ID: 961083957

View in Genome Browser
Species Human (GRCh38)
Location 3:124050507-124050529
Sequence GAACCCTAAGGCTACTCCTG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961083957_961083960 1 Left 961083957 3:124050507-124050529 CCTCAGGAGTAGCCTTAGGGTTC No data
Right 961083960 3:124050531-124050553 CAGGTGCCCTCATAACCATTAGG No data
961083957_961083961 2 Left 961083957 3:124050507-124050529 CCTCAGGAGTAGCCTTAGGGTTC No data
Right 961083961 3:124050532-124050554 AGGTGCCCTCATAACCATTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961083957 Original CRISPR GAACCCTAAGGCTACTCCTG AGG (reversed) Intergenic
No off target data available for this crispr