ID: 961087046

View in Genome Browser
Species Human (GRCh38)
Location 3:124077101-124077123
Sequence AGACAGGAGTTAGAGGCCAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961087046_961087049 -3 Left 961087046 3:124077101-124077123 CCTGTGGCCTCTAACTCCTGTCT No data
Right 961087049 3:124077121-124077143 TCTGCTGCTATTCCACTTCTTGG No data
961087046_961087051 8 Left 961087046 3:124077101-124077123 CCTGTGGCCTCTAACTCCTGTCT No data
Right 961087051 3:124077132-124077154 TCCACTTCTTGGTGCTGGTTTGG No data
961087046_961087050 3 Left 961087046 3:124077101-124077123 CCTGTGGCCTCTAACTCCTGTCT No data
Right 961087050 3:124077127-124077149 GCTATTCCACTTCTTGGTGCTGG No data
961087046_961087053 9 Left 961087046 3:124077101-124077123 CCTGTGGCCTCTAACTCCTGTCT No data
Right 961087053 3:124077133-124077155 CCACTTCTTGGTGCTGGTTTGGG No data
961087046_961087054 30 Left 961087046 3:124077101-124077123 CCTGTGGCCTCTAACTCCTGTCT No data
Right 961087054 3:124077154-124077176 GGACCAGACATTGTCTGCGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961087046 Original CRISPR AGACAGGAGTTAGAGGCCAC AGG (reversed) Intergenic
No off target data available for this crispr