ID: 961093572

View in Genome Browser
Species Human (GRCh38)
Location 3:124136403-124136425
Sequence GATCAGGGGCTCTCATAGCA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 162
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 146}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961093572_961093577 -5 Left 961093572 3:124136403-124136425 CCTTGCTATGAGAGCCCCTGATC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 961093577 3:124136421-124136443 TGATCCTTTAGAACGAGAGGAGG 0: 1
1: 0
2: 0
3: 8
4: 76
961093572_961093575 -8 Left 961093572 3:124136403-124136425 CCTTGCTATGAGAGCCCCTGATC 0: 1
1: 0
2: 1
3: 14
4: 146
Right 961093575 3:124136418-124136440 CCCTGATCCTTTAGAACGAGAGG 0: 1
1: 0
2: 0
3: 5
4: 59

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961093572 Original CRISPR GATCAGGGGCTCTCATAGCA AGG (reversed) Intronic
903471497 1:23590832-23590854 GAGCAGTGGTTCTCATAGTAGGG - Intronic
904915122 1:33964687-33964709 GAGCAGGGGCTTTCATATGATGG - Intronic
905107083 1:35570363-35570385 GATCAGTGGCTCTCAAAGTGTGG - Intergenic
908604525 1:65781230-65781252 GATCAAGTGCTTTCATACCAGGG + Intergenic
909449048 1:75778210-75778232 GAGCAGTGGTTCTCACAGCACGG + Intronic
911700747 1:100949516-100949538 GAGCAGTGGTTCTCCTAGCATGG - Intronic
918783607 1:188733879-188733901 AATCAGGGGCTTCTATAGCAAGG + Intergenic
922084815 1:222336295-222336317 AATAAGGGGCTCTCAATGCAGGG - Intergenic
1062984107 10:1751149-1751171 GATCAGTGGCTGTCAGAGCTTGG + Intergenic
1066223405 10:33357950-33357972 GAGCAGTGGTTCTCAAAGCATGG + Intergenic
1069188967 10:65463923-65463945 GAGCAGTGGTTCTCCTAGCATGG - Intergenic
1069572469 10:69502696-69502718 GGTGAGGGGCTCTCCTGGCAGGG + Intronic
1072633494 10:97163279-97163301 GATGAGGGGCACTCATGGGAGGG - Intronic
1075634439 10:124020567-124020589 GCTCAGCGTCTCGCATAGCAAGG - Intronic
1078392843 11:10951790-10951812 GAGCAGGGGATCTCCCAGCATGG - Intergenic
1080405316 11:31973434-31973456 GAGCAGGGGCTCCCAGGGCAGGG + Intronic
1084278100 11:68066719-68066741 GAGCAGGGGTTCTCATGGCCAGG - Intronic
1084343373 11:68524814-68524836 GGCCAGGGGCTCTGATGGCATGG - Intronic
1087709467 11:101532501-101532523 CATGAGGGTCACTCATAGCATGG + Intronic
1089192893 11:116667334-116667356 GAGCAGTGGTTCTCCTAGCATGG + Intergenic
1089291797 11:117441752-117441774 GCCAAGGGGCTCTCAGAGCAGGG + Intronic
1089882865 11:121791733-121791755 AATCAGTGGCTCTCAAAGCACGG - Intergenic
1090103743 11:123829720-123829742 GAGCAGTGGTTCTCCTAGCATGG - Intergenic
1093433587 12:19110557-19110579 GATCATGAGCTCTGATAGCTAGG + Intergenic
1093763568 12:22937534-22937556 GGTGAGGGCCTCTCATAACATGG - Intergenic
1094135364 12:27119804-27119826 GAGCAGGGGCTCTCCCAGCATGG - Intergenic
1100044273 12:90359310-90359332 GTAGAGGGGCTCACATAGCAAGG + Intergenic
1107996348 13:45864810-45864832 GGTCAGGGGCTCTCTAGGCAGGG + Intergenic
1108184931 13:47879027-47879049 GATCAGTGGTTCTCAAAGTATGG - Intergenic
1110606913 13:77443362-77443384 GAGCAGTGGTTCTCCTAGCATGG - Intergenic
1110826371 13:79975663-79975685 GAGCAGTGGTTCTCACAGCATGG + Intergenic
1112266806 13:97931912-97931934 GATCAGGGCGTCCCACAGCAAGG + Intergenic
1114167566 14:20235655-20235677 GAGCAGTGGCTCTCCCAGCACGG - Intergenic
1115135899 14:30107573-30107595 GAGCAGTGGCTCTCCCAGCACGG + Intronic
1115183982 14:30664017-30664039 GAGCAGTGGTTCTCCTAGCATGG + Intronic
1115362335 14:32517841-32517863 GAGCAGTGGTTCTCCTAGCACGG + Intronic
1117887684 14:60382241-60382263 GAGCAGTGGTTCTCCTAGCAGGG + Intergenic
1118648747 14:67867678-67867700 AAACTGGGGCTCTCATAGCGAGG + Intronic
1118821343 14:69348068-69348090 AATCAGGGGCTCTCCTGCCAAGG - Intronic
1119537312 14:75413047-75413069 GCTCAGGGGCTCACAATGCAGGG + Intergenic
1123808304 15:23897598-23897620 GATGAGGGGCTCTTAGGGCAAGG - Intergenic
1124350784 15:28954171-28954193 GATGACAGGCTCTCATCGCACGG - Intronic
1126383713 15:48073233-48073255 TAGCAGTGGCTCTCACAGCAGGG + Intergenic
1127918381 15:63473964-63473986 GAGCAGTGGTTCTCAGAGCAAGG - Intergenic
1127961685 15:63895141-63895163 GATCAGGGGTTCTCAAAGTGTGG - Intergenic
1130999896 15:88931612-88931634 GATAAGGAGCTCACCTAGCAAGG - Intergenic
1134625439 16:15719551-15719573 CATCTGAGGCTCTCCTAGCAAGG + Intronic
1134793190 16:17009741-17009763 GAGCAGTGGTTCTCACAGCATGG - Intergenic
1134876974 16:17709312-17709334 GAACAGTGGCTCTCAAAGTATGG + Intergenic
1135046321 16:19158937-19158959 GACCAGTGGTTCTCAAAGCATGG - Intronic
1140430413 16:74898252-74898274 GATCAGGGGCTTTTAGACCATGG - Intronic
1142323928 16:89402017-89402039 GACCAGGAGCTTTCACAGCAAGG - Intronic
1146916920 17:36683834-36683856 GATCAGGGCCTCTTAAAGCATGG + Intergenic
1148795020 17:50192781-50192803 CATCAGGGACACTCACAGCAGGG + Exonic
1149225487 17:54465403-54465425 GAGCAGTGGTTCTCCTAGCATGG - Intergenic
1149932016 17:60766699-60766721 GAGCAGTGGTTCTCACAGCATGG - Intronic
1150662302 17:67093571-67093593 GACCAGGAGCTCCCATGGCAAGG - Intronic
1151785055 17:76271414-76271436 CACCAGGGGCTCTGACAGCAAGG + Intergenic
1151821797 17:76500840-76500862 GATGAGGGACTCACACAGCAGGG - Intronic
1152274949 17:79350723-79350745 CATCAGGGGCTCTCACAGGATGG - Intronic
1158285891 18:55882371-55882393 GTTGAGGGGCTCTTATAACACGG + Intergenic
1159027885 18:63202836-63202858 CATCAGGGGCTCTCTAAACAAGG + Intronic
1160409288 18:78664192-78664214 GGTGACGGGCTCCCATAGCAGGG + Intergenic
1161951201 19:7469100-7469122 GAGCAGGGGCTCTCAGCGCTGGG + Exonic
1162776041 19:12980073-12980095 GACCAGAGACTCTCAGAGCAGGG + Intergenic
1163534920 19:17871721-17871743 GATCAGGGGATCACAGTGCATGG + Intergenic
1163699703 19:18781128-18781150 ACGCAGGGGCTCTCAGAGCAAGG + Exonic
931684872 2:64784566-64784588 CCTCAGGGCCTCTCAGAGCAGGG - Intergenic
931836196 2:66100418-66100440 GATTGGTGGCTCTCAAAGCATGG - Intergenic
932595265 2:73089402-73089424 TATCAGTGGCTCTCAGAGCAAGG - Intronic
936551964 2:113451632-113451654 GATCAGTGGCTCTCAAACCAGGG - Intronic
936555227 2:113491127-113491149 GATCAAGGGGTTTCATACCAGGG + Intronic
936720924 2:115252308-115252330 GAACAGTGGCTCCCACAGCAAGG - Intronic
936775306 2:115965522-115965544 GAGCAGTGGTTCTCACAGCATGG - Intergenic
937078793 2:119125817-119125839 GACCAGTGGCTCTCAAAGTATGG + Intergenic
938342400 2:130544311-130544333 GAGCAGGGGCCCTCCTAGCCAGG + Intronic
938347432 2:130576398-130576420 GAGCAGGGGCCCTCCTAGCCAGG - Intronic
939974822 2:148705469-148705491 GAGCAGTGGCTCTCCCAGCACGG + Intronic
947151079 2:227116124-227116146 AATTAGGGGTTCACATAGCAGGG + Intronic
948199546 2:236119880-236119902 GATCAGCGGCTCTCACACCTTGG + Intronic
948313770 2:237010905-237010927 CTTAATGGGCTCTCATAGCATGG + Intergenic
1169659034 20:7958029-7958051 GAGCAGTGGTTCTCCTAGCATGG - Intergenic
1171050530 20:21854055-21854077 GAGCAGTGGTTCTCACAGCATGG + Intergenic
1174589702 20:51635353-51635375 GCTCAGGGTCTCTCACAGCCTGG - Intronic
1175291299 20:57877300-57877322 GATCACGTGCTCTCGGAGCATGG + Intergenic
1178752389 21:35317247-35317269 GAGCAGGGGCTCCCAAAACAAGG - Intronic
1181972094 22:26698613-26698635 GAGCAGGGACTCTGAAAGCAGGG + Intergenic
1183624872 22:38995792-38995814 GATCAGGGGCTTTCCAGGCATGG - Intergenic
1184105869 22:42367306-42367328 TATGATGGACTCTCATAGCATGG - Intergenic
950701651 3:14754419-14754441 GAACAGGGGCTGTCATTCCATGG + Intronic
950796452 3:15514281-15514303 GAACAGAGGCTCTTACAGCATGG + Intronic
952550520 3:34471737-34471759 GAGCAGTGGCTCTCCCAGCATGG - Intergenic
952759474 3:36901362-36901384 GATAAGGGGCTATCTTAGCAAGG - Intronic
953662265 3:44899840-44899862 GGTCAGGGCAGCTCATAGCATGG + Intronic
955779865 3:62472900-62472922 GATCAGTGGTTCTCATAGTGTGG + Intronic
961093572 3:124136403-124136425 GATCAGGGGCTCTCATAGCAAGG - Intronic
963023301 3:140893638-140893660 GATCAGTGGGTTTCATACCAAGG - Intergenic
966494159 3:180560539-180560561 GAGCAGTGGTTCTCCTAGCATGG + Intergenic
969411416 4:7030907-7030929 GAACAGGGGCTCTCTGAGGATGG + Exonic
969593886 4:8137292-8137314 GACCAGGGACTCCCAGAGCAGGG - Intronic
969676327 4:8616429-8616451 GAGCAGGGGCTCTCCCAGGAGGG - Intronic
969854677 4:9989629-9989651 TATCAGGGGGTCTCAGAGCCTGG - Intronic
973554900 4:52073058-52073080 GAATGGGGGCTCTCATAGCCTGG - Intronic
974871787 4:67653167-67653189 GAGCAGTGGTTCTCATAGCATGG + Intronic
975115060 4:70670990-70671012 GATCAGGGACCCTAAAAGCAGGG + Intronic
977624062 4:99170980-99171002 CACCAGGGTCTCTCATAGGATGG - Intergenic
979315340 4:119255230-119255252 GAGCAGTGGTTCTCCTAGCATGG - Intronic
981672294 4:147300757-147300779 GATCAAAGGCTTTCACAGCATGG - Intergenic
986149574 5:5115171-5115193 GAGCAGTGGCTCTCCTAGCATGG - Intergenic
990721319 5:58699469-58699491 GAGCAGTGGCTCTCCCAGCATGG - Intronic
990898962 5:60729480-60729502 GATCAGTGGTTCTCCCAGCATGG + Intergenic
992756518 5:79911628-79911650 GAGCAGTGGTTCTCCTAGCAGGG + Intergenic
993546653 5:89220522-89220544 GAGCAGTGGTTCTCCTAGCATGG + Intergenic
996804453 5:127439123-127439145 GGGCAGTGGCTCTCAAAGCATGG - Intronic
998965043 5:147530077-147530099 GATCAGGGGTTCTCAGAGATTGG + Intergenic
1001346330 5:170903025-170903047 GAGCAGGGGATCTCCCAGCATGG - Intronic
1002673069 5:180885912-180885934 GAGCAGTGGTTCTCTTAGCATGG - Intergenic
1005438064 6:25836354-25836376 GAACAGGGGCTCTGTTATCAGGG + Intronic
1007218773 6:40262236-40262258 AATCAGGGACTCTCAAAGTATGG + Intergenic
1009295381 6:61940766-61940788 GATCATGGGCTAACATACCAGGG + Intronic
1009393296 6:63167595-63167617 GATCAGTGGTTCTCCTAGCATGG + Intergenic
1010102448 6:72125488-72125510 GAGCAGTGGATCTCCTAGCATGG - Intronic
1011537424 6:88391332-88391354 GAGCAGGGGTTCTCCCAGCATGG + Intergenic
1011743863 6:90389845-90389867 GTTCAGGGGCTTTCCAAGCATGG + Intergenic
1014616701 6:123610627-123610649 CATTATAGGCTCTCATAGCATGG - Intronic
1020818759 7:12939601-12939623 GACCAGTGGTTCTCAAAGCACGG - Intergenic
1021936226 7:25634685-25634707 GATCAGATTCTCTCATATCATGG - Intergenic
1022334129 7:29406634-29406656 GATCAGTGGTTCTCAAAGCATGG + Intronic
1022545582 7:31185705-31185727 GACCAGGAGATCTCATAGGAAGG + Intergenic
1026159235 7:67854004-67854026 CATCAGTGGCTGTCACAGCATGG + Intergenic
1027732949 7:81899168-81899190 GATCAGTGGGTCTTATACCAGGG - Intergenic
1028451973 7:90995248-90995270 GAGGAGGGGCCCTCATATCAAGG + Intronic
1030166372 7:106559933-106559955 GAGCAGTGGTTCTCTTAGCATGG - Intergenic
1032601751 7:133304373-133304395 GCCCAGGGGCTCTCATAGCAGGG + Intronic
1033490571 7:141839266-141839288 GATCAGTGGTTCTCATATAAGGG - Intronic
1041221582 8:55656764-55656786 GAGCAGTGGTTCTCCTAGCATGG + Intergenic
1043703299 8:83318174-83318196 AATCAGGGGCTTATATAGCAAGG - Intergenic
1044595199 8:93952798-93952820 GAGCAGTGGATCTCCTAGCACGG - Intergenic
1045658798 8:104414476-104414498 GAGCAGAGGTTCTCAAAGCATGG - Intronic
1049790435 8:144469889-144469911 AATGAGGGGCCCTCATAGCTGGG - Intronic
1049897769 9:126051-126073 GATCAAGGGGTTTCATACCAGGG - Intronic
1049901041 9:165522-165544 GATCAGTGGCTCTCAAATCAGGG + Intronic
1051736782 9:20208329-20208351 GGAGAGGGGCTCGCATAGCACGG + Intergenic
1053740861 9:41136347-41136369 GATCAAGGGGTTTCATACCAGGG - Intronic
1053744074 9:41175837-41175859 GATTAGTGGCTCTCAAACCAGGG + Intronic
1054349350 9:64005640-64005662 GATCAGTGGCTCTCAAACCAGGG + Intergenic
1054443849 9:65292492-65292514 GATCAAGGGGTTTCATACCAGGG - Intergenic
1054483199 9:65689460-65689482 GATCAGTGGCTCTCAAACCAGGG - Intronic
1054486424 9:65729011-65729033 GATCAAGGGGTTTCATACCAGGG + Intronic
1054684269 9:68255416-68255438 GATTAGTGGCTCTCAAACCAGGG - Intronic
1054687490 9:68294952-68294974 GATCAAGGGGTTTCATACCAGGG + Intronic
1056348427 9:85723179-85723201 GAGCAGTGGCTCTCCCAGCATGG - Intronic
1056700405 9:88901017-88901039 GATTAGGTGCCCTCATAGAAGGG - Intergenic
1058161029 9:101570996-101571018 GTTCAGGGGCACGCAGAGCATGG + Exonic
1058735328 9:107888912-107888934 GATCAGGGTTTCACAGAGCAGGG - Intergenic
1060247726 9:121960418-121960440 GACATGGGGCTCTCAGAGCATGG - Intronic
1189867539 X:45346671-45346693 GATCAGTGGTTCTCAAAGTATGG - Intergenic
1192014161 X:67310994-67311016 GATCAATGGTTTTCATAGCAGGG - Intergenic
1197959663 X:131990093-131990115 GAGCAGTGGTTCTCACAGCATGG + Intergenic
1200378512 X:155809403-155809425 GAGCAGTGGTTCTCCTAGCATGG + Intergenic
1201306867 Y:12558276-12558298 GATCAGTGGGTTTCATACCAGGG - Intergenic
1201353495 Y:13072239-13072261 GAGCAGTGGTTCTCCTAGCATGG + Intergenic