ID: 961100706

View in Genome Browser
Species Human (GRCh38)
Location 3:124196181-124196203
Sequence TAAGATAGACAACCTAATAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 190
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 182}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961100706_961100713 25 Left 961100706 3:124196181-124196203 CCCTTATTAGGTTGTCTATCTTA 0: 1
1: 0
2: 0
3: 7
4: 182
Right 961100713 3:124196229-124196251 CTTTTTCAGGTTCACTGCTGAGG 0: 1
1: 0
2: 2
3: 16
4: 219
961100706_961100708 -4 Left 961100706 3:124196181-124196203 CCCTTATTAGGTTGTCTATCTTA 0: 1
1: 0
2: 0
3: 7
4: 182
Right 961100708 3:124196200-124196222 CTTAGTCTCAGACAAGCTGCAGG 0: 1
1: 0
2: 0
3: 10
4: 130
961100706_961100711 1 Left 961100706 3:124196181-124196203 CCCTTATTAGGTTGTCTATCTTA 0: 1
1: 0
2: 0
3: 7
4: 182
Right 961100711 3:124196205-124196227 TCTCAGACAAGCTGCAGGTGGGG 0: 1
1: 0
2: 0
3: 24
4: 238
961100706_961100710 0 Left 961100706 3:124196181-124196203 CCCTTATTAGGTTGTCTATCTTA 0: 1
1: 0
2: 0
3: 7
4: 182
Right 961100710 3:124196204-124196226 GTCTCAGACAAGCTGCAGGTGGG 0: 1
1: 0
2: 0
3: 9
4: 147
961100706_961100712 12 Left 961100706 3:124196181-124196203 CCCTTATTAGGTTGTCTATCTTA 0: 1
1: 0
2: 0
3: 7
4: 182
Right 961100712 3:124196216-124196238 CTGCAGGTGGGGTCTTTTTCAGG 0: 1
1: 0
2: 1
3: 11
4: 180
961100706_961100709 -1 Left 961100706 3:124196181-124196203 CCCTTATTAGGTTGTCTATCTTA 0: 1
1: 0
2: 0
3: 7
4: 182
Right 961100709 3:124196203-124196225 AGTCTCAGACAAGCTGCAGGTGG 0: 1
1: 0
2: 1
3: 13
4: 187

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961100706 Original CRISPR TAAGATAGACAACCTAATAA GGG (reversed) Intronic
905483024 1:38274710-38274732 TCAGATAGACAACCTGAGACAGG - Intergenic
907801836 1:57774555-57774577 GAAGATACCCAAGCTAATAAAGG - Intronic
908157659 1:61371684-61371706 TGTGAAAGACAACCAAATAAGGG - Intronic
908462651 1:64360467-64360489 AAAAATAGACAACCAAAAAAAGG + Intergenic
908959503 1:69678378-69678400 TAGGATGGAGAACCTAATAAGGG + Intronic
909773874 1:79459827-79459849 TAAAGTAGAAAACCTAAGAATGG - Intergenic
910134663 1:83953380-83953402 TAAACTTGACAATCTAATAAAGG - Intronic
910192847 1:84611984-84612006 TAAGATAGAGAAACTAAAAGCGG + Intergenic
910925658 1:92395764-92395786 TAAGGCAGACAACTTAAAAATGG + Exonic
915659456 1:157390449-157390471 TAAGATAGACATCTTCATGAAGG - Intergenic
918153920 1:181825853-181825875 TAATATTAAAAACCTAATAAGGG + Intergenic
919011558 1:191972482-191972504 TATGATAGAAAAGCTAATATAGG + Intergenic
922404191 1:225295146-225295168 TTAGTTAGACAAACTAAAAACGG - Intronic
923856911 1:237854997-237855019 TCAGATAGAAGACCTAAGAAAGG + Intergenic
924572088 1:245246170-245246192 TAAGATTTACAGCCGAATAAAGG + Intronic
1062899065 10:1128057-1128079 TAAGAAAGACCACATAACAAAGG - Intronic
1067819323 10:49513442-49513464 TAATCTTTACAACCTAATAAGGG + Intronic
1069123699 10:64603166-64603188 TAATGTAAACAATCTAATAAAGG + Intergenic
1069187623 10:65445345-65445367 TAAGATGCACAACATAATCAGGG + Intergenic
1069280498 10:66649400-66649422 TAAGAAAGACACACTGATAAAGG + Intronic
1072355541 10:94606198-94606220 TAAGATACACAACATAAAGATGG - Intronic
1073677713 10:105667496-105667518 TAAGATAAACAACAGAATATTGG + Intergenic
1073749762 10:106511519-106511541 AGAGATAGAAGACCTAATAATGG - Intergenic
1079623205 11:22581062-22581084 TAAGATAAAGAACTTAAAAAGGG + Intergenic
1079832478 11:25285940-25285962 GAAGATAGACAGCATAATAGTGG - Intergenic
1080377240 11:31726620-31726642 TAACATAGAAATCCTAATGAAGG + Intronic
1080958738 11:37132673-37132695 TAAAATAGAAAACCTAAAAGTGG + Intergenic
1080980476 11:37398118-37398140 TAAGATAGAAATCCAAAAAAAGG - Intergenic
1085820320 11:79785999-79786021 TAAGATATACAAATAAATAATGG + Intergenic
1086936452 11:92750677-92750699 TCAGATAAACAACTTAATACTGG + Intronic
1088485902 11:110340230-110340252 TAAGATTGAAAACCTAATTTAGG - Intergenic
1090497993 11:127233333-127233355 GTAGATAGACAAGCTAATAATGG - Intergenic
1090936975 11:131351902-131351924 GAAGAGAAACAAACTAATAAAGG - Intergenic
1093259240 12:16914602-16914624 TCAAATAAACAACCTAATGATGG - Intergenic
1093721412 12:22446646-22446668 AAAGATAGACAACAAAATAGGGG + Intergenic
1093913871 12:24778271-24778293 TAAGGAAGACAAACTAACAAAGG - Intergenic
1093999554 12:25680389-25680411 TAAGATGGACAACACAAGAATGG - Intergenic
1095111601 12:38300576-38300598 TAAGATAGGCAAATCAATAAAGG + Intergenic
1095646727 12:44556784-44556806 TTAGATAGACAAGCTGGTAAAGG + Intronic
1098465982 12:70785912-70785934 AAAGATAGAAAACATAATCAGGG - Intronic
1098670359 12:73220808-73220830 TAAAATATACAACTTAATCATGG + Intergenic
1099005070 12:77225964-77225986 TAAGAAAGAATACCTAATATGGG - Intergenic
1099374385 12:81880581-81880603 TAACATAGAAAAACTAACAAAGG + Intergenic
1099959468 12:89382804-89382826 TTGAATAGACAACCTCATAACGG - Intergenic
1101369622 12:104114281-104114303 TAATATAGACAACTTCATATAGG - Intergenic
1104327727 12:127815959-127815981 TAAGATTAGCAACCTTATAAAGG + Intergenic
1104334785 12:127883881-127883903 TAAGACAGAGAACCTCATTAAGG + Intergenic
1106209159 13:27624944-27624966 CAAGATAGAAAACATAAGAAAGG + Intronic
1108648444 13:52452671-52452693 TGGGATAGACAACCGTATAAGGG + Intergenic
1109047711 13:57435438-57435460 TAAGATACACAACCACAGAATGG - Intergenic
1109960667 13:69625002-69625024 AAATATACACAACCTGATAATGG + Intergenic
1111578157 13:90185781-90185803 TAAATTAGCCAACCAAATAAAGG + Intergenic
1112106342 13:96243988-96244010 CAAGATAAACAAACTAAAAAAGG + Intronic
1113403265 13:110014974-110014996 TATGATGCACATCCTAATAAGGG - Intergenic
1114786828 14:25609840-25609862 TAAGATAGACTACTGAATAGTGG + Intergenic
1115366644 14:32564999-32565021 TGAGATAGACAACAGAATGACGG + Intronic
1115518674 14:34211069-34211091 TAAGGTGAAAAACCTAATAAGGG - Intronic
1116240344 14:42334045-42334067 CAAGATTGAAAACCTAATATGGG + Intergenic
1116339996 14:43710464-43710486 TAAAAATGACAATCTAATAATGG + Intergenic
1116352288 14:43878364-43878386 AAAGATAGTCTTCCTAATAAAGG - Intergenic
1117847954 14:59933402-59933424 AAAGAGAAACAACCAAATAAAGG + Intronic
1118066408 14:62195969-62195991 CAAAATAGAAAACCTAATATAGG + Intergenic
1118433181 14:65742938-65742960 AAAAACAGACAACCTTATAAAGG - Exonic
1118531365 14:66709781-66709803 TAAGATATACATCCAAAAAAAGG + Intronic
1120460234 14:84786137-84786159 TAGGAGAGACAACCTAGTAAAGG + Intergenic
1128448934 15:67790078-67790100 AAAGATACACAACCAAACAAAGG - Intronic
1129063145 15:72877596-72877618 GAAGTTTCACAACCTAATAAAGG - Intergenic
1133893066 16:9900041-9900063 TGAGATACACAACGTGATAAAGG + Intronic
1135391146 16:22094430-22094452 TAAATTAAACAGCCTAATAATGG - Intronic
1138987316 16:62345463-62345485 TAGGATAGATAAATTAATAAAGG - Intergenic
1139231721 16:65289613-65289635 TAAGATTGAGAACTCAATAAAGG + Intergenic
1143916773 17:10299645-10299667 TAAGATAGTCAAACTCATAGAGG - Intronic
1149055704 17:52362163-52362185 AAAGTTATTCAACCTAATAAAGG + Intergenic
1156161475 18:34363861-34363883 TAAGATAGGAAATGTAATAATGG + Intergenic
1156596559 18:38554389-38554411 TAAGAGAGAGAAGCTAATGATGG + Intergenic
1156999065 18:43502644-43502666 TAAAATGGACAAGTTAATAAGGG + Intergenic
1158096430 18:53777475-53777497 TCAAATAAGCAACCTAATAATGG - Intergenic
1158375741 18:56862172-56862194 CAAGATATACAACATAATAGTGG - Intronic
1162867090 19:13556368-13556390 TAAGTTAGACATCAGAATAATGG + Intronic
1164089598 19:21936473-21936495 TAATATAGACAGTATAATAAGGG + Intronic
1165884075 19:39064719-39064741 TAAGCTATAAAACATAATAAAGG - Intergenic
925196080 2:1927010-1927032 TAAAATAGAAAACCAAAAAAAGG - Intronic
926886449 2:17603135-17603157 ACAGAGAGACAACCTAAGAAAGG + Intronic
935527272 2:104186188-104186210 TAAAATAGAAAACATAAAAAAGG - Intergenic
936702381 2:115028182-115028204 TCAGATAAACAAGCTAATGATGG - Intronic
938656335 2:133437906-133437928 TAAAATAGATAAAATAATAAGGG - Intronic
938693145 2:133810923-133810945 TAAGAAAGAGAACCTAGAAAAGG + Intergenic
939309037 2:140449447-140449469 TATGATAGACAACATATAAAGGG - Intronic
940688278 2:156881880-156881902 TAAGATATACAACATATTATGGG - Intergenic
941912499 2:170777533-170777555 AAGGATAGGCAACATAATAAAGG - Intergenic
942531777 2:176917913-176917935 TAAGACAAACAACATAAGAATGG + Intergenic
945844849 2:214931677-214931699 TAGGATAGACTTCTTAATAATGG - Exonic
946793492 2:223325103-223325125 TAAAATAGAAAACCTCATGAAGG - Intergenic
947019282 2:225656687-225656709 GAAGATAGACAACCCAAAATAGG + Intergenic
948930455 2:241128553-241128575 TAACATCAGCAACCTAATAAAGG + Intronic
1171158072 20:22895059-22895081 TAAGATAAATAATCAAATAAGGG + Intergenic
1171997670 20:31744738-31744760 TAATATAAAGAACCAAATAATGG - Intronic
1173739058 20:45383478-45383500 TAAAAGAAACAACCTAAAAATGG - Intronic
1173985855 20:47260768-47260790 AAAGATAGAGAAAATAATAAAGG - Intronic
1181411658 22:22726767-22726789 TAAGACAGATAATCTAATCAAGG + Intergenic
1182192065 22:28471881-28471903 TAAGAGATATATCCTAATAAAGG - Intronic
949307581 3:2660298-2660320 TAAGAAAGACGTCCTAATATTGG + Intronic
949828956 3:8193483-8193505 TCAAGTAGACAACCTAACAATGG - Intergenic
949835568 3:8266191-8266213 TAAGGTAGACAACCCAAAAGCGG + Intergenic
951408778 3:22335829-22335851 ACATATAGACTACCTAATAAAGG - Intronic
951785623 3:26415585-26415607 TAAAATAGAGAACAGAATAAGGG + Intergenic
951934804 3:28010492-28010514 TAAAAGAGAAAACCAAATAATGG - Intergenic
952464030 3:33561788-33561810 TAAGATAGTCAACACCATAATGG + Intronic
955664140 3:61332454-61332476 TAGGAAAGAAAACCTAATCATGG + Intergenic
957790191 3:84930633-84930655 TAAAATAGTCAGCCTGATAAAGG - Intergenic
957797079 3:85023335-85023357 TAAGATAGAAGACATATTAAAGG - Intronic
959765161 3:110018017-110018039 TAATATTGACAAGCTAACAAGGG - Intergenic
959784313 3:110275876-110275898 TAAGATGGCAAACTTAATAAAGG + Intergenic
961100706 3:124196181-124196203 TAAGATAGACAACCTAATAAGGG - Intronic
963558417 3:146828125-146828147 TAAGAGAGAAAAAATAATAAAGG - Intergenic
965424270 3:168501994-168502016 TTAAATAGACAACCTAAAAATGG - Intergenic
969308506 4:6339057-6339079 TAAGAAAGACCAGCTAAAAATGG - Intronic
969668980 4:8579390-8579412 TAAGACGGACCCCCTAATAAAGG + Intronic
970174003 4:13319413-13319435 TCAAATAAAAAACCTAATAATGG - Intergenic
970347975 4:15172398-15172420 TAAGAAAGTCAATCTAATAAAGG - Intergenic
970804283 4:20012306-20012328 CAAGAAAGAAAATCTAATAAAGG + Intergenic
975213959 4:71732388-71732410 TGAGATGGACACACTAATAAGGG - Intergenic
976295797 4:83470466-83470488 TAAAATAAACAACCTTAAAATGG + Intronic
977495576 4:97771342-97771364 TAAGATAGAGTACCTAACGAAGG + Intronic
978200790 4:106021815-106021837 TAAGAAAGAAAGCCTAATAGTGG - Intergenic
978361804 4:107938790-107938812 TAAGATCGAGGACCTAACAAAGG + Intronic
979135857 4:117112517-117112539 TAAGATAAAAAATATAATAATGG + Intergenic
979598659 4:122562110-122562132 TAAGCAAGACTACCAAATAAAGG - Intergenic
982771071 4:159397995-159398017 TGAGATGGACCACCTAATATTGG + Intergenic
983506723 4:168561210-168561232 ACAGATACACTACCTAATAAGGG + Intronic
983878471 4:172904720-172904742 TAAGAGAGACTACATAATACTGG - Intronic
984328443 4:178283857-178283879 TAAGTTAGTCAATGTAATAATGG - Intergenic
989803241 5:45571471-45571493 CAAAATAGACAAGCTAAGAATGG + Intronic
990714200 5:58618303-58618325 GAAGATAAACAACCAAATATAGG + Intronic
994438627 5:99771246-99771268 ATAGATATAAAACCTAATAATGG + Intergenic
995049974 5:107691879-107691901 TAAAATAGAAAACCTAGAAATGG + Intergenic
999791380 5:154942756-154942778 CAAGATACACAAGCTAGTAAAGG - Intronic
1001887548 5:175308997-175309019 CAAGATAGACATCGTAAGAAAGG + Intergenic
1003338538 6:5197766-5197788 TCAAATAGATAACCTAATCAAGG + Intronic
1004541369 6:16553542-16553564 TAAGGTAGACAAGATAAAAATGG - Intronic
1004965842 6:20850123-20850145 TAAGACAGGCAATCTAATCATGG - Intronic
1005178524 6:23075962-23075984 TATGATAGCCATTCTAATAAGGG - Intergenic
1007535392 6:42582988-42583010 AAAGATAAACAACCCAAAAATGG - Intronic
1008246728 6:49184221-49184243 TAAGATAGACACTCTGAAAAAGG + Intergenic
1008651433 6:53567667-53567689 AAAGATAGACTCCCCAATAAGGG + Intronic
1009777879 6:68229353-68229375 TAAGATATCCAACATAATGATGG - Intergenic
1010217538 6:73417967-73417989 TTAAATAGAGAACCTAATAGAGG + Intronic
1010931692 6:81811494-81811516 TAACATGGCCAACCTAAAAATGG + Intergenic
1012998861 6:106000784-106000806 TAAAATAGATAAATTAATAATGG - Intergenic
1013436252 6:110111369-110111391 CAAGAAAGACAACCTAAAGAAGG + Intronic
1014601226 6:123415697-123415719 TAAGAAAGAAGACCTAATAAAGG + Intronic
1016611052 6:145990204-145990226 TAAAATAGAAAACATATTAAAGG + Intergenic
1017197789 6:151720762-151720784 TATGTTAGACAACCTAAAATTGG - Intronic
1017489572 6:154933148-154933170 CAAGAAACACAGCCTAATAAAGG - Intronic
1018513536 6:164553138-164553160 AAAGAAAGACAAGCTAACAAGGG + Intergenic
1020609761 7:10380309-10380331 TCAAATAAACAACCTAATGATGG + Intergenic
1020847768 7:13309011-13309033 TAACACAGACAACATGATAAAGG + Intergenic
1023670616 7:42572255-42572277 TAAGATAAACTAACTAATGAAGG + Intergenic
1023773988 7:43585225-43585247 GAAGCCAGACAACCAAATAATGG - Intronic
1026361647 7:69606637-69606659 TAGGATAAAGAACCTAGTAATGG + Intronic
1028167276 7:87552118-87552140 CAAAAAAGACAACCTGATAAAGG - Intronic
1028203310 7:87987997-87988019 TATTATAGACAAAATAATAAAGG - Intronic
1032497512 7:132373831-132373853 TAGAACAGAAAACCTAATAAGGG - Intronic
1035907832 8:3532749-3532771 ATATATAGACAACATAATAATGG + Intronic
1035961496 8:4143691-4143713 TAAGATACACAAAGTAACAAAGG + Intronic
1038795323 8:30704362-30704384 TAAGAAAGACAACAGGATAATGG + Intronic
1039648158 8:39309844-39309866 TAAGAAAGACAAGAAAATAATGG + Intergenic
1042627524 8:70774726-70774748 TAAAATAGACAGCCCAATAATGG - Intronic
1045898581 8:107247162-107247184 TAAGATAGTGAACATAATTAAGG - Intergenic
1050614289 9:7385711-7385733 TAACATAGAAAACAAAATAAAGG + Intergenic
1051087383 9:13365677-13365699 AAAGAAAAACAAACTAATAAAGG + Intergenic
1051829834 9:21263566-21263588 TAATATACACAACATAATCATGG + Intergenic
1053557316 9:39150981-39151003 TACAATATATAACCTAATAATGG + Intronic
1053821422 9:41971250-41971272 TACAATATATAACCTAATAATGG + Intronic
1054090299 9:60839398-60839420 TACAATATATAACCTAATAATGG + Intergenic
1054111710 9:61114955-61114977 TACAATATATAACCTAATAATGG + Intergenic
1054139799 9:61467968-61467990 TACAATATATAACCTAATAATGG - Intergenic
1054609146 9:67216166-67216188 TACAATATATAACCTAATAATGG - Intergenic
1056278530 9:85017035-85017057 CAAGATAGAAAACCTGATACTGG - Intronic
1060329422 9:122652788-122652810 TAAGATAGATAATATAATGAGGG - Intergenic
1062667013 9:137679631-137679653 TAAAAAAGACAACATAAAAACGG - Intronic
1187377931 X:18773911-18773933 TAGGAAGGAAAACCTAATAATGG - Intronic
1188921584 X:35985052-35985074 TTAGATAAACACACTAATAATGG - Intronic
1189206692 X:39245915-39245937 TAGGATAGAGAACCACATAATGG - Intergenic
1190778506 X:53574940-53574962 TAAGTTAACCAACCTAGTAATGG - Intronic
1191052455 X:56208549-56208571 TCAAATAAACAATCTAATAATGG - Intergenic
1194058993 X:89173907-89173929 AAAGATATAGAATCTAATAATGG - Intergenic
1195628919 X:107033545-107033567 TAAGATTGACACTCTAAAAATGG + Intergenic
1196362379 X:114878428-114878450 TAAGATATAAAAACTAATAGTGG - Intronic
1198668465 X:139051344-139051366 TAGGATACACAACCTGATCAAGG - Intronic