ID: 961076745

View in Genome Browser
Species Human (GRCh38)
Location 3:123989860-123989882
Sequence CTGGGAAAGGTTTCTTCCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 255
Summary {0: 1, 1: 0, 2: 1, 3: 27, 4: 226}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961076739_961076745 -6 Left 961076739 3:123989843-123989865 CCCCTATGCACCAAGCTCTGGGA 0: 1
1: 0
2: 2
3: 15
4: 197
Right 961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 226
961076735_961076745 12 Left 961076735 3:123989825-123989847 CCAGTCAGCTGTGGCCATCCCCT 0: 1
1: 1
2: 0
3: 22
4: 219
Right 961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 226
961076736_961076745 -2 Left 961076736 3:123989839-123989861 CCATCCCCTATGCACCAAGCTCT 0: 1
1: 1
2: 1
3: 19
4: 253
Right 961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 226
961076740_961076745 -7 Left 961076740 3:123989844-123989866 CCCTATGCACCAAGCTCTGGGAA 0: 1
1: 0
2: 1
3: 9
4: 157
Right 961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 226
961076741_961076745 -8 Left 961076741 3:123989845-123989867 CCTATGCACCAAGCTCTGGGAAA 0: 1
1: 0
2: 1
3: 12
4: 185
Right 961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG 0: 1
1: 0
2: 1
3: 27
4: 226

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961076745 Original CRISPR CTGGGAAAGGTTTCTTCCTT GGG Intronic
905809724 1:40903090-40903112 CAGGGAAACTTTTATTCCTTGGG + Intergenic
908485112 1:64584073-64584095 CTGAAAATGGTTTCTTCTTTGGG - Intronic
908852084 1:68386771-68386793 CTGGGAAAGCAGCCTTCCTTTGG + Intergenic
909131603 1:71743666-71743688 CTGGGAAAGATTTGACCCTTTGG - Intronic
910194190 1:84623594-84623616 ATGGGAAAGGAGTGTTCCTTGGG + Intergenic
910220307 1:84883282-84883304 GAGGGAAAGGATTCTTCCTTTGG - Intronic
912340038 1:108905515-108905537 CTGAGAAAACTTTCTTCATTTGG + Intronic
912565954 1:110587551-110587573 CTGAAAAAGCTGTCTTCCTTTGG - Intergenic
912605786 1:110987183-110987205 CTGGCAAATATTTCTTCCTTTGG - Intergenic
920164729 1:204027912-204027934 TTGGGAACGTTTCCTTCCTTAGG + Intergenic
920541351 1:206780676-206780698 CTGGGAAAGTCTTCTTCTCTAGG - Intergenic
920806443 1:209238670-209238692 ATGGGTCACGTTTCTTCCTTTGG - Intergenic
922071230 1:222195525-222195547 CTGGGAAAGTTTCTTACCTTAGG - Intergenic
923245575 1:232128572-232128594 CTGAGAATGCATTCTTCCTTGGG + Intergenic
923841642 1:237678810-237678832 CTGGGTAAGCTTTCTTGTTTAGG + Intronic
924030612 1:239881714-239881736 CTGACAAGGTTTTCTTCCTTTGG - Intronic
924424325 1:243936964-243936986 CTGGGGAAGCGTTCTTCCTTTGG + Intergenic
1063018080 10:2098032-2098054 CTGGGGAAGTTTTCTTGCTCCGG + Intergenic
1064548932 10:16478937-16478959 CTGGGAAAGGTCTCCTCCTCTGG - Intronic
1065781963 10:29177422-29177444 CTTGGAAATCTTGCTTCCTTTGG + Intergenic
1067289846 10:44932729-44932751 AGGGGAAAGCTTTCTGCCTTAGG - Intronic
1067453371 10:46396409-46396431 CTGGGTAAGCTTTCTTCCACAGG - Intergenic
1067583865 10:47463357-47463379 CTGGGGAAGCTTTCTTCCACAGG + Intronic
1067633868 10:47988705-47988727 CTGGGGAAGCTTTCTTCCACAGG + Intergenic
1067672845 10:48341202-48341224 CAGTGAAATGTTTTTTCCTTAGG + Intronic
1068401882 10:56538122-56538144 TTGGGAAAGGTTGCTCTCTTTGG + Intergenic
1072316725 10:94210779-94210801 CAGAGGAAGTTTTCTTCCTTTGG + Intronic
1072847856 10:98852311-98852333 TTGGGGAAGATTTCTGCCTTGGG - Intronic
1073490558 10:103850432-103850454 ATGGGAACGGTTTCTTCTCTGGG - Intronic
1073566365 10:104538894-104538916 CTGGGAAAGGCTGCTTTCCTGGG - Intergenic
1074495622 10:113977864-113977886 CTGGGAATATTTTTTTCCTTTGG + Intergenic
1076206443 10:128608193-128608215 CAAGGAAAGTTTTCTTCCTGAGG - Intergenic
1076899746 10:133332442-133332464 GAGGGAAATGTTTCTTCATTAGG + Intronic
1077119376 11:899752-899774 CTGGGCCAGGGTTCTTCCCTTGG - Intronic
1077936181 11:6789239-6789261 TTGGGAAATTTTTCTTCTTTTGG + Intergenic
1078795968 11:14591879-14591901 CTGTGGAAGGTTTGTTCTTTTGG + Intronic
1079364995 11:19801341-19801363 CTGGCAAAGGACTCTGCCTTTGG - Intronic
1079565562 11:21878133-21878155 CTGGGAGAGACTTCTTCCTTGGG + Intergenic
1080929475 11:36793638-36793660 CTTGGAAAACTTTCTTCCTCAGG + Intergenic
1086106796 11:83156411-83156433 GTGTGAAAGGCTTTTTCCTTGGG - Intergenic
1086878212 11:92123593-92123615 GAGGGAAAGGTTTTTACCTTTGG - Intergenic
1087068436 11:94049504-94049526 CAATGAAAGGTTTATTCCTTTGG - Intronic
1087577930 11:100012919-100012941 CATGGAAAAGTTTCTTCCTCTGG + Intronic
1087913826 11:103784665-103784687 CAGGCAAAGCATTCTTCCTTTGG + Intergenic
1089330028 11:117682652-117682674 CTGGAAAAGGATTCTTCCAAGGG + Intronic
1089491082 11:118884699-118884721 CTTGGAAAGGTTTCTTGGGTGGG + Intronic
1090338472 11:125992929-125992951 CTTGGAAGGGATTCTTGCTTTGG - Intronic
1090366639 11:126211933-126211955 CTGAGAAACGTTTCTCCTTTTGG + Intronic
1091656253 12:2348734-2348756 GGGGGAAAGGTTCCTTCCTCGGG + Intronic
1092994237 12:13933298-13933320 CAGGGAAGGGTTTCATCTTTTGG - Intronic
1093704148 12:22256046-22256068 CGGGGAAAGCTTTCTCACTTGGG + Intronic
1095769240 12:45933842-45933864 CTGTAAAAGGGTTCTTCTTTAGG + Intronic
1095869651 12:47012339-47012361 CTGGGAAAGGCTTCATCACTGGG + Intergenic
1095929716 12:47613377-47613399 CTGGGACAGACTTCTGCCTTGGG - Intergenic
1096236525 12:49931837-49931859 CTGGGAAAGGATACTTTGTTAGG + Intergenic
1096734892 12:53645088-53645110 TTGGAAAATGTTTATTCCTTTGG - Intronic
1097631056 12:62062831-62062853 CTGGGAAAGGCCTTTACCTTAGG - Intronic
1097983597 12:65759257-65759279 GTGTTAAAGGATTCTTCCTTGGG + Intergenic
1099119825 12:78674900-78674922 CTTGGAAAGCTTTCCTGCTTGGG - Intergenic
1101388919 12:104282469-104282491 CTTAGAAAGATTTCTTCCCTAGG + Intronic
1103098587 12:118152485-118152507 CTGGAAGAGGTTTCCTCATTTGG + Intronic
1103224322 12:119274078-119274100 CTGGCAAAGGATTCACCCTTGGG + Intergenic
1105857616 13:24386600-24386622 CTGGCAAAGGCTTCCTCCCTGGG + Intergenic
1109220898 13:59639922-59639944 ATGGGGCAGGTTTCTCCCTTTGG + Intergenic
1110117705 13:71840364-71840386 CTGGGAAATTTTTTTTCCATTGG - Intronic
1111030518 13:82591935-82591957 CAGGGCAAGCTTTCTTCCTTGGG - Intergenic
1112520515 13:100090483-100090505 ATTGGACAGGTCTCTTCCTTGGG + Intronic
1113382113 13:109813631-109813653 CTGGAATGGGTTTCTTACTTGGG + Intergenic
1113483897 13:110640895-110640917 CTGGGAAAGGTTGGTTCCGGAGG - Intergenic
1114567516 14:23643575-23643597 CTGGGACAGGCTTTTTCCTATGG - Intronic
1115242499 14:31263527-31263549 CTGGGAAAGGAGCCTTCATTGGG + Intergenic
1116143346 14:41030536-41030558 CTTTGAAAGCTTTGTTCCTTTGG + Intergenic
1118910988 14:70061913-70061935 CAAGGAAAGTTTTCTTCCCTGGG - Intronic
1121908376 14:97767684-97767706 CTGGGTAGGGTTCCTTCCTCAGG - Intergenic
1124955169 15:34355659-34355681 CTTGGAAAGGTTTCTTCTTCAGG + Exonic
1126528625 15:49687216-49687238 CTGGGAAAAGTTTATTCTTTAGG + Intergenic
1127925446 15:63535953-63535975 CTGGGAAATGTTGCTTCTTAAGG + Intronic
1129359212 15:75013943-75013965 GTGGGAAAGGTGTCTTCTTGGGG + Intronic
1130602385 15:85285206-85285228 TTGGGAATGGTTGCTTCCATGGG - Intergenic
1131126066 15:89858115-89858137 CTGGAAAAGGGTTCTTAGTTAGG + Intronic
1133075146 16:3274355-3274377 CTGGAAAAGGTTTGTTTCTGAGG + Intronic
1133823580 16:9258238-9258260 CTGGGAGAGTTTTCTTCATGTGG - Intergenic
1134213293 16:12296081-12296103 CTGAAAAATTTTTCTTCCTTCGG + Intronic
1139277961 16:65745440-65745462 CTGGGAAAGCCTGCTTGCTTTGG + Intergenic
1139283232 16:65787559-65787581 CTGGGGAAGTTTACCTCCTTTGG - Intergenic
1139480268 16:67226806-67226828 CTGGGTAACGGTTCCTCCTTTGG - Intronic
1139869271 16:70091338-70091360 CTTGGACAGGTTTATCCCTTTGG - Intergenic
1140144144 16:72289019-72289041 ATGGAAAATGTTTCTTGCTTTGG - Intergenic
1140386112 16:74540801-74540823 CTTGGACAGGTTTATCCCTTTGG + Intronic
1140421919 16:74826337-74826359 GTGGGAAAAGTTTCTGCCTAAGG - Intergenic
1140435542 16:74944074-74944096 CTGGGAAAGGTGTGTTCTCTTGG - Intronic
1140911630 16:79458844-79458866 CTGAGAAAAGTTTCTCCCTGAGG + Intergenic
1141689279 16:85587361-85587383 CGGGGGAAGGTTTTTACCTTGGG - Intergenic
1144063494 17:11603926-11603948 CTGGAAACGCTTTCTTCTTTGGG + Intronic
1147121397 17:38337339-38337361 GTGGGAATGGGTGCTTCCTTGGG + Intronic
1149567213 17:57648826-57648848 CTGGGGCAGGCTACTTCCTTGGG - Intronic
1149725578 17:58890752-58890774 CTGGGAAAGGTTTCTGAGATAGG - Intronic
1152079688 17:78179077-78179099 AAGGGAAAGGTTTCTGCCTCGGG + Intronic
1153222876 18:2877241-2877263 ATGGGAAATGTTTCTTCCACTGG + Intronic
1153871766 18:9327806-9327828 CTGGCAGAGGTTGCTTCATTAGG + Intergenic
1153911999 18:9712587-9712609 CTGGGAAACTTTTCCACCTTTGG - Intronic
1154979986 18:21495763-21495785 CTGGGAAAGGTTTCTCCAAGAGG - Exonic
1155711568 18:28886793-28886815 CTGGGGATGGTTTTTCCCTTGGG - Intergenic
1155991807 18:32285927-32285949 GTGGGGAAGGGGTCTTCCTTGGG - Intronic
1156204820 18:34873891-34873913 CGGGCAAAGTTCTCTTCCTTGGG + Intronic
1156397425 18:36711023-36711045 CTGGGAACGGTTTCCACTTTTGG - Intronic
1157006815 18:43592590-43592612 GTGGGAAAGATGTGTTCCTTGGG + Intergenic
1158698186 18:59721447-59721469 CTGGGAAAGATCTTCTCCTTTGG + Intergenic
1159202428 18:65204571-65204593 CTGGCAAAGGTTTCAATCTTTGG - Intergenic
1159534216 18:69694320-69694342 CTGGGCATGGTCTATTCCTTTGG + Intronic
1159965365 18:74590043-74590065 TTGAGAAAGCTTTCTTCTTTAGG + Intergenic
1164554433 19:29240248-29240270 CAGGTAAAGGCTTCTCCCTTTGG - Intergenic
1165059943 19:33200199-33200221 ATGGGAAAGATCTCTTCTTTTGG + Intronic
1165100210 19:33434735-33434757 CTGGGAAAGGTCACGCCCTTTGG + Intronic
1166845934 19:45728531-45728553 CTGGGCAAGGGTTCTTCTTTTGG - Intronic
925295682 2:2775034-2775056 CTTGGGAAGGATTCTTTCTTAGG - Intergenic
926036357 2:9638807-9638829 CTGCAAAAGGTTTCTTCACTGGG - Intergenic
926681252 2:15665633-15665655 CTGGGTAAGATTTCTTGCCTGGG + Intergenic
928099876 2:28430733-28430755 CTGGGAGAGGGTCCTTCCTGTGG + Intergenic
932160134 2:69452409-69452431 CTGGGAAAGAATTCATCCTGGGG + Intergenic
934556868 2:95291710-95291732 CTGGCAAATGTTTCATGCTTTGG - Intergenic
935734913 2:106098773-106098795 CTGGAAACCGTTTCTTTCTTAGG - Exonic
936244752 2:110816951-110816973 CTGGGAAAGCTTCCTGCCTTTGG + Intronic
937646295 2:124269365-124269387 CTGAGCTAGGTTTCTTTCTTTGG + Intronic
938289064 2:130140023-130140045 CTGGGAAAGCTAGCTTCCTCCGG + Exonic
938467466 2:131532915-131532937 CTGGGAAAGCTAGCTTCCTCCGG - Exonic
940739426 2:157490294-157490316 CTGAGCAAGGTTTCTTACTATGG + Intergenic
941954008 2:171186079-171186101 CGGAGGAAAGTTTCTTCCTTTGG - Intronic
943437429 2:187883797-187883819 ATGAGAAATGTTTTTTCCTTTGG + Intergenic
943610238 2:190024184-190024206 CTGGTAAATGTGTCTTCCTAGGG + Intronic
944482925 2:200175526-200175548 CTGTGGAAGGTTTGTTCTTTTGG + Intergenic
944531359 2:200670575-200670597 CTGGGAAATGTTTGTGACTTAGG - Intronic
945105243 2:206305802-206305824 CTTGGAAAGGTTTACTTCTTTGG - Exonic
945531459 2:210958765-210958787 ATGGGAAAGTTTTCTCTCTTTGG - Intergenic
947294172 2:228612672-228612694 CTGGGAACAATTTCTTCTTTAGG - Intergenic
947792055 2:232873976-232873998 CTGGAAAGGGGTTCTGCCTTGGG + Intronic
948819103 2:240529592-240529614 TTGGGAAAGTTTTCTTTTTTGGG - Intronic
948963839 2:241360791-241360813 CTGTGTAATATTTCTTCCTTTGG + Intronic
1169039518 20:2481466-2481488 CTGTGAAAGCTTCCTTCCCTAGG - Intronic
1169565951 20:6853772-6853794 CACGTAAAGGTTTCTTCCATGGG + Intergenic
1170516495 20:17135621-17135643 ATGAGAAAGGTTGCTTACTTAGG - Intergenic
1171305568 20:24102990-24103012 CAGGGAAAGGTTTTTTCCTGAGG - Intergenic
1171959051 20:31480793-31480815 TATGGACAGGTTTCTTCCTTTGG - Intronic
1173302690 20:41817933-41817955 AAGGGAAAAGTTTCTGCCTTGGG - Intergenic
1173938745 20:46891985-46892007 ATGTGAAATGTTTCTTCCTGTGG - Intergenic
1174500447 20:50980507-50980529 ATGGGAAAAGTTACTTCATTGGG + Intergenic
1176024417 20:62978511-62978533 CTGGGATTGGCTACTTCCTTTGG + Intergenic
1176992933 21:15520952-15520974 CTGGGGAAGGATTCTTTCTCTGG - Intergenic
1178697070 21:34802424-34802446 CTTGGAAAGGCATCTTCCTGTGG + Intronic
1181186147 22:21105726-21105748 CTGGGACATGTTTTTTTCTTTGG + Intergenic
1182426811 22:30277994-30278016 CTGGGAAGGCTTTCCTCTTTGGG + Intergenic
1184060587 22:42078868-42078890 CTGGGAAAAGTCTGTTGCTTTGG + Exonic
1184826332 22:46954357-46954379 CTGGGAAGTGTTTCTTGGTTGGG + Intronic
949545787 3:5071071-5071093 CCGGGCAAGGTTTCTGCCCTTGG - Intergenic
949561845 3:5210048-5210070 CTGGGCCCTGTTTCTTCCTTTGG + Intronic
950324643 3:12095114-12095136 CTTGAAATGTTTTCTTCCTTTGG - Intronic
950852472 3:16075743-16075765 CTGGGAAAAGTCTCATGCTTGGG - Intergenic
952104057 3:30049671-30049693 CTGGGAAAGGATTTTCCCTTGGG + Intergenic
952104215 3:30050688-30050710 CTGGGAAAGGATTTTCCCTTGGG + Intergenic
952673425 3:35998767-35998789 CTGGTAATGGTTTCTTCTTTCGG + Intergenic
953742267 3:45547895-45547917 CTGGGAAATGGCTCTGCCTTAGG + Exonic
954101797 3:48379215-48379237 CTTGGAAAGTTTTATTCCATGGG + Intronic
954417024 3:50398226-50398248 CTGGGAGTGGTTCCTTGCTTGGG + Intronic
955104804 3:55887725-55887747 CTGGGAAATGGTTGTTCCTGTGG - Intronic
955119800 3:56046481-56046503 CTGTGAAAGGCTTCTTCAATGGG + Intronic
957123760 3:76131559-76131581 TTTGGTAAGGTTTTTTCCTTGGG + Intronic
957533758 3:81474460-81474482 CTTGGGAAGGTTTTTTCCTATGG - Intergenic
961076745 3:123989860-123989882 CTGGGAAAGGTTTCTTCCTTGGG + Intronic
961645449 3:128390490-128390512 CTGGGTTAGGTTTTTTCATTTGG - Intronic
962199644 3:133390782-133390804 CTGGGAAGGCTTTCCTCCTTGGG - Intronic
963923707 3:150929455-150929477 CTGGGATGGTTTTCTACCTTAGG + Intronic
972428825 4:38960776-38960798 CTTGTAAAGGTTTCTTCACTTGG + Intergenic
976301537 4:83520391-83520413 CAGGGAGAGGCTTCTTCCTCAGG - Intronic
976752836 4:88467087-88467109 TTGGGAAAGGTCTTTTCCTTTGG + Exonic
981050360 4:140303698-140303720 CTGGGAACTCTTACTTCCTTTGG + Intronic
981190317 4:141854889-141854911 ATGGAAAAGGATTCTTCCATAGG + Intergenic
981886080 4:149674623-149674645 CCTGGAAAGGTTTTTTTCTTTGG - Intergenic
985016576 4:185642727-185642749 CTGGCAAAGAGATCTTCCTTAGG - Intronic
985219968 4:187693567-187693589 TGGAGGAAGGTTTCTTCCTTGGG + Intergenic
986372424 5:7093205-7093227 TTGGGAAAGGTGTCCTCCTTAGG + Intergenic
986517634 5:8580855-8580877 CTGGGAAATGCTACTTCCTGGGG - Intergenic
986781942 5:11074689-11074711 GTGAGAAATGTTTTTTCCTTTGG - Intronic
987168260 5:15223723-15223745 CTGGGACATGGTTCTTCCTGAGG + Intergenic
989139591 5:38189618-38189640 TTTGGAAAGGTCTTTTCCTTTGG - Intergenic
989253345 5:39340735-39340757 CTGGGAAGGCTGTCTTCCATTGG - Intronic
991011428 5:61886924-61886946 TTGGGTAAGGTATCTCCCTTTGG + Intergenic
991574599 5:68089930-68089952 CAAGGAAGGGTTTCCTCCTTAGG - Intergenic
995313468 5:110739345-110739367 CTGGAAAAGGGTTCCTCCGTGGG - Exonic
997429775 5:133829787-133829809 CTGGGGAGGCTTTCTTCCTCAGG - Intergenic
998386731 5:141761516-141761538 AAGGGAATGGTTTCTTCCTGGGG - Intergenic
999050528 5:148519464-148519486 CTGGAGTAGGTTTCTGCCTTGGG + Intronic
1000406154 5:160890406-160890428 ATGGGGAGGGTTTCTTTCTTTGG - Intergenic
1002852961 6:1012603-1012625 ATGGCTAAGGTTTCTTCTTTGGG - Intergenic
1003032225 6:2611926-2611948 CTGGGCAAGGTGTCATGCTTTGG - Intergenic
1004316199 6:14590158-14590180 CAGGGAATGGTTCCTGCCTTTGG + Intergenic
1004903876 6:20218449-20218471 CTGGGGAAGGTTTCTTCTAAAGG - Intergenic
1004964855 6:20836869-20836891 GTGGGAAAGGTTTCTTCTCATGG + Intronic
1005011731 6:21342307-21342329 CTTGCAAACGTTTCATCCTTAGG + Intergenic
1005294205 6:24408423-24408445 CAGGGAAACGTTACTTCTTTTGG + Exonic
1007677425 6:43608389-43608411 GTGGTAAATGTTTGTTCCTTTGG + Intronic
1008399620 6:51049618-51049640 CTGGGAAGGCCTTCCTCCTTAGG - Intergenic
1008551679 6:52638865-52638887 CTGTGAAAGTTTTGTTCTTTTGG - Intergenic
1008848004 6:55991697-55991719 CTAGTGAAGGTTTTTTCCTTTGG + Intergenic
1011652745 6:89522055-89522077 CTGGCAAGGAGTTCTTCCTTGGG - Intronic
1011851404 6:91633975-91633997 TTGAGAAAGTTTTCTTCCATGGG + Intergenic
1013994351 6:116290827-116290849 CTGGAAAAAGTTTCTCCCTTTGG - Intronic
1014001135 6:116367921-116367943 CTGTGAAAAGTTTCTTGCCTCGG - Intronic
1016103082 6:140127742-140127764 CTGGGAAATGTCTCTCCCTCAGG - Intergenic
1017989526 6:159473868-159473890 CTGGGTAAGGTCTCTTCTTTGGG - Intergenic
1020684028 7:11271336-11271358 ATGGGAAAGGTTTCATCCATGGG + Intergenic
1020825390 7:13021122-13021144 TTGGGAAACGTTTCTTTTTTTGG - Intergenic
1021279397 7:18698711-18698733 CTGGGAAAAGTCACTTCCATTGG - Intronic
1021410680 7:20327072-20327094 CTCATACAGGTTTCTTCCTTTGG + Intergenic
1022646807 7:32238879-32238901 CTGGGAAATGTTATTTCCTCAGG + Intronic
1022846662 7:34216657-34216679 CTGGGGAAGTTTTCATCCTGGGG + Intergenic
1023694990 7:42836612-42836634 CTGGTAAAAGTTTCTAGCTTAGG + Intergenic
1025554466 7:62287769-62287791 ATGTGAAATGTCTCTTCCTTTGG + Intergenic
1025560315 7:62365505-62365527 ATGTGAAATGTCTCTTCCTTTGG - Intergenic
1028283925 7:88970622-88970644 GTGGGCAAGATTTCTTCCATGGG - Intronic
1030165215 7:106547662-106547684 GTGGCAAAGATTTCTTCCTTGGG + Intergenic
1030688976 7:112513509-112513531 CTGGGAAGGTGTTCTTTCTTAGG - Intergenic
1031029023 7:116714623-116714645 CTGGCAAATGCTTCTACCTTGGG - Intronic
1032503671 7:132419195-132419217 CAAGGAAAGGTTTCTACCTGGGG + Intronic
1033264977 7:139877133-139877155 CTGGGCCAGGTGTCTTGCTTTGG - Intronic
1035677554 8:1465919-1465941 CCGGGAAAGGTCCCTGCCTTGGG + Intergenic
1037420941 8:18702049-18702071 CTGGGAAAACATTCTGCCTTGGG - Intronic
1038556221 8:28519765-28519787 CGGGGAAAGGTCTCTCACTTTGG - Intronic
1038576744 8:28710908-28710930 CTGGGAAGTGTTCCTTCCTCTGG + Intronic
1039151083 8:34506296-34506318 CTGGGAAAGTTTTCTTCACGTGG + Intergenic
1039222107 8:35343570-35343592 CTGGGAAATGTTTCCCCATTTGG + Intronic
1040769589 8:50956911-50956933 CTGAGAAAGGTGTCATCCCTGGG + Intergenic
1042179223 8:66068408-66068430 CTGGTAAAGGTTTTTTCCTTTGG - Intronic
1044250463 8:89999768-89999790 CGGGGACAGATTTCTTCCTTTGG - Intronic
1045547996 8:103145207-103145229 ATGGGAAAGCCTCCTTCCTTAGG - Intronic
1045991113 8:108309615-108309637 CTTGGAAGGATTTCTTTCTTGGG - Intronic
1046947084 8:119984314-119984336 CTGGGACAGGTTTGTTACATGGG + Intronic
1047249396 8:123170367-123170389 CTGGGAAACCCTTCTTCCATAGG - Intergenic
1047495640 8:125406775-125406797 CTTCCAAAGGTTTCTTCATTTGG - Intergenic
1048245869 8:132798318-132798340 CCTGGAAAGGATTATTCCTTGGG - Intronic
1048933457 8:139335893-139335915 CTGGGAAGGGCTTGTGCCTTGGG - Intergenic
1050326541 9:4503309-4503331 CTGGGAAAAGTTTATTCATTTGG + Intronic
1050577658 9:7015103-7015125 CTGTGATAGGTTTTTTCCTTGGG + Intronic
1055176403 9:73323325-73323347 CTGGGAAAGATTTCTCCCTGAGG - Intergenic
1055349102 9:75366723-75366745 CTGAGAAAGGTTTCTCCCCTTGG + Intergenic
1060333634 9:122700468-122700490 ATGAGAAAGGTGTTTTCCTTTGG - Intergenic
1060669448 9:125456699-125456721 CTGGCAGAGTTTACTTCCTTGGG - Intronic
1062356698 9:136168256-136168278 CTGGAAAGGGTTTGATCCTTCGG + Intergenic
1062503637 9:136861868-136861890 CTGGGAAAAGTTCCTGCCCTTGG - Intronic
1062630409 9:137460771-137460793 CTGGGTACGGTCCCTTCCTTGGG - Intronic
1186146895 X:6633720-6633742 GTGGGATATTTTTCTTCCTTTGG + Intergenic
1187185378 X:16979766-16979788 CTGAGAAAGGTTTATCCCTTAGG + Intronic
1189270251 X:39746509-39746531 CTGGGAAAGGTTATTCCATTTGG - Intergenic
1190566807 X:51738764-51738786 CTGGGAAAAATATCTCCCTTGGG - Intergenic
1193545290 X:82819328-82819350 ATGGGTGAGGTTTTTTCCTTTGG - Intergenic
1198001615 X:132444616-132444638 TTATGAAAGGTTTCTTCCTGTGG - Intronic