ID: 961102747

View in Genome Browser
Species Human (GRCh38)
Location 3:124215352-124215374
Sequence ACTGGTATGCAGTGGGAAGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 213
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 199}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961102743_961102747 7 Left 961102743 3:124215322-124215344 CCACACAGATGGGTGTGAGCAGT 0: 1
1: 0
2: 0
3: 12
4: 311
Right 961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 199
961102742_961102747 8 Left 961102742 3:124215321-124215343 CCCACACAGATGGGTGTGAGCAG 0: 1
1: 0
2: 0
3: 17
4: 154
Right 961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG 0: 1
1: 0
2: 0
3: 13
4: 199

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961102747 Original CRISPR ACTGGTATGCAGTGGGAAGC TGG Intronic
900838998 1:5032183-5032205 ACAGGTAAGCAGAGGGAAGAGGG - Intergenic
904407785 1:30304632-30304654 ACTGATTTCCAGTGGGAAGAAGG + Intergenic
905828916 1:41048590-41048612 GCAGGTATGAAGTGGGAACCAGG + Intronic
906319182 1:44806140-44806162 GCTGGTATGCAGTGTGGTGCTGG - Exonic
906566877 1:46807181-46807203 ACAGGGAGGCAGTGGCAAGCTGG + Intronic
906855600 1:49301118-49301140 ATTGGTATGCATTGTGAAGCAGG + Intronic
907958031 1:59250168-59250190 ACTAAAATGCAGTGGGAAGAAGG + Intergenic
908184772 1:61642040-61642062 AGTGGTAAGGATTGGGAAGCAGG + Intergenic
908221618 1:62012948-62012970 TCTGCTATGCAGTGGAAAACTGG - Intronic
908514188 1:64875455-64875477 ACTGGGATTCAGTGGTGAGCAGG - Intronic
912255120 1:108050421-108050443 ACTGAAATGCACTGGGAAGGGGG + Intergenic
912547418 1:110460936-110460958 CCTGGTATCCAGAGGGAGGCCGG + Intergenic
912745132 1:112239704-112239726 AGTGACATGCAGTGGGAAGGAGG + Intergenic
913580896 1:120225806-120225828 GCTGGTATTCAGTGGAAGGCAGG + Intergenic
913627283 1:120672593-120672615 GCTGGTATTCAGTGGAAGGCAGG - Intergenic
914562828 1:148837244-148837266 GCTGGTATTCAGTGGAAGGCAGG + Intronic
914610001 1:149292978-149293000 GCTGGTATTCAGTGGAAGGCAGG - Intergenic
915959039 1:160248848-160248870 ACTGGAGTGCAGTGAGTAGCAGG - Intronic
916191352 1:162181600-162181622 ACTGTTATCCAGGGGGCAGCTGG - Intronic
919934223 1:202241133-202241155 GCTGGTACGCCTTGGGAAGCAGG - Intronic
922147909 1:222966956-222966978 CCTGGTATGGAGTGGGAGGGAGG + Intronic
923000617 1:230003886-230003908 TCTGGTTTGCTGTGGGAAACAGG - Intergenic
923617322 1:235548600-235548622 ACTGGTATGGGGCTGGAAGCGGG + Exonic
1064249229 10:13694039-13694061 ACTGGAATGGAAAGGGAAGCAGG + Exonic
1064741547 10:18439804-18439826 ACTGGCATGCAGTAGGCAGAAGG - Intronic
1064795822 10:19010053-19010075 AGAGGTATGGAGTGGGAAGGTGG + Intergenic
1066805720 10:39250689-39250711 ACTGTTGTGGAGTGGGAAGAGGG - Intergenic
1067288701 10:44926265-44926287 GCTGGAAAGCAGTGGGTAGCAGG + Intronic
1073146145 10:101283132-101283154 AATTGTATGCAGTGGGGAGGAGG + Intergenic
1073306092 10:102504331-102504353 ACTGGTATGCTCTGGGCCGCGGG + Exonic
1076302297 10:129437423-129437445 ACTGGTAGGCATGGAGAAGCTGG + Intergenic
1079106309 11:17574528-17574550 ATTGGTAGGCAGTGGGACTCTGG + Intronic
1079795573 11:24798709-24798731 AATGGCAAGCAGGGGGAAGCAGG - Intronic
1082961628 11:58923498-58923520 TCTGCAATGCAGTGGAAAGCGGG + Intronic
1082980754 11:59118122-59118144 TCTGCAATGCAGTGGAAAGCGGG + Intronic
1083107642 11:60373919-60373941 ACGGGGATGGAGTGGGAAGGTGG - Intronic
1083407874 11:62471306-62471328 ACTGGCATCCAGTGGGCAGAAGG + Intronic
1085017592 11:73185588-73185610 ACTGGCTTGCCGTGGGAGGCTGG - Intergenic
1087396975 11:97611397-97611419 AAGGGTATGGAGTGGGAAGGTGG + Intergenic
1087745153 11:101935836-101935858 ACTGGTATCTAGTGGACAGCAGG - Intronic
1087934208 11:104013282-104013304 TCTGGTATGCAGGAGGAATCAGG - Intronic
1088389994 11:109303667-109303689 AATGGGGTGCAGTGGAAAGCAGG - Intergenic
1088759109 11:112912676-112912698 CCTTGTATGCAGTGGTAAGGAGG + Intergenic
1092909991 12:13138293-13138315 AATGGTAGAAAGTGGGAAGCTGG - Intronic
1092959059 12:13578544-13578566 ACTGATATTCAGTGGGAGGCTGG - Intronic
1098359802 12:69643244-69643266 TTTGGTCTGCAGTGGGAAGGTGG - Intergenic
1099828267 12:87807150-87807172 CCTAATATGCAATGGGAAGCTGG - Intergenic
1100047364 12:90399063-90399085 ACTGGCCTCCAGTGGGAATCTGG + Intergenic
1100243440 12:92732841-92732863 TCTGGCATGCTGTGGGAAGAGGG + Intronic
1101304601 12:103514978-103515000 ACTGGTATGGGGTGGGAAGTGGG + Intergenic
1101670525 12:106867688-106867710 TCTGGTTTGAAGTGGGGAGCGGG + Intronic
1101835862 12:108295071-108295093 ACTGGAATGCAGAGAGAAGATGG + Intronic
1106114122 13:26802242-26802264 ACTAGCATGCAGTGGGCAGTGGG - Intergenic
1106157026 13:27169016-27169038 CCTGGTATGCCGGGTGAAGCAGG - Intronic
1106504160 13:30356608-30356630 ACTGGCATGCAGTGGCATGGTGG + Intergenic
1107000976 13:35545318-35545340 AGTGGAATGCAGTGGGATGGGGG - Intronic
1107377735 13:39822597-39822619 ACTTGTCTGCAGTGGAAAGCAGG + Intergenic
1108716854 13:53088655-53088677 ACTGGTAGGAAGAGGGAGGCAGG + Intergenic
1108841763 13:54626542-54626564 AGTGGAATGGAGTGGAAAGCAGG - Intergenic
1110191412 13:72733406-72733428 ACTGGTGTTCAGTGGTATGCTGG + Intronic
1111262494 13:85760408-85760430 AGGGGTATGGAGTGGGAAGGTGG + Intergenic
1112956295 13:105062950-105062972 AATGGTGTGGTGTGGGAAGCAGG - Intergenic
1113636702 13:111924358-111924380 ACTGTTATGTTATGGGAAGCAGG + Intergenic
1113652400 13:112043913-112043935 GCTGGTATGGGTTGGGAAGCAGG - Intergenic
1114259612 14:21026809-21026831 ACTGGCATCCAGAGGGAAGAGGG - Intronic
1114480229 14:23029096-23029118 ACTGGTGTGGGGTGGGAAACAGG + Intronic
1115740114 14:36378699-36378721 ACTAGTGTGCTGTGGGAATCTGG - Intergenic
1116954336 14:50908529-50908551 ACTGGGATGCATTTGGAAGTTGG + Intronic
1120182813 14:81363060-81363082 CCTGGTATACTGTGGGAGGCTGG - Intronic
1121254739 14:92523050-92523072 ACTGGTAAGCAGTCTGTAGCTGG - Intronic
1125446895 15:39767782-39767804 ACGGGGATGGAGTGGGAAGGTGG - Intronic
1129856790 15:78830598-78830620 TCTGGGAGGCACTGGGAAGCTGG + Intronic
1130174972 15:81559123-81559145 ACAGGAAAGCAGTGGGCAGCAGG + Intergenic
1133496487 16:6323030-6323052 CCTTATATGCAGAGGGAAGCTGG - Intronic
1135259424 16:20968023-20968045 AATGCTAAGCAATGGGAAGCAGG + Intronic
1135337218 16:21613231-21613253 ACTGGAGTGCAGTGGCAATCTGG + Intronic
1137536353 16:49329759-49329781 AGTGGTATGAAATGGGAGGCAGG - Intergenic
1137544335 16:49390092-49390114 GCTTGTTTGCAATGGGAAGCTGG + Intronic
1139955481 16:70691140-70691162 ACAAGTTTGCAGAGGGAAGCTGG - Intronic
1140637959 16:76938825-76938847 ATTGGCATTAAGTGGGAAGCTGG - Intergenic
1140830339 16:78744999-78745021 AATGGTATGTGCTGGGAAGCAGG - Intronic
1141541192 16:84723032-84723054 ACCGGTTTCCAGTGTGAAGCAGG - Intronic
1143153793 17:4823091-4823113 AGTGGTTTGCACTGGGCAGCAGG - Exonic
1143305018 17:5939562-5939584 CCAGGGATGCAGTGGGAACCCGG + Intronic
1145002397 17:19314476-19314498 GCTGGTGTGAACTGGGAAGCAGG + Intronic
1147053669 17:37817358-37817380 ATTGGTTTGTAGTGGGAATCAGG + Intergenic
1147454028 17:40523664-40523686 TCTAGTATGGAGTGGGAAGGAGG + Intergenic
1147623477 17:41883910-41883932 CCTGGTGGGCAGTGGAAAGCTGG - Intronic
1147966451 17:44196875-44196897 ATTGGGATGAGGTGGGAAGCAGG - Intronic
1148470308 17:47889083-47889105 TCTAGTCTGCAGTGGGCAGCTGG + Intergenic
1153726881 18:7965716-7965738 ACTGTCATGCTTTGGGAAGCAGG + Intronic
1154030208 18:10746740-10746762 AATAGGATGCAGTGGGAAGATGG + Intronic
1155787179 18:29915375-29915397 ACGGGGATGGAGTGGGAAGTTGG - Intergenic
1158544213 18:58381915-58381937 AATGGGATGCACTGGGAAGATGG + Intronic
1158930983 18:62325150-62325172 CCTGGTTTGCGGTGGGACGCGGG - Intergenic
1161158445 19:2747664-2747686 ACTGGGAGGCAGTGAGTAGCGGG + Intergenic
1164771590 19:30813739-30813761 ACTGGGAGGCAGTGGCAAGAGGG + Intergenic
1165060515 19:33202846-33202868 AGCGGCCTGCAGTGGGAAGCTGG + Exonic
1166272909 19:41728352-41728374 ACTGGTCTGGAGTGGGACCCAGG + Intronic
1166909383 19:46140931-46140953 TCTGGCATGAAGTGGGAAGGGGG + Intergenic
1166923938 19:46252638-46252660 TCTGGCATGAAGTGGGAAGGGGG - Intergenic
1166966483 19:46532155-46532177 CCTGCTGTGCAGTGGGAAGTAGG - Intronic
1167105280 19:47426814-47426836 ACTGATCTGCAGTGGGAGGTGGG - Intergenic
925166072 2:1716523-1716545 AGAGGTGTACAGTGGGAAGCTGG + Intronic
926252127 2:11160745-11160767 AATGGTATGCATTGTGAAGCAGG + Intronic
927397816 2:22674307-22674329 ACTAGTGTGAAGTGGGAGGCAGG + Intergenic
927477657 2:23426131-23426153 TCTGGAAGGCTGTGGGAAGCGGG + Intronic
927670896 2:25068046-25068068 GCTCGTATGCACAGGGAAGCAGG - Intronic
929913430 2:46113660-46113682 CCTGGCTTGCAGTGGGAAGGGGG + Intronic
932828830 2:74968531-74968553 AATGCTTTGCTGTGGGAAGCTGG + Intronic
936017902 2:108973463-108973485 ACTGGAAAGCACTGGAAAGCAGG - Intronic
936018891 2:108979898-108979920 ACTGCTGGGCGGTGGGAAGCAGG + Intronic
937205459 2:120233815-120233837 ACTGGCATACACTGGGAACCAGG - Intergenic
937768124 2:125685612-125685634 ACTGCAATGCAGTGGTAAGGAGG + Intergenic
938821055 2:134960573-134960595 GCTGGTAAGGAGAGGGAAGCTGG - Intergenic
940892347 2:159047213-159047235 AGTGGTTTGGAGTGGGGAGCAGG - Intronic
940984215 2:160036658-160036680 GCTGGGATGGAGTGGGAAGGAGG + Intronic
941347715 2:164390567-164390589 ACACGTATGAAGTGGCAAGCAGG - Intergenic
941348634 2:164403209-164403231 GCTGGTATGAAGTGGAGAGCAGG + Intergenic
945577586 2:211551155-211551177 ACTAGTATGCAGTGTGACCCTGG + Intronic
947089784 2:226496834-226496856 ACTGGTATGCTCAGGAAAGCAGG + Intergenic
947724006 2:232386461-232386483 TCTGGCAGGCAGTGGGGAGCGGG - Intergenic
948116244 2:235495606-235495628 CCTGACATGCAGAGGGAAGCGGG - Intronic
1169663363 20:8005850-8005872 ACGGGGATGGAGTGGGAAGGTGG - Intronic
1170809316 20:19661379-19661401 AGTGGAATACACTGGGAAGCTGG - Intronic
1172902570 20:38345822-38345844 ACTGCTATGCTGTGGGAAACAGG - Intergenic
1173649710 20:44655386-44655408 CCTGGTTTTCAGTGGGCAGCTGG - Intergenic
1173820687 20:46018351-46018373 ACTAGTATCTAGTGGGAGGCAGG - Intergenic
1174322919 20:49756325-49756347 ATTGCTCAGCAGTGGGAAGCAGG - Intergenic
1174424432 20:50422143-50422165 ACAGGGATGCAGTGGGAGGCGGG + Intergenic
1174429239 20:50456001-50456023 ACCGGAAGGAAGTGGGAAGCTGG + Intergenic
1175146070 20:56897400-56897422 ACTGGTAGTCTTTGGGAAGCTGG + Intergenic
1175604642 20:60302669-60302691 ACGGGGATGCAGTGAGGAGCAGG - Intergenic
1175972230 20:62692326-62692348 CCTGCTCTGCAGTGGGCAGCTGG - Intergenic
1176026096 20:62986372-62986394 ACTGGGGTACAGTGGGAAGGGGG + Intergenic
1177144766 21:17395540-17395562 GCTGGAATGCAGTGAGTAGCTGG + Intergenic
1178359757 21:31938995-31939017 ACTGGGGTGCAATGGGAAGCAGG + Intronic
1180715553 22:17869665-17869687 ACTAGTATGGAGTTGGCAGCAGG + Intronic
1184240922 22:43210890-43210912 GCTGCTCTGCCGTGGGAAGCTGG - Intronic
1184799569 22:46751470-46751492 TTTGGTATGGCGTGGGAAGCAGG - Intergenic
949851083 3:8421138-8421160 GCTGGTATGCAGTTACAAGCAGG - Intergenic
951580695 3:24159776-24159798 ACTGGTGTCCAGTGGGAAGAGGG + Intronic
951993258 3:28699536-28699558 ACTGGTTTTCACTGGAAAGCTGG - Intergenic
952191698 3:31029616-31029638 ACTGGCATGCAGTGGGCTGCAGG - Intergenic
953292905 3:41684269-41684291 ACTGGTGTGCACAGAGAAGCAGG - Intronic
954289407 3:49641887-49641909 AATGGCCTGAAGTGGGAAGCAGG + Intronic
957837744 3:85619809-85619831 ACTGGCATGCATTGAGAAGAAGG - Intronic
960121884 3:113955466-113955488 CCTGGCATGCAGTGGGTAGAAGG + Intronic
961102747 3:124215352-124215374 ACTGGTATGCAGTGGGAAGCTGG + Intronic
961326036 3:126109956-126109978 ACTGGTCTGCGGCGGGAATCAGG - Exonic
961491079 3:127257270-127257292 ACAGGTGTGCAGTGGGGAGAGGG - Intergenic
962201115 3:133401855-133401877 CCTGGGATGAAGTGGGAGGCAGG - Intronic
962710184 3:138079682-138079704 AAGGGTATGCAGTGAGAAGCAGG - Intronic
967687912 3:192439007-192439029 ACTGGTTTGCAGTTTGCAGCGGG + Intronic
968458005 4:708226-708248 ACTGGTGTGGACTGGGAAGAAGG + Intronic
969626807 4:8309744-8309766 ACGGGTGAGCAGTGGGAGGCAGG - Intergenic
974554948 4:63434307-63434329 ACTTGTATGCAGATGGAAGATGG + Intergenic
979990714 4:127371932-127371954 ATGGGACTGCAGTGGGAAGCAGG + Intergenic
981104934 4:140869825-140869847 ACTGGAATGCAGAGTCAAGCTGG + Intronic
981497407 4:145409730-145409752 TGTGGTATGCTGTAGGAAGCTGG + Intergenic
982984217 4:162184859-162184881 ACTGAGATGCACTGGGAAGTGGG + Intergenic
986015494 5:3753786-3753808 AATTGTAAGCATTGGGAAGCAGG - Intergenic
993047832 5:82888641-82888663 AATGGGATGCTGAGGGAAGCAGG - Intergenic
993262432 5:85675915-85675937 AAGAGTATGAAGTGGGAAGCTGG - Intergenic
995256276 5:110050316-110050338 CCTGGTATGCAGTAGGAACTTGG + Intergenic
995379648 5:111517877-111517899 ACTGGTGTCCAGGGGGAAACAGG + Intergenic
999523376 5:152376190-152376212 ACTCATATGCAGTGGGATGGGGG + Intergenic
1000745537 5:165028039-165028061 AATGGAAAGCAGTTGGAAGCTGG + Intergenic
1002313573 5:178329332-178329354 GCTGGGATGCAGTGGGAACTGGG - Intronic
1002883933 6:1276948-1276970 TCTGGAATGAAGTGGGAACCTGG + Intergenic
1004000516 6:11592931-11592953 AGTGGGAAGCAGTGGGAGGCAGG + Intergenic
1006505551 6:34486494-34486516 ACTGGACTGAAATGGGAAGCGGG - Intronic
1006919792 6:37619871-37619893 GCTGGGAGGCAGTGGGTAGCGGG - Intergenic
1007186660 6:39977680-39977702 AGTGGTAGGAAGTGGAAAGCTGG - Intergenic
1009210768 6:60860880-60860902 ACTGGCATGGAGTTGGCAGCAGG + Intergenic
1012291852 6:97466072-97466094 ACTGGGATGGAGAGGGAAGTGGG - Intergenic
1016323073 6:142869100-142869122 ACTGGTATCTATTGGGTAGCTGG + Intronic
1019646853 7:2135221-2135243 ACAGGTGTGCAGTTGGAAGAAGG - Intronic
1021820711 7:24494941-24494963 AGGGGTATGGAGTGGGAAGGTGG + Intergenic
1022577388 7:31511185-31511207 AATGGTAGGCAGTGGAAAGGAGG - Intergenic
1024665833 7:51546170-51546192 CCTGGTATGGAGTAGGAAGAGGG - Intergenic
1026618196 7:71926295-71926317 AGCAGTATGCAGTGGGAATCTGG - Intronic
1028022076 7:85789595-85789617 ATTGGGATGGATTGGGAAGCTGG + Intergenic
1029494869 7:100891150-100891172 ACCGGTATGCAGGGGCCAGCGGG - Exonic
1030978566 7:116157858-116157880 ACTGGTGTTTAGTGGGAAGCAGG - Intronic
1031999298 7:128254385-128254407 ACTGCTATGCAGGAGGAAGAGGG - Exonic
1033970623 7:147034704-147034726 AGGGGGATGGAGTGGGAAGCTGG + Intronic
1035982750 8:4391646-4391668 ACTGGTGAGAAGTGGGAAGACGG + Intronic
1037034812 8:14153382-14153404 ACTGGTATTCAGAGGTAGGCTGG - Intronic
1037508791 8:19560822-19560844 GCTGGTATGCACTGGAATGCAGG + Intronic
1045010638 8:97955857-97955879 ACCGGGATGCAGTGGATAGCAGG + Intronic
1048386593 8:133918031-133918053 ACTGGTTTCCATTGGGAAACAGG - Intergenic
1050095371 9:2059414-2059436 CCTGGTATGGAGAGGGAGGCAGG - Intronic
1050630760 9:7555892-7555914 TCTGGCATGTAGTGGGAAGAGGG + Intergenic
1051363393 9:16302381-16302403 ACTGATATACAGTGGTAAGAAGG + Intergenic
1052641228 9:31167628-31167650 CCTGCTCTGCAGAGGGAAGCAGG - Intergenic
1054739377 9:68789175-68789197 ACAGTTATCCAGTGGGAAGTTGG + Intronic
1055157798 9:73086222-73086244 ACTGGTATGCAGTCTCAACCAGG + Intergenic
1055576390 9:77663941-77663963 ACTTGTTTGCACTGGCAAGCAGG - Intergenic
1055692773 9:78851670-78851692 ACTGGTATGGCATGGGAAACAGG + Intergenic
1057828084 9:98386503-98386525 ACTAGGCTGCAGTGGGGAGCAGG + Intronic
1058758181 9:108103150-108103172 ACTGGTATGGAGGGGGACTCTGG + Intergenic
1058878405 9:109265083-109265105 TGGGGTTTGCAGTGGGAAGCTGG - Intronic
1059367427 9:113797328-113797350 AATGGGATGCGGTGGGAAGCAGG - Intergenic
1062183178 9:135202159-135202181 GCTGGTAAGCCCTGGGAAGCTGG + Intergenic
1187885286 X:23883485-23883507 AGGGGTATGGAGTGGGAAGGTGG - Intronic
1191005817 X:55710856-55710878 ACTGGTTTGCACGGGGGAGCGGG + Intergenic
1195791492 X:108592580-108592602 AGTGGTAGGCAGTGGGGAGTTGG - Intronic
1196168238 X:112558385-112558407 ACAGTTAAGCAGTGGTAAGCAGG + Intergenic
1196902695 X:120401463-120401485 ACTGTTATACAGTGGGAACAGGG + Intergenic
1200234351 X:154461014-154461036 AGGGGGATGCAGAGGGAAGCTGG + Intronic
1200940434 Y:8774807-8774829 ACTCCTATGGAGTGAGAAGCAGG - Intergenic
1201395355 Y:13541695-13541717 ACTGTTATGGGGTGGGAAGTGGG - Intergenic