCCAATGG - Intergenic
1049895922 9:112079-112101 CAGCAGATAAAGAAGACACAAGG + Intergenic
1050835087 9:10067227-10067249 CTGAAGTAACAGGAGATAAATGG - Intronic
1051585507 9:18722728-18722750 CTTCAAATACAGAAGTTAAGAGG + Intronic
1051667556 9:19479859-19479881 CTGCAGATAAAGAAGACTGAAGG - Intergenic
1051669548 9:19495781-19495803 CTGCACATACTGAAAAGAAATGG - Intergenic
1051857710 9:21588439-21588461 CTGTAAATACAGAAAATAATAGG - Intergenic
1052931616 9:34060356-34060378 CTGAAAATTCAGTAGATAAATGG + Intergenic
1053616995 9:39778081-39778103 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1053739104 9:41122262-41122284 CAGCAGATAAAGAAGACACAAGG + Intergenic
1053875176 9:42537430-42537452 CTGCAGCAACAGAAGGAAAATGG + Intergenic
1054236521 9:62564298-62564320 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054267172 9:62929356-62929378 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054550661 9:66598801-66598823 CTGCAGCAACAGAAGGAAAATGG - Intergenic
1054689246 9:68309060-68309082 CAGCAGATAAAGAAGACACAAGG - Intergenic
1055467694 9:76582028-76582050 CTGCAGAGGGAGAAGAGAAAGGG + Intergenic
1055593540 9:77842976-77842998 CTGCAGATATCCAAAATAAAAGG - Intronic
1057939912 9:99272895-99272917 TTTCATATACAGCAGATAAAGGG - Intergenic
1058531294 9:105907495-105907517 CTGCAAATAAAGCAGAGAAATGG - Intergenic
1058645894 9:107131254-107131276 CTGCAGATTCAAAAGACAAGTGG - Intergenic
1059202507 9:112431145-112431167 CTGCAGATAGAGCAGATGGAGGG + Intronic
1059648572 9:116292801-116292823 CTGTAGATAAAAAAGAAAAAGGG + Intronic
1062422234 9:136488346-136488368 CTGTAGATAGGGAAGAGAAAAGG + Intergenic
1186004642 X:5055807-5055829 CACCAGAAACAGAAGATAAATGG + Intergenic
1188553286 X:31384029-31384051 CTGCAGATGGCAAAGATAAAAGG + Intronic
1190121644 X:47665069-47665091 CTTCCTATACAGAAGATAACAGG + Intergenic
1190210959 X:48447494-48447516 CTGAAAATACAGAAAAAAAATGG - Intergenic
1190286807 X:48966845-48966867 CTGCAGAGAGAGGAGATAAAAGG + Intronic
1190539387 X:51461596-51461618 AGGCAGATAGAGAAGGTAAAAGG + Intergenic
1194003972 X:88467579-88467601 AGGCACATACAGAAGATACATGG - Intergenic
1194497034 X:94629216-94629238 CTCCAGTTACAGAACATAAGAGG + Intergenic
1194939977 X:99997977-99997999 CTGCAGTAACAGAAGACAAGGGG - Intergenic
1195536733 X:106015898-106015920 CTGCAAATACAGAAGCAATAGGG + Intergenic
1196046559 X:111261829-111261851 TTGAAGACACAGAAGAGAAAAGG - Intronic
1197466825 X:126815009-126815031 CTGCACATATAGAAGATATAGGG - Intergenic
1198267230 X:135021406-135021428 CTGCAAATTCAGAAGAGAAATGG + Exonic
1198270311 X:135051058-135051080 CTGCAAATTCAGAAGAAAACAGG + Exonic
1198521868 X:137461195-137461217 CTGCAGATTCAGTAGGCAAAAGG + Intergenic
1199133706 X:144226773-144226795 CTGGAGATAAAGGAAATAAAAGG - Intergenic
1199181795 X:144866009-144866031 CAGCAGATACATTGGATAAAGGG - Intergenic
1201312660 Y:12611024-12611046 CTGCAGCTGCATAAGATAAGGGG - Intergenic
1201508705 Y:14733926-14733948 CTGCAGATGGCAAAGATAAAGGG - Intronic
1202586252 Y:26430934-26430956 CTACACATACAGCAGATAAGGGG + Intergenic