ID: 961108199

View in Genome Browser
Species Human (GRCh38)
Location 3:124260305-124260327
Sequence ATTTGGGCCTGGGAGCTCAA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 298
Summary {0: 1, 1: 0, 2: 1, 3: 37, 4: 259}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961108199 Original CRISPR ATTTGGGCCTGGGAGCTCAA AGG (reversed) Intronic
901095587 1:6676595-6676617 ACTTGAGCCTGGGAGGTCGAGGG + Intronic
901108125 1:6773572-6773594 ATTTGAGCCCAGGAGTTCAAGGG - Intergenic
902604845 1:17563315-17563337 ACTTGAGCCTGGGAGGTCGAGGG - Intronic
904067361 1:27764112-27764134 AATTGAGCCTGGGAGGTCAAAGG - Intergenic
905114688 1:35627562-35627584 ATCTGGGCCTGAAAGGTCAAGGG + Intronic
905225563 1:36476741-36476763 ACTTGAGCCTAGGAGGTCAAGGG - Intronic
905622711 1:39462630-39462652 ACTTGAGCATGGGAGATCAAAGG + Intronic
907409784 1:54275763-54275785 ATGTGGGGCTGAGAGCTCACAGG + Intronic
907569364 1:55468667-55468689 ATTTAGGACTGGGAGGTGAAGGG + Intergenic
907757809 1:57327741-57327763 ATATGGGCTGGGTAGCTCAACGG + Intronic
909618207 1:77636629-77636651 ACTTGAGCCTGGGAAGTCAAGGG + Intronic
909618986 1:77646301-77646323 ATTTGAGCCTGGGAGGTCGAAGG - Intronic
909653415 1:78001255-78001277 ACTTGAGCCTAGGAGTTCAAGGG + Intronic
910223933 1:84917170-84917192 ATTTGGGAGTGGGATCACAAAGG - Intergenic
910338241 1:86156784-86156806 CTTTGGGCCTGGGAGGAGAAAGG + Intronic
910674931 1:89807206-89807228 ATTTGCGGATGGGACCTCAAAGG + Intronic
911388563 1:97209008-97209030 ATTTTGGTCCTGGAGCTCAATGG - Intronic
912526298 1:110285677-110285699 ATCTGGGCCCATGAGCTCAATGG + Intergenic
912909931 1:113748058-113748080 CTTTGAGCCTGGGAGTTCAAAGG - Intronic
916699351 1:167275103-167275125 GCTTGAGCCTGGGAGCTCAAAGG - Intronic
916759359 1:167802618-167802640 ATGTGGGCCTGGGACCACACTGG - Intergenic
918259863 1:182786025-182786047 GCTTGAGCCTGGGAGGTCAAAGG + Intergenic
918887448 1:190213707-190213729 ACTTGGGCTTTGGAGTTCAATGG - Intronic
920120695 1:203654802-203654824 GTTTGGGCCTGAGAGGTCGAGGG + Intronic
920399152 1:205666423-205666445 GCTTGAGCCTGGGAGGTCAAGGG + Intronic
921435888 1:215121362-215121384 GCTTGAGCCTGGGAGGTCAAGGG - Intronic
922150208 1:222995410-222995432 ATTTGGGCCAGTGACCTCAAAGG + Intronic
923606922 1:235452629-235452651 ACTTGAGCCTGGGAGGTCGAGGG - Intronic
924136540 1:240972964-240972986 ACCTGGGCCTGGGAGGTCAAGGG + Intronic
1062805015 10:412603-412625 ATTTGGGCCTAGGAGCATATTGG - Intronic
1064179550 10:13102288-13102310 AGTTGGGCCTGGGCCCTGAAAGG + Intronic
1065224787 10:23532757-23532779 ATTTGGGTCTCAGAGGTCAAGGG - Intergenic
1067282299 10:44881598-44881620 ACTTGGGCCTGGGAGCTGCATGG - Intergenic
1069044989 10:63733936-63733958 ATTTGGGCCTGAGTGTTAAAGGG + Intergenic
1069060487 10:63889428-63889450 ATTTGGATGTGGGAGCTTAAAGG - Intergenic
1070308976 10:75259477-75259499 ATTTGAGCCCGGGAGGTCAAGGG + Intergenic
1071728693 10:88225629-88225651 ATTTGGACCCAGGAGTTCAAGGG + Intergenic
1072597218 10:96885462-96885484 GCTAGGGCCTGGGAGGTCAAGGG - Intronic
1073040129 10:100598366-100598388 ACTTGAGTCTGGGAGGTCAAAGG - Intergenic
1073956216 10:108874375-108874397 ATTTTGCCCTGGGAGGGCAAGGG + Intergenic
1074538770 10:114347556-114347578 ACTTGAGTCTGGGAGGTCAAGGG - Intronic
1076171526 10:128323996-128324018 AGCTGGGCATGGGAGCTCATGGG - Intergenic
1076533396 10:131160351-131160373 GCTTGGGCCTGGGAGCACAGAGG - Intronic
1076565916 10:131399016-131399038 ACTTGAGCCTAGGAGATCAAAGG + Intergenic
1077260298 11:1614843-1614865 ACTTGAGCCTGGAAGATCAAGGG + Intergenic
1077452938 11:2661871-2661893 ACCTGGCCCTGGGAGCTCACAGG + Intronic
1084325715 11:68398815-68398837 GCTTGAGCCTGGGAGGTCAAGGG - Intronic
1085428964 11:76430177-76430199 ACTTGAGCCTGGAAGGTCAAGGG - Intergenic
1085534627 11:77210678-77210700 TTTTGGGTCTGGAAGTTCAAGGG + Intronic
1085787305 11:79464846-79464868 ATATGGGCTTTGGAGCTCTACGG - Intergenic
1086176386 11:83895959-83895981 ATTTTTGCTTGGGAACTCAATGG - Intronic
1086335879 11:85800356-85800378 ACTTGAGCCTGGGATATCAAGGG - Intronic
1087575402 11:99983790-99983812 ATATTGGCCTGGGGGTTCAAAGG + Intronic
1088306347 11:108412651-108412673 ACTTGAGCCTGGCAGGTCAAGGG + Intronic
1088696455 11:112370308-112370330 ATTAGGGTCTGGGAATTCAATGG + Intergenic
1090306829 11:125698541-125698563 ATTAGGGCCCAGGAGTTCAAGGG - Intergenic
1091855431 12:3735686-3735708 ATGTGAGCCTCGGAGCTCCACGG - Intronic
1092442208 12:8515591-8515613 ATTTTGGACTGGGATCACAAAGG + Intronic
1094529636 12:31261886-31261908 ATTTGAGCCTTGGAGTTTAAGGG + Intergenic
1095049861 12:37545854-37545876 ATTTGGCCCTGGGACCCCCATGG + Intergenic
1096362748 12:51002263-51002285 GCTTGCGCCTGGGAGGTCAAGGG + Intronic
1096548855 12:52359338-52359360 ATCTGGGCCAGGGATGTCAACGG - Intergenic
1096998798 12:55858343-55858365 TCTTGAGCCTGGGAGGTCAAGGG + Intergenic
1097655144 12:62350705-62350727 ACTTGAGCCTGGGAGGTCATGGG - Intronic
1100279564 12:93105623-93105645 TCTTGAGCCTGGGAGATCAAGGG + Intergenic
1101396231 12:104350845-104350867 AGTTGGGTCTGTGACCTCAAAGG + Intergenic
1102113052 12:110379867-110379889 AATTGACCCTGGGAGTTCAAAGG - Intronic
1102189859 12:110979409-110979431 ACTTGAGCCTGGGAGGTCAAGGG + Intergenic
1103366061 12:120384228-120384250 GCTTGGGCCCGGGAGATCAAGGG + Intergenic
1103484738 12:121274888-121274910 ACTTGAGCCTAGGAGTTCAAGGG - Intronic
1104692225 12:130835204-130835226 GCTTGCGCCTGGGAGGTCAAGGG + Intronic
1106223460 13:27766872-27766894 ACTTGAGCCTGGGAGGTCACTGG + Intergenic
1106641535 13:31588956-31588978 CTTTGGGCCTGGTAGCTTGAGGG - Intergenic
1107866849 13:44711372-44711394 ACTTGAGCCTGGGAGGTCAGAGG - Intergenic
1108251550 13:48572808-48572830 ACTTGAGCCTGGGAGGTCAAGGG + Intergenic
1108771764 13:53710851-53710873 ATTTGGTCCAGGCAGCTCAGAGG + Intergenic
1109587476 13:64425792-64425814 ATATGGATCTAGGAGCTCAATGG + Intergenic
1112459689 13:99592608-99592630 ACCTGAGCCTGGGAGGTCAAGGG - Intergenic
1112510889 13:100008152-100008174 ACTTGAGCCTAGGAGGTCAAGGG + Intergenic
1112856306 13:103773795-103773817 TTTTGGGCCTTGAAGCACAAGGG + Intergenic
1114258749 14:21023207-21023229 ATTTGGGCATGGGAGTCAAACGG + Intronic
1114315040 14:21502100-21502122 ACTTGAGCCTGGGAGTTCAGTGG - Intronic
1115568223 14:34643349-34643371 ATTTGAGCCTGGGAGGTTGAAGG - Intergenic
1115669630 14:35595164-35595186 AATTGGGACAAGGAGCTCAAAGG + Intronic
1115758066 14:36549403-36549425 GTTTGGGGCTGGGAGCCCATGGG + Intergenic
1116113920 14:40623945-40623967 ATTAGGGCTTGAGAGCTCCAAGG + Intergenic
1116988609 14:51248416-51248438 AGTTGGGCATGGTAGTTCAATGG - Intronic
1118978297 14:70695942-70695964 ATTTGGGCCTGGAAGCCTGATGG - Intergenic
1120047410 14:79823491-79823513 GCTTGAGCCTGGGAGGTCAAGGG + Intronic
1121126268 14:91408751-91408773 TTGTGGGCCTGGGATCTCTAGGG + Exonic
1121294386 14:92806393-92806415 ACTTGAGCCTGGGAGGCCAAAGG - Intronic
1121588058 14:95077470-95077492 ACTTGAGCCTGGGCTCTCAATGG + Intergenic
1122174562 14:99907383-99907405 GCTTGAGCCTGGGAGGTCAAGGG + Intronic
1124026132 15:25967578-25967600 ATTTGGGGTTGTGAGCTGAATGG - Intergenic
1124788804 15:32707287-32707309 ATTTGAGCCTAGGAGGTCAAGGG + Intergenic
1125068721 15:35525755-35525777 AACTGAGCCTGGGAGTTCAAGGG + Intronic
1126092688 15:45065835-45065857 ACTTGAGCCTGGGAGGTCAAGGG + Intronic
1127916975 15:63462783-63462805 AGTTGAGCCCGGGAGATCAAGGG + Intergenic
1127986784 15:64078956-64078978 ACTTGAGCCTGGGAGATCAAAGG + Intronic
1128643872 15:69360610-69360632 CCATGGGCCTGGGAGCTCACAGG + Intronic
1129247628 15:74289324-74289346 ATTCTGGCCTGGGAGCTCCTAGG - Intronic
1129312446 15:74722206-74722228 ATCAGGGCCTGGGAGGTCAAAGG - Intronic
1129355443 15:74987814-74987836 ACTTGAGCCAGGGAGGTCAAGGG - Intronic
1129846345 15:78769350-78769372 ATGTGGGACTGGCAGCTCAGGGG - Intronic
1130255574 15:82324576-82324598 ATGTGGGACTGGCAGCTCAGGGG + Intergenic
1130417346 15:83706000-83706022 ATTTGGGCCTGGTTGCTAATAGG + Intronic
1130599393 15:85265410-85265432 ATTTGGGACTGGCAGCTCAGGGG - Intergenic
1131834552 15:96377099-96377121 ACTTGGGCCCAGGAGGTCAAGGG - Intergenic
1132105995 15:99063027-99063049 ATGTGTGTCTGGGAGCTCCAGGG - Intergenic
1132799377 16:1744155-1744177 GTTTTGGCCTGTGAGCTCACTGG + Intronic
1133124217 16:3634590-3634612 ATTTGAGCCCTGGAGTTCAAGGG - Intronic
1133314597 16:4874881-4874903 CTTTGGGCCTTGGAGCTTATTGG - Exonic
1135932110 16:26747211-26747233 GTTTGGGTCTGGAAGCTCCAAGG - Intergenic
1136343821 16:29662944-29662966 ATGTGAGCCTGAGAACTCAAGGG - Intergenic
1137782073 16:51105882-51105904 GCTTGAGCCTGGGAGTTCAAGGG + Intergenic
1139387948 16:66586266-66586288 AGCTGGTCCTGGGAGCTGAAAGG + Intronic
1140007238 16:71090580-71090602 ACTTGAGCCTAGGAGTTCAAGGG - Intronic
1142241190 16:88946867-88946889 GCTTGAGCCTGGGAGGTCAAAGG - Intronic
1142292903 16:89201029-89201051 ATCTGGGCCTGGGAGCTGCCAGG - Intronic
1142408543 16:89904495-89904517 GCTTGTGCCTGGGAGGTCAAAGG + Intronic
1143482393 17:7235177-7235199 TATTGGGCATGGCAGCTCAAAGG - Exonic
1146804818 17:35856701-35856723 ATTTGGCCCTGGCAGCTCCCAGG + Intronic
1147684461 17:42278486-42278508 ACTTGAGCCTGGGAGGTCAAGGG + Intergenic
1147728913 17:42584731-42584753 ACTTGAGCCTGGGAGGTCAAGGG + Intronic
1147818339 17:43226476-43226498 ACTTGAGCCTGGGAGGTCAAGGG - Intergenic
1148561909 17:48611180-48611202 GATTGGGGCTGGGGGCTCAAGGG + Intronic
1149146647 17:53501787-53501809 ATGTGGGCCAGGGAGATAAATGG - Intergenic
1150350905 17:64443768-64443790 ACTTGAGTCTGGGAGGTCAAGGG - Intergenic
1150760693 17:67958247-67958269 ACTTGAGCCTGGGAGGTGAAGGG + Intronic
1150975532 17:70082149-70082171 AACTGTGCCTGGGAGATCAAGGG + Intronic
1151525415 17:74662685-74662707 AGTTGAGCCTGGGAAGTCAAGGG + Intergenic
1152200170 17:78940877-78940899 CTTTGGGGCTGGGAGCTATAAGG - Intergenic
1154529851 18:15331927-15331949 ACTTGGGCCTGGGAGTTCGTGGG + Intergenic
1156455212 18:37289320-37289342 ACTTGGGGATGGGAGCTCAGAGG + Intronic
1157723680 18:49945779-49945801 AGCTGGGCCTGGGGGCTCCATGG + Intronic
1158240337 18:55370321-55370343 ACTTGAGTCTGGGAGGTCAAGGG + Intronic
1161276624 19:3421858-3421880 ACTTGAGCCTGGGAGGTCAAGGG - Intronic
1161898180 19:7098350-7098372 ATTTGGGGCTGGAAGATCTAAGG - Intergenic
1162111255 19:8400972-8400994 GCTTGAGCCTGGGAGGTCAAGGG - Intronic
1162952911 19:14082425-14082447 ACGTGGGCCTGGGAGCTGGAGGG - Intronic
1164158073 19:22608361-22608383 CTTTGGCCCTGGGAGCCTAAAGG - Intergenic
1165126244 19:33600029-33600051 ATATGGGTCTGGGAGCACAGTGG + Intergenic
1165439036 19:35813379-35813401 TCTTGAGCCTGGGAGGTCAAGGG + Intergenic
1165775052 19:38399340-38399362 AATTGGGCCTGGGGGCTCCAGGG - Intergenic
1167621740 19:50564588-50564610 ATTGGGGGCTGGGAGGGCAAAGG + Intronic
1168709871 19:58493060-58493082 ACTTGAGCCTAGGAGGTCAAGGG + Intronic
925601560 2:5613158-5613180 ACTTGAACCTGGGAGGTCAAGGG - Intergenic
925930815 2:8706377-8706399 ATTTGGGCCTGAGAGGTGAGGGG + Intergenic
926251410 2:11157247-11157269 TCCTGGGCATGGGAGCTCAAGGG + Intronic
926719776 2:15951311-15951333 ATCTGGTCCTGGGAGCTGAGGGG + Intergenic
927194240 2:20536922-20536944 AGGTGGGCGTGGGAGCTCCAGGG + Intergenic
927482125 2:23462392-23462414 ATTTGGGGCTGTGAACTCACAGG - Intronic
927928524 2:27029130-27029152 ATTTGAGCCCTGGAGGTCAAGGG + Intergenic
928165564 2:28969286-28969308 ATTAGGGTCTGAGAGGTCAAGGG + Intronic
929338678 2:40785135-40785157 AATTGGGCATGGGAGCACAGAGG - Intergenic
931104604 2:59041736-59041758 ACTTGAGCCCGGGAGATCAAGGG - Intergenic
931714939 2:65021415-65021437 TCTTGAGCCTGGCAGCTCAAGGG - Exonic
931787263 2:65631331-65631353 ACTTGAGGCTGGGAGGTCAAGGG + Intergenic
936393771 2:112102027-112102049 ATTTGGGCCTGGTACTTCATAGG - Intronic
937132813 2:119525686-119525708 TTTTGGACCTAGGAGCTGAATGG - Intergenic
937386810 2:121441659-121441681 ACTTGAGCCTGGCAGGTCAAGGG + Intronic
938108806 2:128550934-128550956 ACCCGGGCCTGGGAGCTCCAAGG + Intergenic
938528946 2:132163367-132163389 ACTTGGGCCTGGGAGTTCGTGGG + Intronic
940477750 2:154187542-154187564 ATTTGGGCTAGTCAGCTCAATGG + Intronic
940526657 2:154824251-154824273 ACTTGAGCCTGGGAGGTCATGGG + Intronic
941241387 2:163042556-163042578 ACTTCAGCCTGGGAGGTCAAGGG + Intergenic
944039010 2:195333982-195334004 ATTTTGGCCTGAGAGCTTAATGG + Intergenic
944639360 2:201707510-201707532 ACTTGGGCCTGGGAGGTTAAAGG - Intronic
945937877 2:215921858-215921880 GCTTGGGCCTGGGAGGTCGAGGG - Intergenic
946310044 2:218878200-218878222 ATTTGGGGCTGGGACCCCAGGGG + Intergenic
946815727 2:223576884-223576906 GATTGAGCCTGGGAGGTCAAGGG - Intergenic
946934665 2:224707828-224707850 ATTTGCCCCTGGGAGGACAAAGG + Intergenic
1172080772 20:32338912-32338934 ACTTGAGCCTAGGAGGTCAAGGG + Intergenic
1172127081 20:32630880-32630902 ACTTGGGCCTGGGAAAGCAAGGG + Intergenic
1172806128 20:37613082-37613104 ACTTGAGCCTGGGAGGTCAAGGG + Intergenic
1176767561 21:13036545-13036567 ACTTGGGCCTGGGAGTTCGTGGG - Intergenic
1179034104 21:37745175-37745197 ACTTGAGCCTGGGAGGTCAAGGG - Intronic
1179058948 21:37962077-37962099 CTTTGGACCTGAGAGCTCAGAGG + Intronic
1179831228 21:43997846-43997868 ACTTGGGCCTGGGAGGTTGAGGG + Intergenic
1180993024 22:19949678-19949700 ACTTGAGCCCGGGAGTTCAAGGG - Intronic
1181336293 22:22132676-22132698 GCTTGAGCCTGGGAGGTCAAGGG + Intergenic
1181472021 22:23146289-23146311 GCTTGAGCCTGGGAGGTCAAGGG - Intronic
1181558510 22:23685945-23685967 CCTTGAGCCTGGGAGATCAAGGG + Intergenic
1181562422 22:23713682-23713704 TGTTGAGCCTGGGAGGTCAAGGG - Intergenic
1181969442 22:26679271-26679293 ATTTGGGGCTGGATGCTCTACGG + Intergenic
1182333316 22:29566739-29566761 ATCTGAGCCCGGGAGGTCAAGGG + Intronic
1182438871 22:30349737-30349759 ACTTGAGCCTGAGAGGTCAAGGG - Intronic
1183652315 22:39164300-39164322 ACTTGAGCCTGGGAGGTCAAGGG - Intergenic
1184678278 22:46054973-46054995 GTTTGGGCATGGGAGCTCAGAGG + Intronic
950141905 3:10621363-10621385 ATTTGGGGCGGGGAGCTCTGGGG - Intronic
950977287 3:17261554-17261576 ACTTGAGCCTGGGATGTCAAGGG - Intronic
951138898 3:19137987-19138009 ATTTGAGCCTGGGAGGTCGAGGG + Intergenic
951908454 3:27725806-27725828 ATTTGGGTCTGGGGTTTCAAGGG - Intergenic
952567644 3:34678760-34678782 CTTAGGGCCTGGGAGATAAAAGG - Intergenic
954357702 3:50096403-50096425 ACTTGAGCCTAGGAGGTCAAGGG + Intronic
954618249 3:51981261-51981283 CTTTGGGCCTGGGAGCTGGAGGG + Intronic
955432724 3:58865559-58865581 CTTTGGGCCAGTGAACTCAACGG + Intronic
955695875 3:61635873-61635895 ATTTAGGGCTGAGAGCTCTAAGG - Intronic
956150383 3:66235992-66236014 ACTTGAGCCTAGGAGTTCAAGGG - Intronic
956865259 3:73363031-73363053 GATTGAGCCTGGGAGGTCAAGGG + Intergenic
958681174 3:97333554-97333576 ACTTGAGCCTGGAAGATCAAGGG - Intronic
960095934 3:113689898-113689920 TGTTGGGCCTTGGAACTCAAAGG - Intronic
960799792 3:121526984-121527006 GTTTGAGCCTGGGAGGTAAAGGG - Intronic
961108199 3:124260305-124260327 ATTTGGGCCTGGGAGCTCAAAGG - Intronic
961141021 3:124556298-124556320 AATTGGACCTGGCAGCTCCATGG + Intronic
963205683 3:142631576-142631598 ACTTGAGCCTGGGAGGTCGAGGG + Intronic
963873148 3:150441669-150441691 GCTTGGGCCTGAGAGGTCAAGGG + Intronic
964625631 3:158756603-158756625 GCTTGAGCCTGGGAGGTCAAAGG - Intronic
964737381 3:159930656-159930678 ACTTGAGCCCGGGAGTTCAAGGG - Intergenic
967257718 3:187610425-187610447 ATTTGGGCCAGGTATCTCCATGG + Intergenic
967295304 3:187958566-187958588 ATGGGAGCCTGGGAGCCCAAGGG - Intergenic
968798456 4:2725792-2725814 AAGTGAGCCTGGGAGGTCAAGGG - Intronic
975320718 4:73007638-73007660 ATTGGGGCTTGGAAGATCAAAGG - Intergenic
976725607 4:88212982-88213004 ATTTGGGCCCCAGAGTTCAAAGG - Intronic
977235254 4:94500864-94500886 ATTTGAGCCTGGGAGGTGGAGGG - Intronic
977917353 4:102609068-102609090 ACTTGAGCCTGTGAGTTCAAGGG + Intronic
978991433 4:115086229-115086251 TTTTTGGCCTGGAAGCTGAAAGG - Intronic
979568767 4:122190177-122190199 GTTTGAGCCTGGAAGGTCAAGGG - Intronic
979987642 4:127334708-127334730 ACATGTGCCTGGGACCTCAAAGG + Intergenic
981506175 4:145502319-145502341 ATTTGGGAATGGGGGTTCAATGG + Intronic
983775532 4:171602016-171602038 ATTTGGGCCTGGAGGCTGGAGGG + Intergenic
984367242 4:178815060-178815082 GCTTGAGCCTGGGAGATCAAGGG + Intergenic
986096225 5:4556230-4556252 ATTTGGGCATCAGAGCTCCAGGG - Intergenic
986166611 5:5277897-5277919 GTTTGCACCTGGGAGGTCAAGGG + Intronic
987862862 5:23508076-23508098 ATTTGGTCCTTGAAGCTGAAGGG - Intronic
989392669 5:40918275-40918297 ATTTGAGCCTGGGAGGTCGAGGG + Intronic
990876264 5:60489846-60489868 ATTTGAACATGGGAGTTCAAGGG - Intronic
992156365 5:73958833-73958855 ATTTGGTAATGGGAACTCAAGGG + Intergenic
993348195 5:86812311-86812333 AAGTGAGCCTGGGAGTTCAAGGG - Intergenic
993636809 5:90353946-90353968 ATCTGGATCTGGGGGCTCAATGG - Intergenic
995007115 5:107212983-107213005 ATAGAGGCCTGGGAGCTCATGGG + Intergenic
996769822 5:127074029-127074051 CTTTGGGGCTGGGATCTGAAGGG + Intergenic
999601825 5:153274956-153274978 ATTTGGGCATGGCAGCTCTAAGG - Intergenic
1000331514 5:160209438-160209460 ATTTGAGCCTGGGAGGTTGAGGG + Intronic
1001226033 5:169945341-169945363 ATTTTGGGCAGAGAGCTCAAGGG + Intronic
1001470636 5:172009767-172009789 ACTTGAGCCTGAGAGGTCAAGGG + Intergenic
1001499327 5:172216881-172216903 ACTTGAGCCCGGGAGGTCAAGGG + Intronic
1003593595 6:7455953-7455975 ACTTGAGCCTGGGAGGTCAAGGG - Intergenic
1003633869 6:7813558-7813580 ATTTGAGCCCAGGAGTTCAAGGG + Intronic
1006535016 6:34692044-34692066 AATTGAGCCTGGGAGGTGAAGGG - Intronic
1007119328 6:39367207-39367229 AATAGGGGCTGGGAACTCAAAGG + Intronic
1008753886 6:54770501-54770523 ATTTCGGACTGGGAGCTCCGTGG + Intergenic
1009871563 6:69459020-69459042 ATTTTGTGCTGGAAGCTCAATGG - Intergenic
1011334448 6:86244687-86244709 GCTTGAGCCTGGGAGATCAAGGG - Intergenic
1012399729 6:98833858-98833880 AATTGGGCCTGGAACCTAAAAGG + Intergenic
1016760063 6:147727051-147727073 ATTTGGGCCTGAAAGTTAAAAGG - Intronic
1016790768 6:148064844-148064866 ATTTTGGCCTGCCAGCTCAGGGG - Intergenic
1019457041 7:1134188-1134210 ACTTGAGCCTAGGAGTTCAAGGG + Intronic
1019569153 7:1701266-1701288 ATTTGAGCCAGGGAGGTCAAGGG - Intronic
1019599680 7:1874958-1874980 GGCTGGGCCTGGGAGCTCCAGGG + Intronic
1019637245 7:2082430-2082452 AGCCGGGCCTGGGAGCTCAGCGG + Intronic
1021757000 7:23861301-23861323 GTTAGGACCTGGGAGCTGAATGG + Intergenic
1023915090 7:44582533-44582555 ATTTGGGTCTCGGAGCACCAAGG + Intergenic
1023991807 7:45133089-45133111 ATTTGGCCCTGAGGGCTCTAAGG - Intergenic
1025068025 7:55874606-55874628 ATTGCTGCCAGGGAGCTCAAGGG - Intergenic
1025227286 7:57176853-57176875 ACTTGAACCTGGGAGGTCAAGGG - Intergenic
1025230382 7:57200289-57200311 ACTTGAGCCTGGGAGGTCAAGGG - Intergenic
1025730592 7:64103427-64103449 ACTTGAGCCTGGGAGGTCAAGGG + Intronic
1025928684 7:65978858-65978880 ACTTGAGCCTGGGATGTCAAGGG - Intronic
1027384522 7:77646906-77646928 GCTTGAGCCTGGGAGGTCAAGGG - Intergenic
1028271551 7:88797134-88797156 ATTTTGGCCTGGGAACTGAGAGG - Intronic
1029274165 7:99394264-99394286 ATCTGGGCCTTGGTGCTCACTGG + Intronic
1029805200 7:102988756-102988778 ACTTGAACCTGGGTGCTCAAGGG + Intronic
1032380077 7:131469956-131469978 GCTTGAGCCTGGGAGGTCAAGGG - Intronic
1032856267 7:135836160-135836182 ATTGGGGCCTGGGAAGTCAAAGG + Intergenic
1034966891 7:155397146-155397168 GTTTGGGCTTGGGAGCTGGATGG - Intergenic
1035164692 7:156979588-156979610 ATTTGAGCCTGGGAGGTCAAGGG - Intergenic
1035535319 8:386532-386554 GCTTGAGCCTGGGAGGTCAAGGG - Intergenic
1036690521 8:10941831-10941853 CTTTGGGCCTGGGGCCTCCAGGG - Intronic
1037765304 8:21768879-21768901 TTTTGAGCCTGGGGGCTCAGGGG - Intronic
1037941589 8:22955650-22955672 CTTTGAGCCTAGGAGGTCAAGGG - Intronic
1039417199 8:37405860-37405882 ACTTGGGCCTGGTACCTGAAGGG - Intergenic
1039451518 8:37678397-37678419 AATTGGGCCTGAGAGGTCAAGGG + Intergenic
1039642162 8:39235460-39235482 GTTTGGGCCAGGGAGCTCAGTGG + Intronic
1039722526 8:40179911-40179933 ATTTGGCCCTTGGAGGGCAAAGG - Intergenic
1039789153 8:40860504-40860526 GTGTGGGCCTGGAAGCTCATAGG - Intronic
1044726180 8:95196049-95196071 ATTTGGGTGTGGGAGCCCAGTGG + Intergenic
1046303858 8:112335993-112336015 CCTTGAGCCTGGGAGGTCAAAGG - Intronic
1047910947 8:129528431-129528453 ATTTGTGCCTGGGAGACCCATGG - Intergenic
1048259529 8:132933991-132934013 ATTCGGGTCTGGGACCCCAAGGG - Intronic
1048825044 8:138416140-138416162 ATTTTGTCCTGGGGGATCAAGGG - Intronic
1049730803 8:144177294-144177316 ATGTGGGCCTGGGAGCTGCCTGG + Intronic
1049935476 9:497768-497790 AGTTGAGCCCGGGAGGTCAAGGG + Intronic
1050858658 9:10395653-10395675 ATTTGGCCCTGAGAGGTGAATGG - Intronic
1052096962 9:24394950-24394972 ATTTGGGGATGGGAGCTGATTGG + Intergenic
1052933635 9:34075760-34075782 ACTTGAGCCTGTGAGGTCAAGGG - Intergenic
1053359237 9:37472082-37472104 ACTTGAGCCTGGGACATCAAGGG + Intergenic
1056645417 9:88407841-88407863 ATTTGAGCCTGGGAGGTGGAGGG - Intronic
1059262008 9:112986182-112986204 GCTTGAGCCTGGGAGATCAAAGG + Intergenic
1060597416 9:124856679-124856701 TTTGGGGCCTGTGAGCTCACTGG - Intronic
1187041223 X:15598084-15598106 ATTTAGGCTTGGGAGCCCTAGGG - Intronic
1189511875 X:41670663-41670685 ACTTGAGCCTGGAAGGTCAAGGG + Intronic
1192750471 X:73985028-73985050 ATTTGAGCCTGGGAGGTGGAGGG - Intergenic
1195750943 X:108161674-108161696 AGGTGGGCCTGGGAGCCCACTGG + Exonic
1196653703 X:118195127-118195149 ACTTGAGCCCAGGAGCTCAAGGG - Intergenic
1196752068 X:119126989-119127011 ACTTGAGCCTGGGAGGTCGAGGG + Intronic
1198070821 X:133147048-133147070 GCTTGAGCCTGGGAGGTCAAGGG - Intergenic
1198274318 X:135087139-135087161 AGGTCAGCCTGGGAGCTCAAAGG - Intergenic