ID: 961073200

View in Genome Browser
Species Human (GRCh38)
Location 3:123956644-123956666
Sequence TCTACCCCAGAAAATTAGGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 179
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 169}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961073200 Original CRISPR TCTACCCCAGAAAATTAGGT AGG (reversed) Intronic
903452945 1:23467026-23467048 TCTACTACAGAAAATTAGCCAGG - Intronic
907001088 1:50857653-50857675 TCTCCACCAAAAAATTACGTGGG + Intronic
907701508 1:56792569-56792591 TCAACCTCAGAAAATAAAGTTGG - Exonic
910448509 1:87324012-87324034 TCTACCAAAAAAAATTAGCTGGG + Intergenic
910613431 1:89169594-89169616 TCCAGGCCAGAAAATTGGGTTGG - Intronic
912219927 1:107661901-107661923 CCTACCACGGAAAATTAAGTTGG + Intronic
923143674 1:231182946-231182968 TCTAGCTAAGAAAATTTGGTTGG + Intronic
1063836061 10:10014095-10014117 TCTATCACATAAAATTATGTAGG + Intergenic
1064985112 10:21202146-21202168 TGCACCCCACAAAGTTAGGTGGG + Intergenic
1065046449 10:21750995-21751017 AATACCCTAGAAAATTAAGTTGG + Intergenic
1072281942 10:93873638-93873660 TGTTCCCCATTAAATTAGGTTGG + Intergenic
1073533841 10:104256455-104256477 ACTGCCCCAGTAAATAAGGTAGG - Intronic
1073808087 10:107121972-107121994 TCTACCTCCAAAAATTAGTTTGG + Intronic
1073831958 10:107394740-107394762 CTTACCCCTCAAAATTAGGTAGG - Intergenic
1078849281 11:15149329-15149351 TCCTCCCCAGAAAATTGCGTGGG - Intronic
1079629978 11:22662761-22662783 TCTAACCCAGAAACTTTGGAGGG + Intronic
1079971643 11:27042511-27042533 TCTACAAAAGAAAATTAGGCAGG - Intronic
1080281681 11:30564385-30564407 ACGTCCCCAGAAAATTTGGTAGG + Intronic
1081235790 11:40645775-40645797 TGTACCCCAGAAACTCAGATTGG - Intronic
1083791749 11:64990188-64990210 TCTACCACAGGGAATTTGGTGGG - Intronic
1083916870 11:65752070-65752092 TCTACCAAAAAAAATTAGCTGGG - Intergenic
1085298965 11:75447477-75447499 ACTACCCCAGAAAAAAAAGTAGG + Intronic
1086382575 11:86272928-86272950 TGTAACCCAGAAAGTTAGGGGGG - Intronic
1086876281 11:92099619-92099641 TCTACCACAGAAAAATGGTTTGG + Intergenic
1089317976 11:117605138-117605160 GCTACTCCAGAGAATGAGGTGGG - Intronic
1089390924 11:118101117-118101139 GCTTCCCCAGAGAATTAGATGGG + Intronic
1092024673 12:5230773-5230795 TCTACACAAGACAATTAGGCAGG - Intergenic
1093946621 12:25117043-25117065 GCTACCCCAGAAGCTGAGGTGGG - Intronic
1096693919 12:53336962-53336984 TCTGCCCCACAAAGTGAGGTAGG - Intronic
1096878604 12:54648957-54648979 TCTACCCCAGAAAATTCTCCTGG + Intergenic
1097589553 12:61557443-61557465 TCTACCCCACAGAATTATTTAGG + Intergenic
1099147328 12:79063400-79063422 TCTGCCCCTGAAAACTATGTAGG + Intronic
1100229980 12:92597131-92597153 TCTTCACCAGAAAATAAGGCTGG + Intergenic
1100534352 12:95492723-95492745 TCTACCAAAAAAAATTAGCTGGG - Intronic
1100803770 12:98260336-98260358 TCTAAGGAAGAAAATTAGGTAGG - Intergenic
1101446894 12:104742975-104742997 TCTCCACCAGAAGATGAGGTGGG + Intronic
1102867688 12:116387011-116387033 TTTACGCCGGAAAATTAGGTGGG - Intergenic
1103769910 12:123313921-123313943 TCTACTACAAAAAATTAGCTGGG + Intronic
1109515071 13:63433278-63433300 TCTATCCTTGCAAATTAGGTTGG - Intergenic
1109530155 13:63632369-63632391 TCTGGCCAAGAAAAGTAGGTTGG - Intergenic
1110343449 13:74418939-74418961 TCTATCCCTGGAGATTAGGTAGG + Intergenic
1110520689 13:76472529-76472551 TCTACCTCAGAAAAGGAGGCGGG + Intergenic
1111112837 13:83736655-83736677 ACTACCGCAGAAAATTAACTTGG - Intergenic
1111833557 13:93359260-93359282 TCTACACAAGAATATTAGGTTGG - Intronic
1115163153 14:30418469-30418491 CCTCCTCCAGAAAATTAGGAAGG - Intergenic
1115395996 14:32909235-32909257 TCTACCCCAGAGGATGAGGTAGG + Intergenic
1118432095 14:65729184-65729206 TCTACCATAAAAAATTAGCTGGG - Intronic
1122495991 14:102155884-102155906 TCTACCTGAGAAAGTCAGGTGGG - Intronic
1123710495 15:22983328-22983350 TATCCCCCAGAAGATGAGGTGGG - Intronic
1125192567 15:37010541-37010563 TCTACCAAAAAAAATTAGGAAGG - Intronic
1127408849 15:58684463-58684485 TCCACCCCAGAAAGTGAGGTGGG + Intronic
1127700744 15:61497837-61497859 TCTAACAGTGAAAATTAGGTGGG + Intergenic
1134440913 16:14299180-14299202 GCTACGCCAGAAACTGAGGTGGG - Intergenic
1136384478 16:29914596-29914618 TCTACTAAAGAAAATTAGCTGGG - Intronic
1137656287 16:50161081-50161103 TCCACCCCAGAATATTTGGTAGG + Intronic
1138905406 16:61325152-61325174 GCTACCCCAGAGACTGAGGTGGG + Intergenic
1140892500 16:79297180-79297202 GCTACCCCATAATATTAGGATGG - Intergenic
1141106390 16:81237223-81237245 TCTACCAAAAAAAATTAGCTGGG - Intergenic
1142273723 16:89104731-89104753 TCATCCCCGGAAAATAAGGTTGG + Intronic
1143681066 17:8476420-8476442 TCTGCCCCAGAAGACCAGGTCGG - Intronic
1144271140 17:13617251-13617273 ACTACCCCAGAGACTGAGGTGGG + Intergenic
1145778698 17:27547197-27547219 TTTCCCCCAGAAAACTAGTTTGG - Intronic
1146099747 17:29969138-29969160 TCTACTCCAGGAACTAAGGTGGG - Exonic
1149558278 17:57589725-57589747 TCTTCTCCAGAAAAGTAGGGGGG + Intronic
1149823431 17:59802724-59802746 GCAAACCCAGAAAATTAGCTAGG - Intronic
1150526948 17:65933635-65933657 TCTTCCCCCGAAAATGAGGGAGG + Intronic
1150903410 17:69310243-69310265 TCTACTCCAGAAGCTGAGGTGGG - Intronic
1153199084 18:2631033-2631055 TCTACTCCAGAGGATGAGGTAGG + Intergenic
1154220387 18:12447920-12447942 TATACTCCAGACAGTTAGGTGGG - Exonic
1158007595 18:52691060-52691082 TGTACCCCAGAATATTCTGTTGG + Intronic
1158367435 18:56753603-56753625 TGTCCCCCAGTAAATTTGGTGGG - Intronic
1159305116 18:66630837-66630859 TTTACCCATGAAAACTAGGTTGG - Intergenic
1160078003 18:75695844-75695866 TCTCCCCCAGAAACTTCGGAAGG + Intergenic
1163111640 19:15164890-15164912 GCTACTCCAGAAACTGAGGTGGG - Intronic
933235990 2:79865220-79865242 TCTGCCCCATAAAGTTAAGTTGG - Intronic
935151606 2:100441702-100441724 CCTACACCACAAAATAAGGTTGG + Intergenic
935159196 2:100514593-100514615 AATACCCCAAAAAATTAGCTAGG - Intergenic
935274158 2:101461912-101461934 CCTACCCCAGAAAACTTGCTGGG - Intronic
935278598 2:101497648-101497670 GCTACCCCAGAGACTGAGGTGGG - Intergenic
936828903 2:116616809-116616831 TATACATCAGAAAATTAGATAGG + Intergenic
938224478 2:129604161-129604183 TCTACCCCCCAAAATCAGGCTGG + Intergenic
939036579 2:137138602-137138624 TGTCCTCCAGAAAATTGGGTGGG + Intronic
939101836 2:137903877-137903899 TCTACCCAATAGAATTTGGTAGG + Intergenic
940324778 2:152413587-152413609 TGTCCCCCAGAAAAGTAGTTAGG + Intronic
944762830 2:202834940-202834962 GCTACTCCAGAAGCTTAGGTGGG - Intronic
945995022 2:216429365-216429387 TCAATCCCAGTAATTTAGGTGGG - Intronic
1169338529 20:4777226-4777248 TATACCCCCCAAAATTAGCTGGG - Intergenic
1169847227 20:10007578-10007600 TGTTCCCCAGAAACTTGGGTTGG + Intronic
1171367754 20:24637795-24637817 TCTACACCAGCCAACTAGGTGGG - Intronic
1172043604 20:32063411-32063433 TCTACCCAAAAAAATTAGCCAGG - Intronic
1173270639 20:41531647-41531669 TCTACCACAGAAACTTGGGTGGG - Intronic
1174091858 20:48055456-48055478 TCTACCCCAGGATATTAGTTAGG - Intergenic
1176202719 20:63869965-63869987 TCTACCCCCAAAAATTAGCCAGG + Intronic
1176453705 21:6888559-6888581 TCTACCCAATAGAATTTGGTAGG + Intergenic
1176831880 21:13753607-13753629 TCTACCCAATAGAATTTGGTAGG + Intergenic
1177955839 21:27598021-27598043 TGTCCCCCATAAAAGTAGGTAGG + Intergenic
1180143441 21:45906782-45906804 TCCACCCCTGAAAATTTAGTAGG - Intronic
1183471325 22:38008382-38008404 TCTACTACAAAAAATTAGCTGGG + Intronic
1183772095 22:39935613-39935635 TCTATCCCAGAAAAGTGGGAGGG - Intronic
950813806 3:15676708-15676730 TTTCCTTCAGAAAATTAGGTAGG + Intronic
950971891 3:17197535-17197557 TCTACCAAAAAAAATTAGCTGGG - Intronic
953801458 3:46027039-46027061 AATACCCCAAAAAATTAGCTAGG - Intronic
954979442 3:54731026-54731048 TCTACCACACAGAACTAGGTTGG + Intronic
956637432 3:71380248-71380270 ACTACCCAAGAACATCAGGTTGG + Intronic
956994321 3:74806569-74806591 AGTGCCCCAGAAAATTAGCTGGG + Intergenic
959982314 3:112529540-112529562 TCTTCCCCTGAATATTAGGAAGG - Intergenic
960915262 3:122688536-122688558 TCTACACCAGATACTTAAGTTGG + Intronic
961073200 3:123956644-123956666 TCTACCCCAGAAAATTAGGTAGG - Intronic
962322090 3:134399231-134399253 GCTACTCCAGAAAATGAGGCAGG - Intergenic
962726266 3:138230539-138230561 GCTACCCCAGAGACTGAGGTGGG + Intronic
963118296 3:141752870-141752892 TGTACCCAAGAAAACTATGTAGG + Intergenic
963716096 3:148805534-148805556 TCTACCACAAAAAATTAGCCGGG + Intronic
964196604 3:154072179-154072201 CCTACCTCAGAAAGTTAGGAAGG + Intergenic
967592280 3:191292651-191292673 TCTAACCAGGACAATTAGGTAGG - Intronic
968669323 4:1840369-1840391 TCTGCCTCAAAAAATAAGGTTGG + Intronic
969193701 4:5543997-5544019 TCGACCTCAGAACATCAGGTCGG + Intronic
970894879 4:21090434-21090456 TATACCCCCAAAACTTAGGTAGG + Intronic
971386611 4:26146274-26146296 TTTTCCCCAGTAAATTATGTTGG - Intergenic
972372720 4:38440263-38440285 TCTACCCAAGAAAATGTGGGTGG + Intergenic
972463497 4:39329333-39329355 TCTACCAAAAAAAATTAGCTGGG + Intronic
973100345 4:46260275-46260297 TCTTTTCCTGAAAATTAGGTTGG + Intronic
977639470 4:99340251-99340273 TCTACCCAAAAAAATTAGCTGGG + Intronic
978535199 4:109754705-109754727 TCTACCCCAGAAAACAACTTAGG - Intronic
982016150 4:151155431-151155453 TCTTCTCCAGATGATTAGGTGGG + Intronic
983783756 4:171705881-171705903 ACTACCCCAGAAAAGTAGCATGG - Intergenic
988063844 5:26208898-26208920 TCTATTCCAAAAAATTAAGTAGG + Intergenic
991858046 5:70987356-70987378 TATATCCCAGAGAACTAGGTAGG + Intronic
991871204 5:71112242-71112264 TATATCCCAGAGAACTAGGTAGG + Intergenic
994540925 5:101095837-101095859 TTTACCCCAGAAAATTCTCTTGG - Intergenic
994728852 5:103468538-103468560 TTGATCCCAGAAAATTAGGAAGG + Intergenic
995045712 5:107643984-107644006 TCTTCCCTAGAAAATCAGGGAGG + Intronic
995502579 5:112823709-112823731 TCTACCCCAGAAACTGTGCTAGG + Intronic
996038615 5:118786201-118786223 CCAGGCCCAGAAAATTAGGTAGG + Intergenic
997770946 5:136552489-136552511 TCTACTCCAGAAAATTAAAGAGG - Intergenic
997971021 5:138402087-138402109 TCTACCAAAAAAAATTAGCTGGG - Intronic
999312543 5:150560996-150561018 TTTACCCCTAAATATTAGGTTGG - Intergenic
1000454546 5:161433496-161433518 GCTACCCAAGAGACTTAGGTGGG + Intronic
1001096738 5:168781157-168781179 TCTACCCCAGAGACATAGGAGGG + Intronic
1002484698 5:179526681-179526703 TTTACCCCAGAAGAATAAGTGGG + Intergenic
1003340088 6:5212390-5212412 TCTACCCCAGACAATTAACAAGG - Intronic
1004964350 6:20831043-20831065 TCCACCCTATAATATTAGGTTGG + Intronic
1009055125 6:58325994-58326016 TCTACACAATAAAATTAAGTAGG + Intergenic
1012635766 6:101538898-101538920 ACTACCACATAAAATTTGGTTGG - Intronic
1012909562 6:105103946-105103968 TCTGCCCCAGCAAATATGGTGGG - Intronic
1012910509 6:105112679-105112701 GTTTCCCCAGAAAAGTAGGTGGG + Intronic
1022728880 7:33004495-33004517 TCTACCCCAGATAACTTGTTCGG + Intronic
1022895818 7:34749469-34749491 TCTACCTTATAAAATTAGGGTGG - Intronic
1023186885 7:37541589-37541611 TCTACCCTAGAGCATTAGGAGGG - Intergenic
1025044769 7:55683495-55683517 TCTACCCCAGATAACTTGTTCGG - Intergenic
1026174021 7:67980019-67980041 TGTATCCAAGAAAATAAGGTAGG - Intergenic
1026536813 7:71245328-71245350 TCTGCCTCACAAAATTAGGATGG - Intronic
1029715436 7:102322902-102322924 TCTACCAAAAAAAATTAGCTAGG - Intergenic
1030120334 7:106104134-106104156 TCTACCACAGGGAATTGGGTAGG - Intronic
1031842089 7:126755712-126755734 ACTACCCTAGAGAATTAGCTGGG + Intronic
1036198869 8:6749243-6749265 TCTACTGCAGAAAGTTAGGGAGG + Intronic
1038793400 8:30688809-30688831 TCTACTCCAGAAGCTGAGGTGGG + Intronic
1039339219 8:36628409-36628431 TTTCCTCCAGAAAACTAGGTTGG - Intergenic
1040406165 8:47105161-47105183 TCTCCCCCAAAAAATAAAGTGGG + Intergenic
1042260152 8:66850249-66850271 TTTAACCCACCAAATTAGGTTGG + Intronic
1042785503 8:72541764-72541786 TCGACCACAGAAAATGAGGCTGG + Intronic
1044557356 8:93578307-93578329 TCTAACCCAGAGAGTTAGTTTGG - Intergenic
1050879269 9:10678725-10678747 TCTACCCCAGGAGGTGAGGTAGG + Intergenic
1052531439 9:29689507-29689529 GAAACCCCAGAAAATTAGCTGGG - Intergenic
1053008362 9:34619427-34619449 TCTACCCCTAAACTTTAGGTAGG - Intronic
1053067973 9:35081723-35081745 TCTACTCGGGAAACTTAGGTGGG + Intergenic
1055219495 9:73911192-73911214 TCCCCCCCAAAAAATTAGCTTGG + Intergenic
1055492557 9:76820502-76820524 TCTACCCAAGAAAATTAACTGGG + Intronic
1056807513 9:89740417-89740439 TTTTCCCCAGAAAATGAGGAAGG - Intergenic
1061558875 9:131389820-131389842 TCTACCTGCGAAAATTGGGTGGG - Intergenic
1185669743 X:1798406-1798428 TCTATCCCAGAAATGTGGGTTGG - Intergenic
1187735938 X:22303721-22303743 GCCACCACAGAAAGTTAGGTGGG - Intergenic
1191075252 X:56446170-56446192 CACACCCCAGAAAAGTAGGTTGG - Intergenic
1192109668 X:68351414-68351436 TATATCCCAGAAAATAAGGAAGG + Intronic
1194156674 X:90398367-90398389 TCTTCCCTAGAAACTTAGCTGGG + Intergenic
1195132586 X:101868459-101868481 GAAACCCCAGAAAATTAGCTGGG - Intergenic
1197743779 X:129916443-129916465 CCTACCCCAGTCACTTAGGTTGG + Intronic
1197772141 X:130095961-130095983 TCTACCACAGAGAATAGGGTGGG - Intronic
1200503023 Y:3975352-3975374 TCTTCCCTAGAAACTTAGCTGGG + Intergenic
1201322993 Y:12721018-12721040 TCTAGCCTAGACAAATAGGTAGG + Intronic