ID: 961096041

View in Genome Browser
Species Human (GRCh38)
Location 3:124157856-124157878
Sequence AGGGGCATTCGCAGGGGAAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 242
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 227}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961096041_961096058 27 Left 961096041 3:124157856-124157878 CCCTTTCCCCTGCGAATGCCCCT 0: 1
1: 0
2: 0
3: 14
4: 227
Right 961096058 3:124157906-124157928 GCTCCAGGTGCAGTGGCTGTGGG 0: 1
1: 0
2: 7
3: 41
4: 327
961096041_961096055 20 Left 961096041 3:124157856-124157878 CCCTTTCCCCTGCGAATGCCCCT 0: 1
1: 0
2: 0
3: 14
4: 227
Right 961096055 3:124157899-124157921 TCCTGTTGCTCCAGGTGCAGTGG 0: 1
1: 0
2: 2
3: 33
4: 332
961096041_961096053 12 Left 961096041 3:124157856-124157878 CCCTTTCCCCTGCGAATGCCCCT 0: 1
1: 0
2: 0
3: 14
4: 227
Right 961096053 3:124157891-124157913 TTCCTGAGTCCTGTTGCTCCAGG 0: 1
1: 0
2: 1
3: 12
4: 242
961096041_961096057 26 Left 961096041 3:124157856-124157878 CCCTTTCCCCTGCGAATGCCCCT 0: 1
1: 0
2: 0
3: 14
4: 227
Right 961096057 3:124157905-124157927 TGCTCCAGGTGCAGTGGCTGTGG 0: 1
1: 0
2: 4
3: 84
4: 599

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961096041 Original CRISPR AGGGGCATTCGCAGGGGAAA GGG (reversed) Intronic
901709974 1:11106166-11106188 GGGGGCATTCTCAGCAGAAAAGG - Intergenic
902756702 1:18553599-18553621 AGGGGGATTCGCACGTGCAAAGG - Intergenic
902789188 1:18753893-18753915 AGGAGCATTCCCAGGCAAAAGGG + Intergenic
904858020 1:33514614-33514636 AGGGGCATAAGAAGGGGGAAGGG + Exonic
905851767 1:41280035-41280057 AGGGGCATCTGCAGGAGAAGGGG - Intergenic
906270007 1:44469805-44469827 AGAGGCAATCGCAGGTGCAAAGG + Intronic
907464272 1:54624600-54624622 AGAGGCATTAGTAGAGGAAAGGG + Intronic
907491567 1:54811976-54811998 AGGGGCACTCCCAGGGCAGAGGG + Intronic
908114881 1:60930657-60930679 TGGGGGATGCGCAGGGGAAGTGG + Intronic
908925432 1:69249066-69249088 AGGGGCATTGGCATGGAAAAGGG - Intergenic
909583683 1:77265604-77265626 AGGGGCTTTAGCAGGAGAAGAGG - Intergenic
912695916 1:111842170-111842192 CACGGCATTCGCAGGGGACAGGG + Intronic
912707013 1:111922194-111922216 GGCGGCATTGGCAGGAGAAAAGG + Intronic
914244074 1:145872959-145872981 AGGGGCCCTTGGAGGGGAAAAGG - Exonic
915461955 1:156075696-156075718 AGGGGCAGGGGCAGGGGGAAGGG + Exonic
918702752 1:187626161-187626183 AGGGGACTTCCCAGAGGAAAAGG + Intergenic
919991156 1:202709469-202709491 AGGAGCATAGGCAGGGGAAGGGG + Intronic
920960948 1:210663656-210663678 AGGGGAATCTGCAGGGGGAAGGG - Intronic
921564286 1:216698016-216698038 AGGGGCAAACGGAGGGGACAGGG - Intronic
924005094 1:239600373-239600395 AGGTGCATAAGCAGGCGAAATGG - Intronic
924316411 1:242802126-242802148 AAGTGAATTCCCAGGGGAAAGGG + Intergenic
1062763629 10:45731-45753 ATGGGCATTCCCAGGGGACCTGG + Intergenic
1063251452 10:4279516-4279538 GGGTGCATTCACAGGAGAAAAGG + Intergenic
1063662907 10:8046128-8046150 AGGGGCATCCGAAGCGGAAGGGG + Intergenic
1064942124 10:20746753-20746775 TGGGGCATGGGGAGGGGAAATGG - Intergenic
1065721076 10:28629292-28629314 GCGGGCATTCCCAGGAGAAAGGG - Intergenic
1069461813 10:68602454-68602476 ATGGGGATTAGCAGGAGAAAGGG + Intronic
1074314006 10:112345720-112345742 GGGAGAATTCCCAGGGGAAAGGG + Intergenic
1075745914 10:124727386-124727408 AGGGCCATTCACAGGGTAGAAGG + Intronic
1076314177 10:129529162-129529184 AGGGGCAGTGGCAGGGGGAGCGG + Intronic
1076585962 10:131547820-131547842 AGGGGCCTTCTCAGAGGAAAGGG + Intergenic
1077556746 11:3229736-3229758 AGGGACATGGCCAGGGGAAAGGG - Intronic
1083183271 11:61002206-61002228 ATGCCCATTCACAGGGGAAACGG - Intronic
1083481072 11:62947327-62947349 CGGGGAATTAGGAGGGGAAAAGG - Intronic
1085076343 11:73596579-73596601 AGGGGACTTTGCAGGGGACACGG - Intronic
1085413202 11:76303768-76303790 AGGGGTAATCTCAGGGGACAGGG + Intergenic
1085484645 11:76851742-76851764 AGGGGCACTGGCAGGAGACATGG + Intergenic
1090610635 11:128467533-128467555 AGGGGGAGTTGCAGGGGGAATGG - Intronic
1091502506 12:1032557-1032579 TGGGGCATGTGTAGGGGAAAAGG + Intronic
1093809946 12:23479689-23479711 TGGGGCAATGGCAGGGGAAATGG + Intergenic
1094555745 12:31497907-31497929 AGGGGCAGGGGCAGGGGCAAGGG + Intronic
1094599728 12:31898135-31898157 AGGGGAATTGGCAGGGGAGCAGG - Intergenic
1096975174 12:55695658-55695680 AGGGGCATTCCTAGGGGGCAAGG + Intronic
1097166678 12:57089759-57089781 AGGAGCATCAGCGGGGGAAAGGG + Intronic
1100223707 12:92534872-92534894 AGGGGCATTCAGCGGGGGAATGG + Intergenic
1101058924 12:100950560-100950582 TGGGGCAATCTCAGGAGAAAGGG + Intronic
1101272445 12:103162035-103162057 TGGGGCATTAGGAGGGAAAAGGG - Intronic
1102043788 12:109817205-109817227 AGGGGCATCTGCAGGGGCACAGG + Intronic
1102776224 12:115521929-115521951 AGGGGCCTACGCAGGAGAGAGGG + Intergenic
1103905621 12:124325981-124326003 AGGGGCACAGGCAGAGGAAAAGG - Intronic
1105424660 13:20284140-20284162 AGGGGCAATCTCAGGGAAATAGG + Intergenic
1105465001 13:20631720-20631742 AGGGGCATTTGTAGGGAGAAGGG + Intronic
1105834086 13:24193238-24193260 AAGGGGAGTTGCAGGGGAAATGG + Intronic
1108916441 13:55618548-55618570 TGGGTCATTAGAAGGGGAAATGG + Intergenic
1109578937 13:64300293-64300315 AAGGGAACTCCCAGGGGAAAGGG + Intergenic
1111557962 13:89906157-89906179 GGGGGCAGTAGCAGAGGAAATGG - Intergenic
1112530082 13:100192793-100192815 AGGAGCATTTGAGGGGGAAAAGG - Intronic
1112643755 13:101306337-101306359 ATGGGCATCTGCAGAGGAAATGG - Intronic
1112653625 13:101425160-101425182 AGGGTCATTCTCTGGGGAAGGGG - Intergenic
1114496425 14:23136261-23136283 AGGGGCAGTAGCATGGGAGAGGG - Intronic
1116655760 14:47651645-47651667 AGGGGTACTCACAGGGCAAATGG + Intronic
1119638233 14:76293889-76293911 AGGGGATTTCTCAGGAGAAAGGG + Intergenic
1120518447 14:85498021-85498043 AGGGTGCTTGGCAGGGGAAAAGG - Intergenic
1120957765 14:90097895-90097917 AGGGGCAGAGGAAGGGGAAATGG + Intronic
1121112236 14:91320396-91320418 AGGGGCACCCGCAGAGGACAGGG + Intronic
1121275857 14:92667074-92667096 AGGGGCAGCCGCAGAGGAATTGG + Intronic
1123473555 15:20571583-20571605 AGGGGCATACACAGAAGAAATGG - Intergenic
1123644454 15:22428770-22428792 AGGGGCATACACAGAAGAAATGG + Intergenic
1123665770 15:22608678-22608700 AGGGGCATACACAGAAGAAATGG + Intergenic
1123733853 15:23166594-23166616 AGGGGCATACACAGAAGAAATGG - Intergenic
1123751990 15:23363975-23363997 AGGGGCATACACAGAAGAAATGG - Intronic
1123784276 15:23653641-23653663 AGGGGCATTGCCAGGGGTAGGGG - Intergenic
1124482919 15:30092339-30092361 AGGGGCATACACAGAAGAAATGG - Intronic
1124489372 15:30144410-30144432 AGGGGCATACACAGAAGAAATGG - Intronic
1124520657 15:30404879-30404901 AGGGGCATACACAGAAGAAATGG + Intronic
1124538000 15:30561340-30561362 AGGGGCATACACAGAAGAAATGG - Intronic
1124544460 15:30613401-30613423 AGGGGCATACACAGAAGAAATGG - Intronic
1124754157 15:32393917-32393939 AGGGGCATACACAGAAGAAATGG + Intronic
1124760649 15:32446245-32446267 AGGGGCATACACAGAAGAAATGG + Intronic
1124777982 15:32602817-32602839 AGGGGCATACACAGAAGAAATGG - Intronic
1125379380 15:39071051-39071073 AGGGGCATTCACAATGGAATGGG - Intergenic
1125444307 15:39736949-39736971 AGGGAAATTCTCAGGGGAAGGGG + Intronic
1126352226 15:47756244-47756266 AGGGGCATTCTTAGAGGATAAGG - Intronic
1127065808 15:55236991-55237013 ATTGGCATTGGCGGGGGAAACGG - Intronic
1127462783 15:59214772-59214794 ACGGGCATGCACTGGGGAAAGGG + Intronic
1128535348 15:68486112-68486134 AGGGGCATTGGCAGGAGTACAGG - Intergenic
1129227063 15:74176173-74176195 AGGGGCATTGGTAGGGGCAAGGG - Exonic
1129889977 15:79065532-79065554 TGGGGCATTGGCAGGAGGAAGGG + Intronic
1131034574 15:89213292-89213314 AGGGGCATAAGAAGTGGAAAGGG + Intronic
1131112994 15:89776908-89776930 AGGGGCAGGGGCAGGGGCAAGGG + Exonic
1131352975 15:91718362-91718384 AGGGGCAGGGGCAGGGGACATGG + Intergenic
1132661497 16:1063380-1063402 AGGGGGATCAGCAGGGGAAGGGG + Intergenic
1134128884 16:11635134-11635156 AGGGGAATTTGCAAGGGAGAAGG - Intronic
1134624627 16:15714819-15714841 AGGGGCATTTGCAGGCCGAAAGG + Intronic
1134782912 16:16914904-16914926 AGTGGCATTGGCAGGTCAAAGGG - Intergenic
1136537279 16:30907451-30907473 AGGGGCATGAGCAGGGGACGAGG - Intergenic
1137446777 16:48536736-48536758 GGGGGCATTCACTGGGGAAATGG - Intergenic
1138961206 16:62032477-62032499 ATTGGCATTCACAGAGGAAATGG - Intronic
1141134412 16:81456321-81456343 TGAGGCGTTAGCAGGGGAAATGG + Intronic
1141178996 16:81739579-81739601 AGGGGCAGCCGCAGGAGAAGGGG - Intronic
1141850950 16:86645618-86645640 AGGGTCATACTCAGGGGAAGAGG + Intergenic
1143628328 17:8123276-8123298 AGGGGCATTGGGAGGGGGAGCGG - Intronic
1144958592 17:19032380-19032402 AGAGGCATGTGAAGGGGAAATGG - Intronic
1144976567 17:19142144-19142166 AGAGGCATGTGAAGGGGAAATGG + Intronic
1147491342 17:40870257-40870279 AGAAGCATTCTCAGGAGAAAGGG - Intergenic
1147677500 17:42218362-42218384 AGGGGCTGGTGCAGGGGAAAGGG + Intronic
1147688541 17:42301221-42301243 AGGGGTTGGCGCAGGGGAAAGGG - Intronic
1151378092 17:73705352-73705374 AATGGCACTCGAAGGGGAAACGG + Intergenic
1151957471 17:77387676-77387698 AGGGGCAGATCCAGGGGAAAGGG - Intronic
1152956538 18:46062-46084 ATGGGCATTCCCAGGGGACCTGG + Intergenic
1155679254 18:28469543-28469565 AGGGGCATTAGCTGGGCCAAGGG + Intergenic
1157693262 18:49700811-49700833 AGGGGCCCTCGGAGGGGAAATGG + Intergenic
1158033137 18:52991541-52991563 AGAGGGATTCACAGAGGAAAGGG - Intronic
1158238911 18:55354243-55354265 ATGGCCATTTGCAGGGGAATTGG - Intronic
1158837732 18:61348763-61348785 AGGAACATTCGGAGGGGAATTGG + Intronic
1161988351 19:7669939-7669961 GGGGGCATTCCCAGGGGACTTGG - Intronic
1162537990 19:11275484-11275506 AGAGACATTTGCAGGGGGAATGG + Intergenic
1164776360 19:30856670-30856692 AGGGGAATTCACAGGGGTATAGG - Intergenic
1165820198 19:38670097-38670119 AGGGGCATATGGAGGAGAAAGGG - Intronic
1166693884 19:44841366-44841388 AGGGGCATAGGTAGGGGCAAAGG - Intergenic
1168270075 19:55245087-55245109 AGGGGAATCCGCAGGGGCATCGG + Intronic
1168317016 19:55488932-55488954 AGGGGCCTGCGCTGGAGAAAGGG + Intronic
925163218 2:1701447-1701469 ACCGGCAGTCGCAGGAGAAATGG + Intronic
925966153 2:9068294-9068316 AGGGGGATTCTAAGGGGAGAGGG - Intergenic
926305786 2:11636718-11636740 AGGGGCAAGGGCAGGGGTAAGGG + Intronic
926305795 2:11636742-11636764 ATGGGCATGGGCAGGGGCAAGGG + Intronic
928088217 2:28358891-28358913 AGGGGCAGGCACAGGGGAAGGGG - Intergenic
928441407 2:31295330-31295352 AGGGGGCTTGGCAGGTGAAAAGG - Intergenic
929303828 2:40336581-40336603 TGGAGGATTCCCAGGGGAAAAGG - Intronic
929595239 2:43171312-43171334 AGGGGCATAGGCAAGGGAAGGGG + Intergenic
930127638 2:47815296-47815318 AGGGGGATACCCAGGGGAAGGGG - Intronic
932573567 2:72950862-72950884 AGGGGCCTTCTCCGGGGATAAGG + Intronic
935376111 2:102399487-102399509 AGGGGCCTGCGGAGGGGAAGCGG + Intergenic
935622094 2:105139154-105139176 TGTGGCACTCGCAGGAGAAACGG - Intergenic
935712424 2:105910971-105910993 AGGGGCTTGCGGAGGCGAAAAGG + Intergenic
936059352 2:109284156-109284178 AGGGGCGGTCCCAGGGGAAGGGG + Intronic
938064333 2:128272939-128272961 AGGGGCAACGGCAGGGGAAAGGG + Intronic
938143353 2:128813547-128813569 AGGGGAATGGGCAGGGGAGAGGG - Intergenic
938289128 2:130140246-130140268 GTGGGCTTTCGCAGGGGAAGGGG + Exonic
938467400 2:131532692-131532714 GTGGGCTTTCGCAGGGGAAGGGG - Exonic
939275321 2:139991411-139991433 AGAGACCTTAGCAGGGGAAATGG + Intergenic
939866771 2:147481735-147481757 AGGAGCACAGGCAGGGGAAAAGG + Intergenic
941527923 2:166628951-166628973 ATGGGCATTCCCAGGGTAGAGGG + Intergenic
942364673 2:175212314-175212336 AGTGGCATTCAAAGGGGCAATGG + Intergenic
942670284 2:178367979-178368001 AGTGGCATAAGCAAGGGAAAAGG - Intronic
944506534 2:200418202-200418224 AGGGGCTTTCTCACCGGAAAAGG + Intronic
946011646 2:216569355-216569377 AGGTGCTTCCGCAGGGGAATTGG + Intronic
946409303 2:219508426-219508448 AGAGGCAGTGGAAGGGGAAAGGG + Intergenic
947787390 2:232835868-232835890 AGGGATATTCTCAGGGCAAACGG - Intronic
948239022 2:236413229-236413251 AGGAACATTCTCTGGGGAAAAGG - Intronic
1169147400 20:3261863-3261885 AGGGGAATTTGCAGGGGCTAAGG + Intronic
1171458278 20:25283932-25283954 AGGGGTCTTCTCATGGGAAAAGG - Intronic
1173633717 20:44536434-44536456 AAGGGCAGTGGCAGCGGAAAGGG + Intronic
1174528170 20:51190182-51190204 AGGGGCAGTCACAGGGGCCAGGG - Intergenic
1175285304 20:57833617-57833639 AGGGGCCCTCGCTGGGAAAAGGG + Intergenic
1175389437 20:58617189-58617211 AGGTGCATTCCCAGGAGAAATGG - Intergenic
1175626614 20:60493516-60493538 AGAGCCATTAGAAGGGGAAATGG + Intergenic
1176196011 20:63836538-63836560 AGGGGCAGGGGCAGGGGAGAAGG + Intergenic
1179243158 21:39609531-39609553 ATGGGCAGTGGCTGGGGAAATGG - Intronic
1179815346 21:43902647-43902669 AGGGCCATTGGCAGGGGATTAGG - Intronic
1183252623 22:36741038-36741060 AAGGGCATTCTCAGGGAAGATGG - Intergenic
1184345051 22:43908064-43908086 AGGGACAGTCGCTGCGGAAATGG - Intergenic
1185275062 22:49947218-49947240 AGGGGCATTTGCATGACAAATGG - Intergenic
1185296999 22:50059211-50059233 AGTGGCATTCCCCGGGGAAGAGG - Intergenic
951558586 3:23945133-23945155 AGGGGGAAGCGCAGGAGAAAAGG + Intronic
952497096 3:33925375-33925397 GAGGGCATTGGCAGTGGAAACGG + Intergenic
954328233 3:49875301-49875323 AGGGGCATCCCCAGTGGAACAGG + Intergenic
954510737 3:51122685-51122707 AGTGGCATTTGCATGGGAAAAGG + Intronic
954684353 3:52362296-52362318 AGGGGCATCAACAGGGGACAAGG + Intronic
955995229 3:64673433-64673455 AGGGGCAATGGAAGGGAAAAAGG + Intronic
960289671 3:115868211-115868233 TGGGCCATTGGCATGGGAAATGG + Intronic
961096041 3:124157856-124157878 AGGGGCATTCGCAGGGGAAAGGG - Intronic
961431444 3:126886811-126886833 AGGGGCACTGGCCTGGGAAAAGG - Intronic
961527326 3:127513543-127513565 AGGGCCAGGCACAGGGGAAAGGG + Intergenic
961981488 3:131083967-131083989 AAGGGCATTCTCAGAGGATATGG - Intronic
967065462 3:185911325-185911347 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
967074738 3:185991807-185991829 AAGGGCATTCTCAGGGGAGAGGG - Intergenic
968135501 3:196216993-196217015 GAAGGCATTCGCAGAGGAAATGG + Intronic
968593381 4:1470851-1470873 AGAGGGATTCGCAGGGACAAGGG - Intergenic
970218715 4:13785467-13785489 AGGGGCAGAGGCAGGGGAGAAGG + Intergenic
970364057 4:15341001-15341023 AGAGACATTCTCAGGGAAAAAGG - Intronic
973655604 4:53044568-53044590 AGGGGAATGGGAAGGGGAAAGGG - Intronic
973816699 4:54626060-54626082 TGGGACATTAGTAGGGGAAATGG + Intergenic
974497507 4:62651085-62651107 AGCTGCTTTCACAGGGGAAATGG + Intergenic
974535360 4:63167417-63167439 GAGGGAATTCCCAGGGGAAAGGG - Intergenic
985790859 5:1926308-1926330 AGGGGCAAGAGCAGGGGAAGGGG - Intergenic
986460482 5:7965615-7965637 ACGGGTATTCCCAGTGGAAATGG - Intergenic
997485939 5:134230812-134230834 AGGGGCATCACCAGGGGACATGG - Intergenic
1001548571 5:172586218-172586240 AGGAGAATTTGCAGGTGAAAAGG + Intergenic
1001856285 5:175013429-175013451 AGGTGCAGGGGCAGGGGAAATGG - Intergenic
1005022632 6:21432441-21432463 AGAGGAATTGGCAGGGGAAGAGG + Intergenic
1005306395 6:24518102-24518124 AGGGGAATTCCTAGAGGAAAAGG - Intronic
1005823940 6:29621027-29621049 AGGGGGCCTTGCAGGGGAAAGGG - Intronic
1005923126 6:30418051-30418073 CGGGGCATTGGCCAGGGAAAGGG + Intergenic
1006416671 6:33908489-33908511 AGAGGCTTCCGGAGGGGAAATGG - Intergenic
1008503895 6:52210458-52210480 AGGGGCCTTTGCAGCAGAAAAGG - Intergenic
1010386376 6:75284885-75284907 AGGGACATGGGGAGGGGAAAGGG + Exonic
1016469970 6:144364913-144364935 AGGGGCCTTCTAAGTGGAAAAGG - Intronic
1016590015 6:145734814-145734836 AGGGGCACTCGGAGGGCGAAGGG + Intronic
1017534846 6:155336055-155336077 AAGGGCATTTGCATGGCAAAAGG - Intergenic
1018388846 6:163328016-163328038 AGGGGACTTCCCAGAGGAAAAGG + Intergenic
1018639497 6:165893268-165893290 AAGGGCATTCGCAGGGCGAGGGG - Intronic
1019515542 7:1438325-1438347 AGGGACATTGGCCGGGGACAAGG + Exonic
1022876368 7:34535869-34535891 AGGGGCAAATGCAGAGGAAAAGG - Intergenic
1029170361 7:98625794-98625816 AGGGGCATTTGCTCTGGAAAAGG - Intronic
1029514225 7:101015960-101015982 AGGGCCATTCCCAGGGCAGAGGG + Intronic
1031978339 7:128107806-128107828 AGAGGCATTGGCAGGGGTGAGGG - Intergenic
1032082587 7:128867183-128867205 AGTGGCTTTTTCAGGGGAAATGG + Intronic
1032196808 7:129794115-129794137 AGGGGCTTGAGCAGGGGACAGGG + Intergenic
1034263895 7:149772495-149772517 AGGGGTGTTCGGAGGGGAGACGG - Intronic
1036477766 8:9109252-9109274 AGGGGCACTTGAAGGGGAAGAGG + Intronic
1037884945 8:22590962-22590984 AGGGGCATTTGCAGAGGCACAGG + Intronic
1038462465 8:27728558-27728580 AGGGGCCGTCGCTGGGGAAGAGG + Intergenic
1038471573 8:27827823-27827845 AGGGGAAGTGGCAGGGGAAAGGG - Intronic
1039785756 8:40832991-40833013 AAGGACAGTGGCAGGGGAAAGGG - Intronic
1040727630 8:50401706-50401728 TGGGGCAGTGGGAGGGGAAATGG + Intronic
1041150412 8:54926389-54926411 AGCCCCATTCCCAGGGGAAAGGG + Intergenic
1041752872 8:61280307-61280329 ACTGGTATTAGCAGGGGAAATGG + Intronic
1043035115 8:75187396-75187418 AGAGGAATTCGAAAGGGAAAGGG - Intergenic
1049180561 8:141219908-141219930 AGGGGCATGCGGAGGGGGCACGG + Intronic
1049214027 8:141399475-141399497 AGGGCCATGCGGAGGGGACAGGG - Intronic
1050336084 9:4591153-4591175 AAGGGCAGTCGCTGGAGAAAAGG + Intronic
1051593979 9:18805666-18805688 AGGGGCAGGGGCAGGAGAAAGGG - Intronic
1053152236 9:35750387-35750409 AGGGGCATTTGCCTGGGAGAGGG + Intronic
1056474846 9:86944046-86944068 AGGGGAGGTCTCAGGGGAAAAGG + Intergenic
1057110438 9:92464967-92464989 AGGGGCATTTGAAGGGGTGACGG - Exonic
1058450304 9:105090297-105090319 AGGGGCCTTTGCAGGAGCAAAGG - Intergenic
1062182051 9:135196175-135196197 AGGGGAATGTGAAGGGGAAATGG - Intergenic
1062182182 9:135196551-135196573 AGGGGAAATGGGAGGGGAAATGG - Intergenic
1062182187 9:135196563-135196585 AGGGGAAATGGGAGGGGAAATGG - Intergenic
1062434326 9:136539991-136540013 AGGGACATTCGCTTGGGAGAAGG + Intronic
1203768198 EBV:37266-37288 AGGGGCAGGGGCAGGGGCAAGGG + Intergenic
1186387094 X:9120943-9120965 AGGGGCTGGAGCAGGGGAAATGG + Intronic
1186834874 X:13427773-13427795 AAGGGCATTCCCAGGGGAGAGGG - Intergenic
1187224122 X:17359572-17359594 AGGGGCATGGGCAGGGGCAAAGG - Intergenic
1190980599 X:55454022-55454044 AGGGGTGGTTGCAGGGGAAAAGG + Intergenic
1190988098 X:55519158-55519180 AGGGGTGGTTGCAGGGGAAAAGG - Intergenic
1198020919 X:132657076-132657098 GGAGGCATTTGCAGGGGAGAGGG + Intronic
1198466886 X:136911348-136911370 AGGGGAAGCCGAAGGGGAAAGGG - Intergenic
1201219921 Y:11758682-11758704 AAGTGAATTCCCAGGGGAAAGGG + Intergenic
1201645663 Y:16228254-16228276 ACAGGCATTCCCAGAGGAAATGG + Intergenic
1201657150 Y:16357060-16357082 ACAGGCATTCCCAGAGGAAATGG - Intergenic