ID: 961095682

View in Genome Browser
Species Human (GRCh38)
Location 3:124154288-124154310
Sequence GGGTATTCAATTACAAAAAC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 11981
Summary {0: 1, 1: 7, 2: 186, 3: 7530, 4: 4257}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961095678_961095682 8 Left 961095678 3:124154257-124154279 CCAGGGCAATTAGGCAGGAGAAG 0: 3432
1: 3970
2: 2749
3: 4464
4: 5213
Right 961095682 3:124154288-124154310 GGGTATTCAATTACAAAAACAGG 0: 1
1: 7
2: 186
3: 7530
4: 4257

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961095682 Original CRISPR GGGTATTCAATTACAAAAAC AGG Intronic
Too many off-targets to display for this crispr