ID: 961078367

View in Genome Browser
Species Human (GRCh38)
Location 3:124002995-124003017
Sequence CTCCCTCTGCTGAAGGAGGT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961078367_961078371 -6 Left 961078367 3:124002995-124003017 CCCACCTCCTTCAGCAGAGGGAG No data
Right 961078371 3:124003012-124003034 AGGGAGAAGTCATCCAGTTTTGG No data
961078367_961078372 0 Left 961078367 3:124002995-124003017 CCCACCTCCTTCAGCAGAGGGAG No data
Right 961078372 3:124003018-124003040 AAGTCATCCAGTTTTGGTGAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961078367 Original CRISPR CTCCCTCTGCTGAAGGAGGT GGG (reversed) Intergenic
No off target data available for this crispr