ID: 961077820

View in Genome Browser
Species Human (GRCh38)
Location 3:123998105-123998127
Sequence CTGTGTGAGGAGAGGCAGAG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961077820_961077826 0 Left 961077820 3:123998105-123998127 CCCCTCTGCCTCTCCTCACACAG No data
Right 961077826 3:123998128-123998150 CCCATATGCTTCTCACCTACAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961077820 Original CRISPR CTGTGTGAGGAGAGGCAGAG GGG (reversed) Intergenic
No off target data available for this crispr