ID: 961091932

View in Genome Browser
Species Human (GRCh38)
Location 3:124120218-124120240
Sequence GGCTCTGACTCCTGAGTTCA TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 2685
Summary {0: 1, 1: 2, 2: 15, 3: 269, 4: 2398}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961091930_961091932 -8 Left 961091930 3:124120203-124120225 CCCGACAGGGCAGGTGGCTCTGA 0: 1
1: 0
2: 2
3: 31
4: 224
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091931_961091932 -9 Left 961091931 3:124120204-124120226 CCGACAGGGCAGGTGGCTCTGAC 0: 1
1: 0
2: 2
3: 19
4: 205
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091922_961091932 21 Left 961091922 3:124120174-124120196 CCTGGACTGGTTTGGGCTGTAGC 0: 1
1: 0
2: 0
3: 3
4: 88
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091926_961091932 -1 Left 961091926 3:124120196-124120218 CCGTTCCCCCGACAGGGCAGGTG 0: 1
1: 0
2: 1
3: 25
4: 161
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091929_961091932 -7 Left 961091929 3:124120202-124120224 CCCCGACAGGGCAGGTGGCTCTG 0: 1
1: 0
2: 5
3: 23
4: 195
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091918_961091932 30 Left 961091918 3:124120165-124120187 CCAGGCCTTCCTGGACTGGTTTG 0: 1
1: 0
2: 0
3: 17
4: 197
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091928_961091932 -6 Left 961091928 3:124120201-124120223 CCCCCGACAGGGCAGGTGGCTCT 0: 1
1: 0
2: 0
3: 27
4: 167
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398
961091921_961091932 25 Left 961091921 3:124120170-124120192 CCTTCCTGGACTGGTTTGGGCTG 0: 1
1: 0
2: 2
3: 12
4: 197
Right 961091932 3:124120218-124120240 GGCTCTGACTCCTGAGTTCATGG 0: 1
1: 2
2: 15
3: 269
4: 2398

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961091932 Original CRISPR GGCTCTGACTCCTGAGTTCA TGG Intronic
Too many off-targets to display for this crispr