ID: 961109150

View in Genome Browser
Species Human (GRCh38)
Location 3:124268913-124268935
Sequence CCTTCCGGGCTAGCATCTCC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 84
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 79}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961109150_961109157 -1 Left 961109150 3:124268913-124268935 CCAGGAGATGCTAGCCCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 961109157 3:124268935-124268957 GAGTTTCCTGTGGATGTGGAGGG 0: 1
1: 0
2: 2
3: 24
4: 285
961109150_961109159 6 Left 961109150 3:124268913-124268935 CCAGGAGATGCTAGCCCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 961109159 3:124268942-124268964 CTGTGGATGTGGAGGGCTCTCGG 0: 1
1: 0
2: 5
3: 42
4: 291
961109150_961109155 -5 Left 961109150 3:124268913-124268935 CCAGGAGATGCTAGCCCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 961109155 3:124268931-124268953 GAAGGAGTTTCCTGTGGATGTGG 0: 1
1: 0
2: 0
3: 23
4: 297
961109150_961109156 -2 Left 961109150 3:124268913-124268935 CCAGGAGATGCTAGCCCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 961109156 3:124268934-124268956 GGAGTTTCCTGTGGATGTGGAGG 0: 1
1: 0
2: 1
3: 27
4: 302
961109150_961109160 9 Left 961109150 3:124268913-124268935 CCAGGAGATGCTAGCCCGGAAGG 0: 1
1: 0
2: 0
3: 4
4: 79
Right 961109160 3:124268945-124268967 TGGATGTGGAGGGCTCTCGGCGG 0: 1
1: 0
2: 1
3: 12
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961109150 Original CRISPR CCTTCCGGGCTAGCATCTCC TGG (reversed) Exonic