ID: 961074338

View in Genome Browser
Species Human (GRCh38)
Location 3:123967706-123967728
Sequence GCAGGTGCAGCCCAGTGCTG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 425
Summary {0: 1, 1: 1, 2: 6, 3: 47, 4: 370}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961074338 Original CRISPR GCAGGTGCAGCCCAGTGCTG TGG Intergenic
900124599 1:1063888-1063910 GCAGATGCAGCCCGCTGCAGTGG - Intergenic
900135267 1:1114533-1114555 GCCTGTGCACCCCAGGGCTGAGG + Intronic
900375243 1:2351240-2351262 GCAGCAAAAGCCCAGTGCTGGGG - Intronic
901627336 1:10631594-10631616 GTGGGTGCAGCCCAGTACTGGGG - Intergenic
902286661 1:15411715-15411737 GCACAGGCAGCCCAGGGCTGAGG + Intronic
903357468 1:22756713-22756735 GCAGGTGCCGCCTTGTTCTGGGG - Intronic
903754503 1:25651489-25651511 GAAGGGGCAGCCCAGCACTGTGG + Intronic
903861514 1:26367564-26367586 GCAGGTGCAGCCCGGTGCCCTGG + Intronic
904754596 1:32761131-32761153 AGAGGTGCAGCCTAGGGCTGAGG - Intronic
904756862 1:32772723-32772745 GGGTGTCCAGCCCAGTGCTGCGG + Intronic
905770622 1:40635893-40635915 GTGCGTGCAGCCCCGTGCTGTGG - Intronic
905868956 1:41391999-41392021 GCAGCTGCAGCCCAGCTGTGGGG - Intergenic
906072329 1:43026113-43026135 CCATGTGCACCCCACTGCTGAGG - Intergenic
906149431 1:43578953-43578975 GCAGGTGCAGCACAGCTCTGTGG - Intronic
906154849 1:43607925-43607947 GTGGGCTCAGCCCAGTGCTGGGG - Intronic
906708548 1:47912671-47912693 GAGAGGGCAGCCCAGTGCTGGGG + Intronic
907629589 1:56066802-56066824 ACAGGGGAAGCCCAGGGCTGTGG - Intergenic
910751311 1:90634135-90634157 GCAAGTGCAGCCCAATGGGGTGG - Intergenic
912949464 1:114110799-114110821 GATGGTGCAGGCCAGAGCTGAGG - Intronic
913410078 1:118541955-118541977 GGAGGTTCAGCCCAGTGAGGAGG - Intergenic
914831847 1:151176002-151176024 GCAGGAGGAGCCCGGTGCCGGGG + Exonic
915162581 1:153930696-153930718 GCAGGTGCAGGCCAGTGGGTGGG + Exonic
917853166 1:179082272-179082294 GCAGGAGCAGCTCAGGGCGGCGG + Exonic
918614772 1:186531860-186531882 GCAGGTCCTGCCCAGTGAGGAGG + Intergenic
919786426 1:201261192-201261214 GCGGGTTCACTCCAGTGCTGGGG - Intergenic
920357756 1:205387671-205387693 GCATTTGGAGCCCAGAGCTGGGG + Intronic
920380627 1:205532613-205532635 TCAGGATCAGCCCAGTGTTGAGG - Intronic
920758018 1:208753808-208753830 GCAAGTGCAGCCAAGTTCTGGGG + Intergenic
921265611 1:213418463-213418485 TCAGCTGCCGCCCAGTGCTCAGG - Intergenic
921384127 1:214552092-214552114 GCGGGAGCAGCCCAGGGTTGGGG - Intronic
922037549 1:221863862-221863884 ACAGGTTCACACCAGTGCTGAGG + Intergenic
1062768524 10:82720-82742 GCAGGTGTTGCCCAGAGCTCCGG - Intergenic
1062790198 10:298788-298810 GGAGGTGCAGCCCAGTGACAGGG - Intronic
1064018064 10:11788030-11788052 GCAGGTGCAGCTCTGTGCCAGGG - Intergenic
1064971682 10:21073023-21073045 ACTGGTGGAGCCCTGTGCTGTGG - Intronic
1065298697 10:24301484-24301506 CCAGGTGCAGCATAGTGCTCAGG + Intronic
1066758199 10:38730843-38730865 GCAGGTGCCGCCTACTGCTCTGG - Intergenic
1067176559 10:43953868-43953890 GCTCGTGCAGCACAGAGCTGGGG + Intergenic
1067324437 10:45253572-45253594 CCAGGCACATCCCAGTGCTGAGG + Intergenic
1067525864 10:47038198-47038220 GGAGGTGCTGCCCAGTCTTGAGG + Intergenic
1067962176 10:50866420-50866442 GCAGCTGCAGCCAAGTGACGAGG - Intronic
1068778199 10:60890498-60890520 GTAGATGCAGTACAGTGCTGGGG + Intronic
1068911626 10:62384178-62384200 GTGGGTGCAGACCAGTGTTGGGG - Intronic
1069930605 10:71878994-71879016 CCAGGTGCAGCCATGTGCGGTGG - Intergenic
1072305490 10:94102713-94102735 GGGAGTGCAGCCCAGGGCTGGGG - Intronic
1072539095 10:96384821-96384843 GCAGGTGCAGCAGTGTGCTGGGG - Intronic
1072616157 10:97049973-97049995 GCAGGGCATGCCCAGTGCTGTGG - Intronic
1072927041 10:99624885-99624907 GCAGGTGCAGGAAACTGCTGAGG - Intergenic
1073564708 10:104525282-104525304 GGAACTGGAGCCCAGTGCTGGGG + Intergenic
1073577411 10:104638478-104638500 GCAGGGGCAGCTCAGGGCTGAGG + Intergenic
1074784574 10:116827606-116827628 GCAGGGCCAGCGCAGTGGTGGGG + Intergenic
1075612613 10:123865720-123865742 GCAGCTACTGCCCAGAGCTGAGG + Intronic
1077181400 11:1218809-1218831 GCAGGGGCAGCCCAGGGCACCGG + Intergenic
1077571748 11:3345497-3345519 GCTGGAGAAGCCCAGTGATGGGG - Intronic
1078613939 11:12847397-12847419 GCAGACCCAGCCCACTGCTGGGG + Intronic
1079104050 11:17559162-17559184 GTAGGTGCAGCCCAGTAGTGGGG + Intronic
1079118135 11:17653672-17653694 GACGGCCCAGCCCAGTGCTGGGG + Intergenic
1079124716 11:17710141-17710163 GGAGGAGCAGCTCAGGGCTGAGG - Intergenic
1079434907 11:20438223-20438245 CCAGGGTCAGGCCAGTGCTGTGG - Intronic
1079882415 11:25944150-25944172 GCAGTTGCACCCCAGAGCTCCGG + Intergenic
1081235243 11:40639298-40639320 GCTGGTGCAGGCCAGTGCAAGGG - Intronic
1083400987 11:62423505-62423527 GCTGGTGCAGCCCAGCGGGGAGG - Intergenic
1083545148 11:63543854-63543876 TCAGGGTCAGCCCAGTGCAGTGG + Intronic
1083603424 11:63962515-63962537 GGAGCTGCACCCCAGTCCTGAGG - Intergenic
1083614129 11:64018146-64018168 GTGGCTGCGGCCCAGTGCTGGGG + Intronic
1083635417 11:64118109-64118131 GCATCTGCAGCCCAGGGCCGCGG - Exonic
1083827196 11:65210540-65210562 GCAGATACAGGCCAGTGCTGTGG + Intronic
1084087344 11:66860619-66860641 ACAGGGGCGGCCCAGGGCTGCGG + Intronic
1084178917 11:67437121-67437143 GCTGGGGCAGCCCCGTGGTGGGG - Intronic
1084188225 11:67486569-67486591 GCAGGTGAAGCCACGTGCTTGGG - Intronic
1084695974 11:70755813-70755835 GGAGGGGCCTCCCAGTGCTGGGG + Intronic
1085049364 11:73372217-73372239 TCTGGACCAGCCCAGTGCTGAGG - Intergenic
1085052434 11:73386784-73386806 GCAGGTGCCACCCAGGGTTGGGG + Intronic
1086542234 11:87926800-87926822 AGAGCTGCAGCTCAGTGCTGCGG - Intergenic
1088462118 11:110093118-110093140 GCCGCGGCAGCCCAGGGCTGAGG + Intergenic
1089519214 11:119052554-119052576 GCACGAGCAGCCCAGTTCAGTGG + Intronic
1090044000 11:123315247-123315269 GCTGCTGCAGCGCAGTGCTGGGG - Intergenic
1090178622 11:124673825-124673847 GCGAGTACAGCCCAGTCCTGAGG - Exonic
1090339677 11:126005920-126005942 GAAGGTCCATCCCAGTGCAGTGG - Exonic
1092525844 12:9309965-9309987 GCAGCTGCTGGCCTGTGCTGGGG + Intergenic
1094045101 12:26158689-26158711 GCAGGAGCAGCCCTGCCCTGAGG - Intronic
1098263793 12:68698127-68698149 GAAGATCCAGGCCAGTGCTGTGG + Intronic
1098983516 12:76985293-76985315 GCAGGGGCAGACCAGTGTTCTGG + Intergenic
1101150840 12:101881007-101881029 GCAGGGGCAATCCAGTGCTCCGG - Intronic
1102577206 12:113863306-113863328 GCAGCTGCTGGCCAGGGCTGGGG - Intronic
1103583207 12:121931688-121931710 GCGTGTTCAGCCCAGAGCTGGGG - Intronic
1103966104 12:124640720-124640742 GCAGATGAAGCTCTGTGCTGTGG - Intergenic
1104272470 12:127294366-127294388 TCAGGTACAGCATAGTGCTGCGG + Intergenic
1104410398 12:128553016-128553038 GCAGGTGCAGGGAAGTGCTGTGG + Intronic
1104787154 12:131457147-131457169 GCTGGCGGAGCCCAGGGCTGGGG - Intergenic
1112033723 13:95478912-95478934 GCAGTTGCAGCCCTGTGCCAGGG - Intronic
1112431433 13:99354110-99354132 GCAGGTGCAGAGCAGTGAAGGGG - Intronic
1112454145 13:99543009-99543031 ACAGGTGCAGCAGAGTGCTGAGG - Intronic
1113638529 13:111939446-111939468 GCAGGCACAGCCCTGGGCTGGGG + Intergenic
1113743098 13:112724658-112724680 GAAGCTGCAGCCCTGTCCTGGGG + Intronic
1113960045 13:114121181-114121203 GCAGGTGCATCCCAGCACTGCGG + Intronic
1114670371 14:24407882-24407904 GCCTGTGCAGCCCAGAGCTGTGG + Exonic
1115271337 14:31556934-31556956 CCAGGTGGAGCTCAGTGCAGTGG - Intronic
1115713513 14:36076427-36076449 GCAGGAGCAGCCCAGGAGTGTGG + Intergenic
1116561218 14:46381739-46381761 GCAGGTGCAGGCCAGTGACATGG - Intergenic
1116734571 14:48672004-48672026 ACAGGTTCAGACCATTGCTGGGG - Intergenic
1118861884 14:69670764-69670786 GCAGGTACAGCCCGCTGTTGCGG + Intronic
1118867043 14:69712067-69712089 GCAGCTCCAGCCCGGTCCTGAGG + Exonic
1119652134 14:76391478-76391500 GAAGCTGCAGCTCATTGCTGGGG + Intronic
1120319358 14:82939861-82939883 GCAGGGGCAGCCCAGAGCAAAGG - Intergenic
1120941557 14:89954907-89954929 GGGGGTGGAGCCAAGTGCTGGGG - Intergenic
1121107250 14:91289145-91289167 ACAGTTGGAGCCCAGTGCGGGGG + Exonic
1122320836 14:100854824-100854846 ACATGTGCAGGCCAGGGCTGAGG - Intergenic
1122539765 14:102491620-102491642 GAGGCTGCAGCCCAGTGGTGAGG - Intronic
1122799740 14:104223554-104223576 GCATGAGCAGCTGAGTGCTGGGG + Intergenic
1122898627 14:104772814-104772836 GCAGGTGCAGCCTGGGGATGAGG + Intronic
1122904825 14:104796810-104796832 GCAGGTTCGGCCCAGTGCTCAGG + Intergenic
1122920517 14:104878090-104878112 GCAGGTGGAGCCCAGCCCTAGGG - Intronic
1122950672 14:105042777-105042799 GCAGGAGGAACCCAGTGCTTCGG - Intergenic
1123014034 14:105365103-105365125 GCAGCTCCAGCCCTTTGCTGAGG + Intronic
1123120679 14:105914997-105915019 TCAGGTGAAGCCCAGAGGTGAGG + Intergenic
1123192346 14:106583382-106583404 ACAGGAGCAGCCCAGGGCAGGGG - Intergenic
1123403392 15:20006544-20006566 TCAGGTGAAGCCCAGAGGTGAGG + Intergenic
1123476202 15:20593875-20593897 GCAGATGCTGTCCAGAGCTGGGG - Intergenic
1123512730 15:21013198-21013220 TCAGGTGAAGCCCAGAGGTGAGG + Intergenic
1123641810 15:22406489-22406511 GCAGATGCTGTCCAGAGCTGGGG + Intergenic
1123760006 15:23424673-23424695 GAAGGTGCAGGGCAGTGGTGAGG + Intergenic
1124001712 15:25765839-25765861 GCAGCAGCAGGGCAGTGCTGAGG + Intronic
1124621001 15:31273875-31273897 GGAAGTGCAGCCCATGGCTGTGG - Intergenic
1125513857 15:40307263-40307285 GAAAGTGCACCCCAGAGCTGAGG - Intronic
1125724593 15:41861863-41861885 GCAGTTGCTGCCCAGTGCTTCGG + Exonic
1127453953 15:59141202-59141224 GCACTTGTAGCCCAGTTCTGTGG - Intronic
1128376314 15:67078734-67078756 CCAGGGGCAGCCTATTGCTGCGG + Intronic
1129725139 15:77897827-77897849 CCAGGTGCAGCCCTGTGCTGCGG - Intergenic
1129727288 15:77908034-77908056 GCACGTGCAGCACAGATCTGGGG - Intergenic
1129840591 15:78740961-78740983 GCACGTGCAGCACAGATCTGGGG + Intergenic
1130273196 15:82463033-82463055 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130368667 15:83264005-83264027 GCATGTGCAGCCGAGGGTTGGGG + Exonic
1130465548 15:84190404-84190426 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130487144 15:84404416-84404438 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130498717 15:84483132-84483154 CCAGATGCAGCCCTGTGCTGCGG + Intergenic
1130587837 15:85194999-85195021 CCAGATGCAGCCCTGTGCTGCGG - Intergenic
1130903798 15:88226199-88226221 GCAGGTGCTGCCCTGGGCTTAGG - Intronic
1131183498 15:90256334-90256356 GATGAGGCAGCCCAGTGCTGGGG - Intronic
1131543078 15:93290742-93290764 GCAGGTGCAGCTCTGTGCATTGG + Intergenic
1132722877 16:1325663-1325685 CCAGGTCCAGACCAGGGCTGGGG + Exonic
1133292794 16:4734112-4734134 GCAGGTGCCGGCAAGTGCTGGGG + Exonic
1133545144 16:6799110-6799132 GCAGGTGAATCCCAGAACTGGGG + Intronic
1135173255 16:20205228-20205250 GCTGGTGCAGCCCATAGCAGAGG + Intergenic
1135421354 16:22307699-22307721 GCACGTGCTGCTCACTGCTGAGG - Intronic
1135425904 16:22335764-22335786 TGAGGGCCAGCCCAGTGCTGGGG - Intergenic
1136394188 16:29983979-29984001 GCTGGGGAAGCCCAGTGCTGGGG + Intronic
1136394197 16:29984011-29984033 GCCTGTGGAGCCCTGTGCTGGGG + Intronic
1136518519 16:30782134-30782156 GCAGCAGCAGCTCAGAGCTGAGG + Exonic
1137721045 16:50627632-50627654 GCATCTGCAGCCCAGAGCTGGGG + Intronic
1138635224 16:58332961-58332983 ACAGATGCAGCCGGGTGCTGTGG - Intronic
1139504682 16:67393000-67393022 GCAGGATCCGCCCAGTGCTTGGG - Intronic
1142032557 16:87845808-87845830 GCAGCCACAGCCCTGTGCTGGGG - Intronic
1142080498 16:88146462-88146484 CCAGGTGCAGCACAGAGCTAAGG + Intergenic
1142133296 16:88440788-88440810 GGAGGTGCAGACCAGGGATGGGG - Intergenic
1142425767 16:90001524-90001546 CCAGGGGCAGCCACGTGCTGGGG - Intergenic
1142497287 17:312973-312995 GCAGATGCCACGCAGTGCTGGGG - Intronic
1142815177 17:2419663-2419685 GCAGAGGCAGTCCAGAGCTGAGG + Exonic
1143407936 17:6690453-6690475 GGAGGAGCAGGCCAGTGCCGTGG - Intronic
1143965452 17:10753653-10753675 GCAGGGGCAGGCAAGGGCTGGGG + Intergenic
1144637095 17:16917090-16917112 GCAGTTGTAGCTCAGTGCAGTGG + Intergenic
1144825205 17:18101888-18101910 GAAGGTGGAGGCCGGTGCTGAGG - Intronic
1144852951 17:18253282-18253304 GCAGGTGCTGGGCAGGGCTGGGG - Exonic
1147249600 17:39145150-39145172 GCAGGGGCAGCCCCGGGGTGGGG + Intronic
1147570674 17:41568573-41568595 GGAGGTGCAGTCCAGTGCCAAGG - Exonic
1147951942 17:44112350-44112372 GCAGGGGCAGGCCAGCGGTGGGG - Intronic
1147991389 17:44335901-44335923 GCAGGAACAGCCCAGTGCCCAGG - Intergenic
1148146202 17:45366659-45366681 GCAGGTTCAGCCCAGAGAAGAGG - Intergenic
1149579812 17:57741764-57741786 GCAGCTACACCTCAGTGCTGTGG - Intergenic
1151938975 17:77281238-77281260 CCAGGTGCAGCGCAGCGCAGGGG + Intronic
1152365522 17:79854176-79854198 AAAGGTGCAGCCCAGTCCTGAGG + Intergenic
1152461700 17:80445295-80445317 CCAGGTGCCTGCCAGTGCTGGGG - Intergenic
1152495598 17:80669128-80669150 GCAGGAGCAGCCAGGGGCTGGGG + Intronic
1152561603 17:81081537-81081559 GCAGGCGCTGCCCAGGGCAGGGG - Intronic
1152961410 18:82553-82575 GCAGGTGTTGCCCAGAGCTCTGG - Intergenic
1154358577 18:13641522-13641544 GCAGGTGCCGCCTAGGGCAGCGG + Intronic
1155083090 18:22429901-22429923 GCAGATGAAGCCCAGTGCTTGGG + Intergenic
1160368260 18:78348422-78348444 GCAGGTGCTGCTCGGTGCTGAGG - Intergenic
1160371720 18:78377785-78377807 GCAGGGGGAGGCCAGGGCTGTGG + Intergenic
1160397025 18:78580110-78580132 GTAGATGGAGCCAAGTGCTGAGG + Intergenic
1160481273 18:79241953-79241975 GCAGCAGCATCCCAGTGCTGAGG - Intronic
1160513152 18:79463645-79463667 GCAAGGGCAGCCCAGTGGGGAGG - Intronic
1160663272 19:311380-311402 GCAGGTGCTGCCAAGTGCCGGGG - Intronic
1160980619 19:1815067-1815089 GCAGGTGTGGCCCAGCCCTGGGG + Intergenic
1161337352 19:3721729-3721751 GCAGGTGCAGCCGGGAGCTGCGG + Exonic
1161343065 19:3753186-3753208 GGAGGGGCAGCCCTGGGCTGGGG + Intronic
1161366114 19:3880761-3880783 GCAGCCGCAGCCCCGCGCTGGGG + Exonic
1161659849 19:5539448-5539470 GCTGGAGCTGCCCAGAGCTGGGG + Intergenic
1162898249 19:13778299-13778321 CTAGGTGAAGCCCAGTGCTGGGG - Exonic
1163390226 19:17026428-17026450 CCAGGTCCAGCCCAGCGCGGAGG + Intronic
1163696226 19:18764869-18764891 GCAGGCCCTGCCCAATGCTGTGG - Intronic
1164698362 19:30263460-30263482 GAAGGAGCTGCCCATTGCTGAGG + Intronic
1164809446 19:31144606-31144628 GCATGGCAAGCCCAGTGCTGTGG - Intergenic
1165150565 19:33757927-33757949 TCAGGTCCAGCCAAGGGCTGGGG - Intronic
1165374868 19:35434561-35434583 GCAGGTCCAGCCAAGAGCCGTGG - Intergenic
1165949977 19:39468913-39468935 GCAGGTGATGCCCTGGGCTGTGG + Intronic
1166230603 19:41424104-41424126 GCCCGTGCAGCCCAGTGGTGAGG + Intronic
1166988781 19:46678267-46678289 GGGGGTGGAGCCCAGTGCTGGGG - Intronic
1168476393 19:56678524-56678546 ACAGGTGCAGCCCAGATTTGAGG + Intergenic
925002586 2:417723-417745 GCTGATGCCGCACAGTGCTGTGG + Intergenic
925379723 2:3416687-3416709 GCAGGGGGAGCGCAGTGATGGGG - Intronic
925842901 2:8009184-8009206 TCAGCTCCAGCCCTGTGCTGAGG - Intergenic
925871757 2:8277944-8277966 GCAGAGGCAGCCCTGTCCTGAGG - Intergenic
926125238 2:10267864-10267886 GCAGGTGGAGGGCAGGGCTGGGG - Intergenic
926892411 2:17649771-17649793 CCCGCTGCAGCACAGTGCTGGGG + Intronic
927945766 2:27134334-27134356 CGATGAGCAGCCCAGTGCTGGGG + Exonic
928914584 2:36457476-36457498 GCAAGTGCAGCCCTGCCCTGGGG - Intronic
929153266 2:38767576-38767598 GCAGGTACTGAACAGTGCTGAGG + Intronic
929428189 2:41865067-41865089 GCAGCTGCTGCCCAGGGCAGCGG - Intergenic
931246052 2:60493780-60493802 GCAGCTGCTGCCCAGTGCTGTGG + Intronic
933746933 2:85578390-85578412 GCACGTGTCGCCCAGTGGTGGGG + Intronic
934993144 2:98935749-98935771 GCAGGAGCTGCCCAGGGCTTCGG + Intronic
938236310 2:129709525-129709547 GCAGCAGCAGCCAAGGGCTGGGG + Intergenic
938268592 2:129948644-129948666 GGCCGGGCAGCCCAGTGCTGTGG + Intergenic
939193370 2:138942675-138942697 GGAGGGGCATCCCATTGCTGAGG - Intergenic
940672496 2:156687933-156687955 GCAGGTGGGGCCCAGTGCCTGGG - Intergenic
941027581 2:160475456-160475478 GGAGGGGAAGCCCAGTGCTGGGG - Intronic
941953399 2:171179668-171179690 GCAGGAGCAGCCGGGTGCAGTGG + Intronic
942041330 2:172066627-172066649 TCAGCAGCTGCCCAGTGCTGTGG - Intronic
947548893 2:231032580-231032602 GTTGGTGCAGCCCTGTCCTGGGG + Intergenic
948205658 2:236161602-236161624 GCAGCTTCAGCGCAGTGCTCAGG - Intergenic
948210199 2:236187327-236187349 GGGGGTGGAGCCCAGTGCTTGGG - Intergenic
948496211 2:238351467-238351489 GCAGCTGCAGCTGAGGGCTGTGG + Intronic
948679299 2:239621805-239621827 GCGGGTGCAGCCTGGGGCTGGGG + Intergenic
948767746 2:240232266-240232288 GAAGGTGCAGGGCAGAGCTGCGG - Intergenic
948889227 2:240898707-240898729 GCAGCTGCAGCCCACAGCAGGGG + Intergenic
1171243131 20:23587462-23587484 GCAGGTACACCCCTGTGGTGTGG + Intergenic
1171453820 20:25255364-25255386 GCAGGTCCAGCCCAGGGAGGTGG + Intronic
1171473710 20:25391154-25391176 GCACGAGGAGCCCAGCGCTGCGG - Intergenic
1172949086 20:38710840-38710862 GCAGCTGCAGACCAGGGCTGGGG - Intergenic
1173423861 20:42926334-42926356 GCTAGTGCAGCCCATTGTTGGGG - Intronic
1173443543 20:43097933-43097955 GCAAGTGCAGCACAGTGCGCGGG + Intronic
1173845980 20:46189089-46189111 GCAGGTGCAGCCACCTCCTGGGG + Intronic
1174193558 20:48757232-48757254 GCAGGTGGAGGGCAGTGCTGTGG - Intronic
1174430540 20:50465275-50465297 AAAGGTGCAGCCCATTCCTGGGG - Intergenic
1175740909 20:61419219-61419241 GCAGGTGCAGCTGAGAGCAGAGG + Intronic
1175935559 20:62512288-62512310 GCGGCTGCACCTCAGTGCTGTGG + Intergenic
1175992243 20:62795442-62795464 GCAGGTTCAGCCCCGGGTTGGGG + Intergenic
1176125562 20:63473068-63473090 GCAGGCTCAGCCCAGAGCTCTGG - Intergenic
1176287899 21:5028527-5028549 GCTGCTGCTGCCTAGTGCTGCGG - Intronic
1178893055 21:36536090-36536112 TCAGCTGCAGCCCAGCTCTGTGG + Intronic
1178896615 21:36564035-36564057 GAGGGTGCAGCCCAGGACTGGGG - Intronic
1179593552 21:42427389-42427411 GCAGGTACAGCCCCTTCCTGAGG - Intronic
1179630121 21:42672570-42672592 GCAGGTCCAGCTCAGTGCTGGGG + Intronic
1179869282 21:44234948-44234970 GCTGCTGCTGCCTAGTGCTGCGG + Intronic
1179880709 21:44292344-44292366 GGAGGTGCAGCCCCGGGCAGAGG + Exonic
1179897071 21:44369126-44369148 TCAGGTGCCCCTCAGTGCTGTGG + Intronic
1179911200 21:44449870-44449892 GCAGGGGCAGCACCGTGGTGAGG - Intergenic
1180030344 21:45202344-45202366 GCAGCTGGAGGTCAGTGCTGGGG + Intronic
1180044877 21:45300764-45300786 GCAGGCGCTGCACAGCGCTGGGG + Intergenic
1180245791 21:46546471-46546493 GCAGGTGCTGTCCTGTGCTTAGG - Intronic
1180917473 22:19499175-19499197 GCAGGGTCAGCCCTGTGCTGTGG + Intronic
1180955070 22:19737868-19737890 GCAGGTCCTGGGCAGTGCTGGGG + Intergenic
1180970054 22:19810556-19810578 GCAGGGGCAGCCCCGGGCTGAGG - Intronic
1181565741 22:23736170-23736192 TCAGCTGCAGCCCAGTTCTAGGG - Intergenic
1182829399 22:33292465-33292487 GCAGGGCCAGGCCAGTGATGTGG + Intronic
1182848078 22:33447759-33447781 GCAGGTGCAGCACAGGGAGGAGG + Intronic
1183214144 22:36468222-36468244 GCAGCTGCAGGCCAGGGCTGGGG + Intronic
1183627633 22:39014444-39014466 GCAGGGGGAGGCCAGGGCTGAGG - Intronic
1183628932 22:39021600-39021622 GCAGGGGGAGGCCAGGGCTGAGG - Intronic
1183630145 22:39027711-39027733 GCAGGGGGAGGCCAGGGCTGAGG - Intronic
1183776829 22:39971593-39971615 TAAGGTGCAGCCCAGTGCTGCGG + Exonic
1184372301 22:44090252-44090274 GCAGGAGGAGCCCAGGCCTGTGG - Intronic
1184403581 22:44287468-44287490 GCAGCTGTAGGCCAGTGCTTAGG + Intronic
1184456747 22:44615227-44615249 GCAGCTGGAGCCCTTTGCTGGGG - Intergenic
1185148418 22:49151399-49151421 GCCGGTGCAGCCCGGCCCTGAGG + Intergenic
1185270228 22:49926574-49926596 GCAGGGCCAGCCCAGGGCAGAGG - Intronic
1185304139 22:50103255-50103277 TCAGGAGCAGGCCAGGGCTGGGG - Intronic
950138400 3:10599263-10599285 ACAGGTGAAGCCCAGGGGTGTGG - Intronic
950374270 3:12557229-12557251 GCCGGTGCGCGCCAGTGCTGTGG + Intronic
950497348 3:13341700-13341722 GTGGGATCAGCCCAGTGCTGGGG - Intronic
950570484 3:13796811-13796833 GCTGGGGGAGCCCTGTGCTGGGG - Intergenic
952264530 3:31772603-31772625 GCAGGGGCAGTGCAGTGCAGTGG - Intronic
952877391 3:37957764-37957786 GCTGGTGCAGGACGGTGCTGGGG - Intronic
953041754 3:39261759-39261781 CCAGGGGCTGCCCAGTGCTTGGG - Intergenic
954295013 3:49669552-49669574 ACAGGTGCAGTCAAGAGCTGGGG - Exonic
954465067 3:50649492-50649514 ACAGGGGCAGCACAGAGCTGGGG - Intergenic
954803787 3:53203160-53203182 GCAGGTGCAGCACCCCGCTGAGG - Intergenic
956435707 3:69232664-69232686 GCAGGTGCACCCATTTGCTGGGG - Intronic
960869358 3:122233375-122233397 CCAGTTCCAGCCCAGTCCTGGGG + Intronic
961074338 3:123967706-123967728 GCAGGTGCAGCCCAGTGCTGTGG + Intergenic
961309291 3:125984429-125984451 GCAGGTGCAGCCCAGTGCTATGG - Intergenic
961556461 3:127699685-127699707 GAAGGTGAAGGTCAGTGCTGGGG + Intronic
962943355 3:140145640-140145662 GCAGGAGCAGCCCTGGGCAGAGG - Intronic
964429233 3:156587312-156587334 GCCCTTGCAGGCCAGTGCTGGGG + Intergenic
964515474 3:157503378-157503400 GCAGCTGCTGCCCAGTCCTGTGG + Exonic
966302898 3:178498540-178498562 CCATCTGCAGCTCAGTGCTGAGG + Intronic
967232158 3:187350161-187350183 GCAGGTCCAGCCTGGTGCAGTGG + Intergenic
967987804 3:195107913-195107935 TCAGCTGCTGGCCAGTGCTGAGG + Intronic
968064132 3:195748860-195748882 GGAGGTGGAGGACAGTGCTGGGG - Intronic
968450563 4:674175-674197 GCAGCCGCCGCCCAGTGCTCTGG - Intronic
968547690 4:1207080-1207102 GCAGGTGCAGGGCAGTGCCCGGG + Intronic
968612613 4:1564008-1564030 CCAGGGGCACCCCAGGGCTGGGG - Intergenic
968652473 4:1765729-1765751 TGAGGTGGAGCCCAGGGCTGAGG - Intergenic
968966661 4:3772349-3772371 GGAGGAGCAGCCCTGTGCGGAGG + Intergenic
969618667 4:8268147-8268169 GGAGGTTCAGCCCAGCCCTGAGG + Intergenic
969690662 4:8702414-8702436 GGAGCTAGAGCCCAGTGCTGGGG + Intergenic
969694412 4:8726480-8726502 GCAGGAGCAGCTGAGTGGTGGGG - Intergenic
970348906 4:15181265-15181287 GCTGGAGCAGCCCAGAGCTTTGG + Intergenic
973068234 4:45823999-45824021 CCATGTGCTGACCAGTGCTGTGG + Intergenic
977006329 4:91572375-91572397 GTAGGTCCAGCCCAGTGAGGAGG + Intronic
985610637 5:886101-886123 GCAGGTGCAGGCCTGTGGTCAGG - Intronic
985668730 5:1195614-1195636 GCAGGTGCAGGCCAGGCCTGTGG + Intergenic
985710989 5:1429829-1429851 GCACATGCAGCCCAGGCCTGGGG + Intronic
985917007 5:2929904-2929926 GCAGGTGCAGAGCAGAGGTGAGG + Intergenic
986204417 5:5610399-5610421 GCAGGTGGAGACCCGGGCTGTGG + Intergenic
986594731 5:9409519-9409541 GGAGGGGGAGCCCAGGGCTGGGG - Intronic
990471138 5:56116756-56116778 GCAGCTGCAGCCCAGTGCAGAGG + Exonic
990958902 5:61372377-61372399 GCAGGTTCAGTGGAGTGCTGGGG - Intronic
991174203 5:63667842-63667864 GCAGGTGCAACCATGTGCAGAGG + Intergenic
992372270 5:76155554-76155576 GCAAGTGCAGCCCAGAGGTGTGG + Intronic
994570348 5:101506345-101506367 GCAGGGGCAGCGCCCTGCTGGGG - Intergenic
995042191 5:107601399-107601421 GATGGTGCAGCCCAGTACAGTGG - Intronic
995683220 5:114743823-114743845 GCAGCAGCAGCCCAGGCCTGTGG - Intergenic
996029829 5:118692840-118692862 ACAGGTGCAGCCCAGAGCCCTGG + Intergenic
997454439 5:134006366-134006388 GCCGGTGCAACCCAGTTTTGAGG + Intergenic
997508679 5:134438075-134438097 GCAAGTGCAGCCCATAGGTGAGG - Intergenic
998374144 5:141680368-141680390 GCAGGTGCAGCCCGGGGCCTGGG - Exonic
999142884 5:149374378-149374400 GCAGGTGCAGCCCACAGCGATGG + Exonic
999208545 5:149868048-149868070 GGAGGGGCATCCCAGTACTGGGG - Intronic
999255277 5:150206569-150206591 GCAGGTGGAGCCTTGTGGTGGGG - Intronic
999327416 5:150651660-150651682 GCAGGTGCATAGCAGTGCAGTGG + Exonic
1001209010 5:169792951-169792973 GCAGCTGCAGGCAAGTGCAGTGG + Intronic
1002101715 5:176861170-176861192 GGGGGTGCAGCCCTTTGCTGTGG + Intronic
1002691036 5:181050799-181050821 GTAGGTGCAGCCGGGTGCAGTGG + Intronic
1002888298 6:1313865-1313887 GCAGGTGCGGGCCAGGGCGGCGG - Exonic
1002900115 6:1404199-1404221 GGAGATGCTGCCCTGTGCTGTGG - Intergenic
1004053585 6:12112693-12112715 GCAGCAGCAGCCCACTGCTAGGG - Intronic
1004526141 6:16409847-16409869 GCAGGTGGAGCACAGTTTTGTGG - Intronic
1006326291 6:33356458-33356480 GCAGCTCCAGCCCAGTCCTGAGG + Intergenic
1006628023 6:35411252-35411274 GGAGGCACAGCCCAGTGCAGTGG + Intronic
1006915470 6:37591219-37591241 GCAGGTGGCCACCAGTGCTGTGG - Intergenic
1007699812 6:43759893-43759915 GCTGGGGGAGCCCAGGGCTGAGG + Intergenic
1007775769 6:44223638-44223660 GCAGGTGCTGCCCGGGGCCGGGG + Exonic
1009839740 6:69053621-69053643 GCATGTCCAGCCCAGTTCAGAGG + Intronic
1011876332 6:91966360-91966382 GGAGGTGCTGCCCAAGGCTGTGG + Intergenic
1012796293 6:103766214-103766236 GCAGATGGAGCCTAGTGCTAGGG - Intergenic
1014150021 6:118044072-118044094 GCAGGTGCAGGCCAGTGCCTTGG + Intronic
1018356276 6:163021037-163021059 GCAGGTGGAGCCCAGTGGATGGG + Intronic
1018407749 6:163505467-163505489 GACAGTGCTGCCCAGTGCTGTGG + Intronic
1018568571 6:165183760-165183782 GCATGAGCAGCCCAGTGGAGAGG - Intergenic
1018753487 6:166828171-166828193 CCAGCTTCAGCACAGTGCTGTGG + Intronic
1019266009 7:117795-117817 GCAGGTGCAGGCCAGTCTCGGGG - Intergenic
1019277302 7:182455-182477 GCAGGTGCAGGCCAGTCTCGGGG - Intergenic
1019327238 7:444489-444511 GCAGGTGCAGCCTCCTGGTGGGG - Intergenic
1019338449 7:496039-496061 CCAGGTGCAGCCCAGGGCTAGGG + Intergenic
1019444595 7:1064791-1064813 GCAGGGGCTGCTCACTGCTGTGG - Intronic
1019667480 7:2259096-2259118 GCAGCTGGAGCCCAGGGCTTTGG - Intronic
1020381524 7:7552769-7552791 GCAGGTACAGCAAAGTGCTAAGG + Intergenic
1022124766 7:27345156-27345178 GCAGCTGGAGCCCAGCACTGAGG - Intergenic
1022514180 7:30964952-30964974 GCAGGTGCAGCAAGGTGCTCGGG - Intronic
1022530946 7:31066493-31066515 GAAGGGCCAGGCCAGTGCTGGGG + Intronic
1023600454 7:41877075-41877097 GCAGGTGAGGCCCAGGCCTGTGG + Intergenic
1023942696 7:44780191-44780213 GCAGGTGCAGGCCAGTCGGGTGG + Intergenic
1024059601 7:45687909-45687931 GCAGGTGCAGCCCAGAGTTGGGG + Intronic
1025244277 7:57304516-57304538 AAAGGTGCAGCCCATTCCTGGGG + Intergenic
1025940393 7:66072713-66072735 TCAGCTGCAGCCCAGTTCTAGGG + Intergenic
1026845520 7:73696998-73697020 GCAGCTGCAGAGCAGGGCTGGGG - Intronic
1028582576 7:92422965-92422987 GCAGGTGCAGTCCTGGGCTTAGG + Intergenic
1029115046 7:98232426-98232448 GCAGGGTCAGCCCAGGGGTGGGG + Intronic
1029745638 7:102514429-102514451 GCAGTAGCAGCCCAGTAGTGGGG - Intronic
1029763577 7:102613408-102613430 GCAGTAGCAGCCCAGTAGTGGGG - Intronic
1031094402 7:117402024-117402046 GTATGTGCAGCCAAATGCTGTGG + Intronic
1031231932 7:119118510-119118532 TCAGGTTCATCCAAGTGCTGTGG - Intergenic
1032805264 7:135347887-135347909 GCAGGTGAAGCCCAGAGATTTGG - Intergenic
1032840045 7:135706179-135706201 GCAGGAGCTGGTCAGTGCTGAGG - Exonic
1033514539 7:142093242-142093264 GCCGTTGCAGCTCAGAGCTGGGG + Intronic
1034789894 7:153958544-153958566 GCAGGTCGAGCCAAGAGCTGAGG + Intronic
1035044105 7:155952801-155952823 GCAGGGGAAGCCCAGCGGTGGGG + Intergenic
1035397339 7:158543881-158543903 GCAGGGGCAGCCTGGTGCAGAGG - Intronic
1037154667 8:15684965-15684987 TCAGATGCACCCCAGTCCTGTGG + Intronic
1037756102 8:21710970-21710992 GCAGAGGGAGCCCACTGCTGTGG - Intronic
1038124517 8:24656784-24656806 GGAAGTGCAGCCCATTGCTCTGG - Intergenic
1038447615 8:27614844-27614866 GCCGGTGCAGCACCGGGCTGGGG + Exonic
1038583606 8:28770712-28770734 GCAGGTGCAGCCCTGCCCTTGGG - Intronic
1040575837 8:48650419-48650441 GCAGCTCCAGACCAATGCTGTGG + Intergenic
1040886268 8:52267000-52267022 GCAGGTGCAGCAAAGGGCTGGGG + Intronic
1041411696 8:57563390-57563412 CCAGGTCCACCCCAGTTCTGGGG + Intergenic
1044603108 8:94025575-94025597 GCATGTGCAGCCCAGAAATGGGG + Intergenic
1044932057 8:97260234-97260256 GCAGGGGCAGCCCAGGACTCTGG - Intergenic
1046104074 8:109645464-109645486 GCAGCTGCAGGGCAGCGCTGGGG - Exonic
1047566701 8:126051664-126051686 GTAGATGCAGCCCAGGTCTGTGG + Intergenic
1048292612 8:133192088-133192110 GCAGGTCCTGCCCTGGGCTGTGG - Intronic
1048724210 8:137363227-137363249 GTAGGTGGAGCTCAGTGATGGGG + Intergenic
1049239749 8:141531114-141531136 CCAGGGACAGCGCAGTGCTGGGG + Intergenic
1049388051 8:142354188-142354210 GCTGGTGCAGGGCAGAGCTGGGG - Intronic
1049422074 8:142521428-142521450 GCAGGTGCAGCCTTTGGCTGGGG + Intronic
1049478585 8:142808263-142808285 GCAGGTGGAGCCCAGCACCGGGG - Intergenic
1051606453 9:18922296-18922318 GCACCTGCAGCCCAGTAGTGTGG + Intergenic
1053025138 9:34723292-34723314 GCGGGGGTAGCCCAGGGCTGAGG + Exonic
1053285071 9:36845006-36845028 GAAGGTGCAGCCCCGTGCCAGGG + Intronic
1055978517 9:81977182-81977204 GCAGGTGCAGCCCCGCGCCCAGG - Intergenic
1056100698 9:83298059-83298081 GCAGGTGCAAACCAGTGTAGGGG + Intronic
1056468013 9:86877938-86877960 GCAGGTGCAGCCAAGGCCTTGGG - Intergenic
1057412506 9:94829580-94829602 GCAGCTGCAGCCAGCTGCTGAGG - Intronic
1058887166 9:109330286-109330308 GCAGGAGGAGGCCAGTGCAGTGG - Intergenic
1060401885 9:123354250-123354272 GCGGCTGCAGGACAGTGCTGGGG + Intergenic
1060405875 9:123372912-123372934 GCAGTTCCCGGCCAGTGCTGGGG - Intronic
1060547191 9:124468454-124468476 GCAGGTGCAGGCCAGCCCCGCGG - Intronic
1060739656 9:126089987-126090009 GCAGCTGCATCCCAGCCCTGGGG - Intergenic
1061138487 9:128750515-128750537 ACAGATGCAGCCCAGAGCCGGGG + Intronic
1061264524 9:129497424-129497446 GCAGCCGCAGCCCTGTTCTGGGG + Intergenic
1061404227 9:130384776-130384798 GCTGGTGCAGCTCAGTGTTCTGG + Intronic
1061425224 9:130494287-130494309 GCTGGTGCTGCTCAGTGCTAGGG + Intronic
1061557096 9:131377604-131377626 GGATGTGGAGCCCAGGGCTGGGG - Intergenic
1061848225 9:133400077-133400099 GCAGTTGCAGCCAAGGGCTCTGG + Intronic
1061912521 9:133732569-133732591 GCAGCTGCGGCCCAGTGACGTGG - Exonic
1062323302 9:136001045-136001067 ACAGGTGCAGGCCCCTGCTGGGG + Intergenic
1062653381 9:137589989-137590011 CCAGGTGCACCCCAGAGCCGAGG + Intronic
1062736741 9:138141565-138141587 GCAGGTGTTGCCCAGAGCTCTGG + Intergenic
1189408215 X:40744762-40744784 GCAGGAGCTGCCCAAGGCTGTGG - Intergenic
1189868166 X:45352993-45353015 GCTGGTGCAGCTGAGTGCAGAGG + Intergenic
1192507606 X:71698461-71698483 GCAGCTCCAGCCCAGTCCTGAGG + Intergenic
1192519090 X:71783091-71783113 GCAGCTCCAGCCCAGTCCTGAGG - Intergenic
1193083381 X:77427046-77427068 GCAGCTGCAGCCCCTTGCAGAGG + Intergenic
1193494721 X:82197141-82197163 GCAATGGCAGCACAGTGCTGAGG + Intergenic
1193712344 X:84894625-84894647 GGAGGTTCAGCCCAGTGAGGAGG + Intergenic
1193836177 X:86347370-86347392 GCAAGTGCACCCATGTGCTGAGG - Intronic
1195757261 X:108211603-108211625 GGAGGTGGGGCCCAATGCTGGGG + Intronic
1196622434 X:117839072-117839094 GCATAAGTAGCCCAGTGCTGTGG + Intergenic
1197240088 X:124114325-124114347 GTGGGGGCAGCCTAGTGCTGGGG + Intronic
1198141206 X:133805389-133805411 GCAGGGGCAGCCTAGGACTGGGG + Intronic
1199185419 X:144910334-144910356 GGTGGAGCTGCCCAGTGCTGTGG - Intergenic
1199852688 X:151736804-151736826 CCAGGGCCAGGCCAGTGCTGGGG - Intergenic
1200053544 X:153446903-153446925 GCAGGGCCAGCCCCATGCTGGGG + Intronic