ID: 961110022

View in Genome Browser
Species Human (GRCh38)
Location 3:124276026-124276048
Sequence TCTCAGATGTAGAGGGTGCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 211
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 194}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961110022 Original CRISPR TCTCAGATGTAGAGGGTGCA TGG (reversed) Intronic
901140369 1:7025390-7025412 TCTCAGATGAAAAGGCTGCAGGG + Intronic
901372680 1:8813689-8813711 ACTCAGAGGCAGAGGTTGCAGGG - Intronic
903192777 1:21666197-21666219 TCTCAGAGGCACAGGGTGCCAGG + Intronic
903362912 1:22788230-22788252 TTGCAGATGGTGAGGGTGCAAGG + Intronic
904329773 1:29751003-29751025 TTTCAGATGCAGAGGGCCCATGG + Intergenic
905041993 1:34967805-34967827 TCTCAGACGGAGCGGCTGCAGGG + Intergenic
906572339 1:46853993-46854015 TCTCATATGTAGAGTTTTCAGGG + Intergenic
906599440 1:47111912-47111934 TCTCATATGTAGAGTTTTCAGGG - Intronic
906754882 1:48302224-48302246 TTATAGATTTAGAGGGTGCAAGG + Intronic
909597579 1:77423255-77423277 TGTCAGAGGTAGGGAGTGCAGGG + Intronic
912373765 1:109193596-109193618 TCTCAGATGCAGAAAGTACATGG - Intronic
914947261 1:152078746-152078768 TCCCAGATGTTGAGGAGGCAGGG + Intergenic
916664416 1:166952571-166952593 GGTCAGATGTATAGGGTGGAAGG + Intronic
917495916 1:175540072-175540094 TCTCAGATGTAGAGTGGGGAGGG + Intronic
919723633 1:200866909-200866931 CCTTAGATGTTGAGGGTGCAGGG + Intergenic
919793315 1:201306165-201306187 TCTCAGGTGTAGAGGGGGAAAGG + Intronic
922207872 1:223464414-223464436 TCTCACAGGTACTGGGTGCATGG + Intergenic
924608557 1:245555549-245555571 GCTCAGATGAAGGGGGTGCTGGG + Intronic
1063415541 10:5869957-5869979 TCTCAGAGGGAGAGAGTCCAGGG - Intronic
1065648608 10:27864043-27864065 TCTCAGAATTACAGGGTGCAGGG + Intronic
1065711427 10:28521956-28521978 TCTGAGTTATAGATGGTGCAGGG + Intergenic
1066658780 10:37720096-37720118 TCTGAGATGCAGAGGGGGCTGGG - Intergenic
1068556048 10:58460159-58460181 TCTAAGAGGCAGAGGATGCAAGG + Intergenic
1071431794 10:85612378-85612400 TTTCAGAGGTAGAAGGTCCAAGG - Intronic
1073222212 10:101884414-101884436 TCTCAGTTGAAGAGGGGACAAGG + Intronic
1075501588 10:122980002-122980024 TCCCAGATGTGAAGAGTGCAAGG - Intronic
1076496420 10:130900486-130900508 ACTCAGAGGCAGAGGCTGCAGGG + Intergenic
1077223227 11:1426527-1426549 CCGCAAATGTAGAGTGTGCAGGG + Intronic
1077528737 11:3084939-3084961 TCTGGGAGGTGGAGGGTGCAGGG + Intergenic
1078312155 11:10255048-10255070 TCACAGAAGCAGAGGGTGAATGG + Intronic
1078431617 11:11292569-11292591 TCCCAGATGTAGACAGTGCTGGG - Intronic
1083312649 11:61792688-61792710 TTTCGGGTGTAGAGGGAGCAGGG + Exonic
1083732801 11:64661950-64661972 CTTCAGAAGTAGAGGGTGCTTGG + Intronic
1085259966 11:75199020-75199042 TCTCAGAAGCAGAGGTTGCCAGG - Intronic
1085303266 11:75471186-75471208 TGTCAGCTGGAAAGGGTGCAGGG + Intronic
1090082466 11:123623158-123623180 TGTCAGATGGAGAGGATGCTTGG + Intronic
1090247998 11:125230375-125230397 TGTCAGGTGATGAGGGTGCACGG + Intronic
1091322123 11:134658965-134658987 TCACAGAGGTGGACGGTGCAGGG + Intergenic
1092916862 12:13197151-13197173 TCTAGGATGTGGAGGGAGCAGGG + Intronic
1095679703 12:44960007-44960029 TTTCAGATGTGAAGGGTGGATGG + Intergenic
1097638121 12:62146357-62146379 CCTCAGAGGTCGAGGCTGCAGGG - Intronic
1101229408 12:102724650-102724672 ACTCAGATGTAGAGTGTACCTGG + Intergenic
1101392044 12:104310045-104310067 TATCAGATGTAGGGGGTGAAAGG - Intronic
1103719020 12:122963694-122963716 TCTGAGATGCAGAGGGGGAATGG + Intronic
1104462102 12:128964305-128964327 CCTGAGAGGTAGAGGCTGCAAGG + Intronic
1107311286 13:39081532-39081554 TCTAAGATGTAGGGGGTGTGAGG + Intergenic
1108966293 13:56306866-56306888 TCTGGGAGGTAGAGGTTGCAAGG + Intergenic
1109247488 13:59973827-59973849 TTTTATGTGTAGAGGGTGCATGG + Intronic
1113087959 13:106587187-106587209 GATCAGATATAGAGGGTGGAGGG - Intergenic
1114320777 14:21545554-21545576 TCTGAGAGGCAGAGGTTGCAGGG - Intergenic
1115372856 14:32638131-32638153 CCTTAGATGTAGAGGCTGCTCGG - Intronic
1115656201 14:35445991-35446013 TCTCAGATGTTATGGGTGCCAGG + Intergenic
1115725775 14:36214876-36214898 TATCAGATTTAAAGGGTGGAGGG - Intergenic
1116175243 14:41461283-41461305 TCTCAGATGTAGTGGGAGACAGG - Intergenic
1118960412 14:70524837-70524859 TCTGAGCTGTTCAGGGTGCATGG + Exonic
1119314083 14:73676931-73676953 TCACTGATGTTGAGGGTGGAGGG - Intronic
1121456112 14:94039834-94039856 TCTCAGATGAGGAGGGCCCATGG - Intronic
1121697531 14:95926007-95926029 ACTCAGATGTTGAGGATGGAGGG - Intergenic
1122437392 14:101709477-101709499 TCTCAGATGAGGAGGATGCAGGG + Intergenic
1123468201 15:20531393-20531415 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1123649914 15:22469671-22469693 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1123728517 15:23126603-23126625 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1123740317 15:23278490-23278512 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1123746681 15:23324068-23324090 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1124255276 15:28136436-28136458 TCTCTGGTGCACAGGGTGCAGGG + Intronic
1124278949 15:28347384-28347406 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1124303750 15:28564224-28564246 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1124532643 15:30520701-30520723 AGTCACATGTAGAGAGTGCAGGG - Intergenic
1124766010 15:32486943-32486965 AGTCACATGTAGAGAGTGCAGGG + Intergenic
1125706863 15:41745678-41745700 CCTGAGATGTAGAGGCTGCAGGG - Intronic
1128796447 15:70469993-70470015 AGCCAGATGCAGAGGGTGCACGG + Intergenic
1129410448 15:75347895-75347917 TCCCAGGTGTGGAGGGGGCAAGG + Intronic
1129422033 15:75436048-75436070 CCTCAGAAGTTGAGGCTGCAAGG + Intronic
1129549918 15:76437229-76437251 TCTCAGAAAATGAGGGTGCACGG - Intronic
1129701687 15:77771987-77772009 TCTCTGATTTAGAGACTGCAGGG + Intronic
1130379803 15:83361730-83361752 TCTCAGCTGTAGGGTCTGCAAGG + Intergenic
1130773838 15:86954775-86954797 TGTTAGATATAGAGGGTTCATGG - Intronic
1130867817 15:87947365-87947387 TCTCTGAAGTAGGGGTTGCAGGG - Intronic
1133074935 16:3272794-3272816 CCTCAGAGGTGGAGGTTGCAGGG - Intronic
1138481076 16:57303815-57303837 TCCCAGAGGTGGAGAGTGCAGGG - Intergenic
1141381367 16:83579989-83580011 GCTCAGAAGTAGAGAGAGCATGG + Intronic
1143014658 17:3885319-3885341 TCTCAGATGCAGAGGTTGGTGGG - Exonic
1143201195 17:5114960-5114982 TCTCAGTTTTGGAGGCTGCAAGG - Intronic
1146422747 17:32704199-32704221 ACTCAAATGTAGAGGGTATATGG + Intronic
1147995777 17:44359725-44359747 ACTCAGATGGAGGGGGTGCCTGG - Intronic
1149392595 17:56206986-56207008 TCTGAGAGGTAGAGGATGCTGGG - Intronic
1153221746 18:2868075-2868097 TCTCAGATGGAGCGGCTGCCGGG + Intronic
1153515753 18:5899446-5899468 TCTCATAGTTAGAGGTTGCATGG + Intergenic
1153560207 18:6363911-6363933 TGTTAGATGTCGAGGGAGCATGG - Intronic
1155466441 18:26140816-26140838 TGTCAGACCTAGAGGGTTCATGG - Intronic
1159861842 18:73659018-73659040 TCTCAGATGTAGTAGGCGGAGGG + Intergenic
1160017567 18:75156393-75156415 TTTCAGATGTGGAGGGTTGATGG - Intergenic
1162121963 19:8476211-8476233 TCTCAGCTGTAGAGGGTGTGGGG - Intronic
1164199163 19:23002731-23002753 TCTCAGATGTGCAGGGAGCATGG - Intronic
1166258070 19:41619994-41620016 CCTCAGGTGTAGAGGGTCCCGGG + Intronic
1167097982 19:47385507-47385529 TCCCAGAAGCAGAGGTTGCAGGG - Intergenic
1167353664 19:48991220-48991242 CCACAGACGGAGAGGGTGCAGGG - Intronic
925619462 2:5777030-5777052 TTTCAGATTTAGAGGGTGGGTGG - Intergenic
928024751 2:27730343-27730365 TCCCAGATGACAAGGGTGCAGGG - Intergenic
931113304 2:59137076-59137098 TTTCTGATGTAGAGGGTGATTGG - Intergenic
935878567 2:107537978-107538000 TCTCAGCAGTTCAGGGTGCAGGG + Intergenic
937075665 2:119104534-119104556 TCTGAGGTGAGGAGGGTGCATGG - Intergenic
937262359 2:120594723-120594745 TCTCTGTTGCAGAGGGTGGAGGG + Intergenic
938004725 2:127779388-127779410 ACTCAGAGGCAGAGGTTGCAGGG + Intronic
938018020 2:127884466-127884488 CCTCAGATTTAGAGTTTGCAAGG - Intronic
938184801 2:129221189-129221211 TCACAGATCTGGAGGGTGCAAGG + Intergenic
939176689 2:138757298-138757320 TCTGAGATGTAGAAGGCGTAAGG + Intronic
941139245 2:161757235-161757257 TTTTAGATATAGAGGGTACATGG - Intronic
941293789 2:163710238-163710260 TCTCAGTTTTAGAGAGTGAATGG - Intronic
945309842 2:208298916-208298938 TCTGAGAGGCAGAGGTTGCAGGG - Intronic
948102644 2:235387401-235387423 TCTAGGATGTTGAGGCTGCAGGG - Intergenic
948190584 2:236055164-236055186 TCCCGGATGCAGAGGGTTCAGGG + Intronic
1169982011 20:11395230-11395252 AGCCAGATGTAGTGGGTGCATGG + Intergenic
1171109894 20:22471397-22471419 TCTGAGATGTAGGTGTTGCAGGG + Intergenic
1172414921 20:34757522-34757544 CCTCAGATGAAGAGTTTGCAGGG - Exonic
1173410472 20:42805100-42805122 TATCATATTTAGAGGGAGCATGG + Intronic
1173792560 20:45837074-45837096 TCACAGATGTAAAGAGTGCTTGG + Intronic
1174444012 20:50578317-50578339 TCTTAGAGGTAGAGAGTGGAAGG + Intronic
1175007285 20:55698520-55698542 TCTTAGATTCAGAGGGTACATGG + Intergenic
1176946861 21:14992341-14992363 TTTCAGATGTAGACTCTGCAGGG - Intronic
1177644956 21:23889109-23889131 TCTCAGTTCTAGAGGCTGGAGGG - Intergenic
1178251167 21:31004611-31004633 TCCAAGATGCAGAGGGAGCAAGG + Intergenic
1178258806 21:31079863-31079885 TTTCAGATGTAGTGGGAGCTGGG - Intergenic
1179640587 21:42745155-42745177 TCTCAGAGGCAGAAGGTGAAGGG + Intronic
1183139010 22:35918405-35918427 TCTCAGCTGTAGAGTTTGGAGGG - Intronic
950471552 3:13189568-13189590 TGTCACTTGTAGTGGGTGCAGGG - Intergenic
951146680 3:19234903-19234925 TCCCAGAAGTTCAGGGTGCAAGG - Intronic
952733619 3:36665954-36665976 TCTTACATATAGAGAGTGCATGG - Intergenic
953005705 3:38977304-38977326 TCTCAGATGTGGCGTGTACAGGG - Intergenic
953296183 3:41719742-41719764 GTTTAGATGTAGAGTGTGCAAGG - Intronic
956870079 3:73408153-73408175 GCTCAGAGGTGGAGTGTGCAGGG + Intronic
957253251 3:77802601-77802623 TCTCTGATGTAGAAAATGCATGG + Intergenic
957315138 3:78567048-78567070 TCTTAGCTGTAGTGGGTGCTGGG - Intergenic
957961088 3:87253773-87253795 TCTCAGATGAAGAGATTGAACGG + Exonic
961110022 3:124276026-124276048 TCTCAGATGTAGAGGGTGCATGG - Intronic
961765336 3:129205969-129205991 TGTCAGATGCAGTGGGCGCAGGG - Intergenic
962406909 3:135108493-135108515 TCTCAGAGGTCAAGGGTGGAGGG - Intronic
962430733 3:135317136-135317158 TCTTAGTAGTAGATGGTGCAAGG + Intergenic
962752516 3:138444266-138444288 CCTCAGATGGGGAGGGTGGAGGG + Intronic
964574937 3:158155508-158155530 CCTGAGAGGTAGAGGCTGCAGGG - Intronic
967950006 3:194833321-194833343 TGTCAGATGTAGGGAATGCACGG + Intergenic
968469555 4:773075-773097 CCTCAGAGGTTGAGGGGGCAGGG + Intergenic
968982337 4:3857035-3857057 TCTCAGCTGGAGAGGGTCAAAGG - Intergenic
970917183 4:21349702-21349724 TCTTAAAGGTAGAGTGTGCAGGG + Intronic
971443428 4:26715668-26715690 TATCTGATGAAGAGGATGCAAGG - Intronic
975850476 4:78566764-78566786 TCTTACATGCAGATGGTGCATGG - Intronic
981046856 4:140272667-140272689 ACATAGATGTGGAGGGTGCAGGG + Intronic
981624702 4:146742425-146742447 TCTCAGCTCTAGAAGATGCAGGG - Intronic
985079523 4:186250276-186250298 TCTCAGATGTGGATGTTGCCAGG + Exonic
985893439 5:2734287-2734309 TCTCAGTTGGAGAGGCTGCTTGG + Intergenic
987755252 5:22092892-22092914 ATTCATATGTAGAGGGTTCAAGG + Intronic
988995338 5:36709607-36709629 TATCAGATGAGGATGGTGCATGG - Intergenic
989327129 5:40211442-40211464 TCTCAGAGGTGGAGGTTGCAGGG + Intergenic
990254583 5:53953605-53953627 TTTCATATGAAGAGGGTGGAGGG + Intronic
990796559 5:59548788-59548810 TCTCAGCTCTGCAGGGTGCATGG + Intronic
993048280 5:82893959-82893981 ACTCAGATGCAGAGGGTACTTGG + Intergenic
993531521 5:89030448-89030470 CCTCAGAAGTAGAGGGTGGAGGG - Intergenic
993729826 5:91409461-91409483 TCTCAGCAGTATAGAGTGCAGGG + Intergenic
1002116716 5:176967825-176967847 TCCCAGAGGTGGAGGCTGCAGGG + Intronic
1005586632 6:27283115-27283137 TCTCAGATGTAATGGTTTCACGG + Intergenic
1005869361 6:29962780-29962802 TGTGAGATGTATAGGGTGTAGGG - Intergenic
1006141529 6:31932392-31932414 TCTCAGATGGAGCGGTTGCCAGG + Intronic
1006489311 6:34372926-34372948 TGTCAGATTTAGTGGGGGCAGGG - Intronic
1006627306 6:35406438-35406460 CCTCAGCTGTAGATGGAGCAAGG + Intronic
1008382133 6:50848004-50848026 TCTAAGAAGGAGATGGTGCACGG + Intergenic
1009930703 6:70174110-70174132 TCTCAGATAAAGAGGAAGCAAGG + Intronic
1013174822 6:107668292-107668314 GCTCAGATGTATAGGGTCAAAGG - Intergenic
1013304793 6:108838234-108838256 TCCCAGATGTAAAGGCAGCAAGG - Intergenic
1015505596 6:133983510-133983532 TCTCTGAAGTAGAGGGTGATAGG + Intronic
1018047953 6:159981168-159981190 TCTCTGTTGTGGATGGTGCAGGG + Intronic
1019146046 6:169976273-169976295 ACTGAGCTGTGGAGGGTGCACGG - Intergenic
1019706954 7:2501516-2501538 TCTCAGCTGCAGAGGGGGTATGG + Intergenic
1020152098 7:5690505-5690527 TCTAAGTGGTAGATGGTGCAGGG - Intronic
1021595864 7:22316136-22316158 TCTTAGATCTAGAGGGGGCTAGG + Intronic
1022440081 7:30426119-30426141 TCTCAGATGTAGAGGTCACATGG - Intronic
1022681545 7:32551970-32551992 TCTAAAATGTAGAGGGAGAAAGG + Intronic
1023276081 7:38519966-38519988 TCTTAGATTCAGAGGGTTCATGG - Intronic
1024259238 7:47561333-47561355 TCTCTAATGTGGTGGGTGCAGGG + Intronic
1026329329 7:69338086-69338108 TCTCAGATTTGGGGGGTTCATGG + Intergenic
1026664434 7:72330215-72330237 CCTCAGAGGTGGAGGGTGCAGGG + Intronic
1026722755 7:72846204-72846226 TCTGAGAAGTGGAGGCTGCAGGG - Intergenic
1026980346 7:74523018-74523040 CCTCAGATGTAGGAGGTACAAGG + Intronic
1027467880 7:78537751-78537773 TGTCAGATGTATAGTTTGCAAGG + Intronic
1027542009 7:79478403-79478425 TCAAAGATGTAGAGGATGTAGGG + Intergenic
1031579600 7:123455370-123455392 TCTCAGAGGTTGAGGGAACAGGG - Intronic
1033668776 7:143469489-143469511 TGGCAGATGTAGAGGATGAAAGG + Intergenic
1039031469 8:33314234-33314256 CCTCAGTTGGAGAGGCTGCAGGG - Intergenic
1039506296 8:38054834-38054856 ACTCAGACCTAGAAGGTGCATGG + Intronic
1040578385 8:48674449-48674471 TGTCAGATGTAGTGGGTTCACGG + Intergenic
1041785195 8:61623978-61624000 TCACAGAGGTAGAGGGTAGAAGG + Intronic
1045007783 8:97931253-97931275 TCTCAGAAGCAGAGGGGGCCCGG + Exonic
1045615244 8:103901283-103901305 CCTCAGATTCAGAGGGTTCAGGG + Intronic
1049220527 8:141426834-141426856 TCTGAGAGGCAGAGGGTGCCAGG - Intronic
1050851096 9:10287467-10287489 ACTCAGATTCATAGGGTGCATGG - Intronic
1053683581 9:40500958-40500980 TCACAGAAGTAAATGGTGCATGG - Intergenic
1053933562 9:43129275-43129297 TCACAGAAGTAAATGGTGCATGG - Intergenic
1056617287 9:88179283-88179305 TCACAGCTGTGGTGGGTGCAGGG + Intergenic
1058212029 9:102181267-102181289 TCTCAGATAGAGAGAGTGAAGGG - Intergenic
1059113999 9:111584358-111584380 TCTCATCCGTAGAGGGTACAGGG + Intronic
1059309193 9:113376872-113376894 TCTCAGCTGTAGGGCGTCCACGG + Intronic
1060750063 9:126163032-126163054 CCTCAGCTGTGGAGGGTGCTGGG + Intergenic
1061175862 9:128996505-128996527 TCACAGATGTAGGAGGTGCTTGG - Intronic
1189429868 X:40936882-40936904 TCCCAGTTATAGATGGTGCAGGG + Intergenic
1190949825 X:55132525-55132547 TCACAGATGGAGAGAGTCCAAGG + Intronic
1192043030 X:67643361-67643383 TCTCACATGTGGAAGCTGCAAGG + Exonic
1193021683 X:76799232-76799254 TTGCAGATCTAGAAGGTGCAGGG + Intergenic
1193237948 X:79131650-79131672 TTTTAGAGGCAGAGGGTGCAAGG - Intergenic
1193423977 X:81318328-81318350 TCTGAGATGGAGAGTTTGCAGGG + Intergenic
1194611611 X:96051280-96051302 TCTCAGATGGGGAGGTTGCCAGG + Intergenic
1194697779 X:97076617-97076639 TCTGAGATTTAGAGTTTGCAGGG - Intronic
1199202781 X:145112537-145112559 TTACTGATATAGAGGGTGCATGG - Intergenic