ID: 961111849

View in Genome Browser
Species Human (GRCh38)
Location 3:124291029-124291051
Sequence TCAGTACCCAAGATGGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 121
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 111}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961111849_961111851 1 Left 961111849 3:124291029-124291051 CCATGGGCCATCTTGGGTACTGA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 961111851 3:124291053-124291075 CTACTGAGAATGATAGAAGATGG 0: 1
1: 0
2: 2
3: 22
4: 257
961111849_961111852 2 Left 961111849 3:124291029-124291051 CCATGGGCCATCTTGGGTACTGA 0: 1
1: 0
2: 0
3: 9
4: 111
Right 961111852 3:124291054-124291076 TACTGAGAATGATAGAAGATGGG 0: 1
1: 0
2: 2
3: 22
4: 252

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961111849 Original CRISPR TCAGTACCCAAGATGGCCCA TGG (reversed) Intronic
900032335 1:380819-380841 TCACTCCCCTAGCTGGCCCAGGG - Intergenic
900052886 1:609005-609027 TCACTCCCCTAGCTGGCCCAGGG - Intergenic
901558607 1:10051571-10051593 TCAATACAAAAGATGGCCCCTGG - Intronic
906565948 1:46801225-46801247 TAAGTACACAAGAGGGCCAAGGG + Intronic
916790048 1:168116927-168116949 TCAGAACCCCAGATGGCCTATGG + Intronic
918357746 1:183721703-183721725 ACAGTATCCAAGGTGGCCAAAGG - Intronic
921195226 1:212750159-212750181 TCAGTAGTCATGATGGACCAAGG + Intronic
922354440 1:224762861-224762883 TCAGTCCCCAAGATGGATCTTGG + Intergenic
922886550 1:229025020-229025042 TTACTTCCCAAGCTGGCCCATGG + Intergenic
923694972 1:236239565-236239587 TCAGTGTCACAGATGGCCCAGGG - Intronic
1063100556 10:2946103-2946125 TGAGAACCAAAGATGGCGCATGG - Intergenic
1063437320 10:6044838-6044860 TCAGAACCTACCATGGCCCAAGG - Intronic
1066037664 10:31509270-31509292 TCAGAGCCCACGATGGTCCAGGG + Intronic
1068418056 10:56751565-56751587 TCAGTTCCCTAAAAGGCCCAAGG - Intergenic
1072603456 10:96955142-96955164 TCTGTAATCCAGATGGCCCAAGG - Exonic
1073327171 10:102649775-102649797 TCAGTTCACATGATAGCCCAAGG + Intronic
1073394672 10:103208068-103208090 TCAGCATCCATGATGGTCCAGGG - Intergenic
1075396850 10:122133871-122133893 GCAGTACCCAAGATGGCATTGGG + Intronic
1081589086 11:44408449-44408471 TCAGTACAAAAGAAGACCCAGGG - Intergenic
1091797374 12:3305021-3305043 TCAGTCCGCACGATGGCCCAGGG - Intergenic
1096706940 12:53428215-53428237 TCAGGCACCAAGATGGCTCAGGG - Intronic
1098130249 12:67342637-67342659 TCAGAACCCAGAAAGGCCCAGGG - Intergenic
1105032266 12:132892211-132892233 TCAGCATCCATGATGGTCCAGGG - Intronic
1105365619 13:19761730-19761752 AAAGTACCCAAAAAGGCCCAGGG + Intronic
1106689786 13:32102715-32102737 TCAGTAACCAGGAAGGCCCTAGG + Intronic
1106859947 13:33894638-33894660 TCAGAACCCAAAATTGCCCCAGG - Intronic
1106906504 13:34415071-34415093 TCTCTACCCAACATGACCCAAGG + Intergenic
1107992830 13:45833388-45833410 TCAGTACCAAAAAAGACCCAGGG - Intronic
1110131306 13:72015015-72015037 ACTAAACCCAAGATGGCCCAGGG + Intergenic
1120190038 14:81432353-81432375 TGAGAACCCAAGATTGTCCATGG - Intronic
1121556399 14:94841019-94841041 TCAGAACCCAAGATGGCCTCAGG - Intergenic
1121816709 14:96934259-96934281 TCAGTCCCCAAGATGCCCAAGGG - Intergenic
1121912742 14:97806769-97806791 TCAGAGCCCATGATGGCTCAGGG - Intergenic
1122255459 14:100472713-100472735 GGAGAACCCATGATGGCCCAAGG - Intronic
1122372233 14:101235253-101235275 TCAGTACCCAAGCAGGGCCTTGG + Intergenic
1122794365 14:104198617-104198639 ACTGTACCCAAGGTTGCCCAGGG + Intergenic
1123116129 14:105894853-105894875 CCAGAACACAAGATGGCCCATGG - Intergenic
1123403086 15:20005143-20005165 CCAGAACACAAGATGGCCCATGG - Intergenic
1123486862 15:20748438-20748460 GGAGTACCCAAGAAGCCCCAGGG + Intergenic
1123512425 15:21011797-21011819 CCAGAACACAAGATGGCCCATGG - Intergenic
1123543350 15:21317494-21317516 GGAGTACCCAAGAAGCCCCAGGG + Intergenic
1129644513 15:77418701-77418723 TGAGTATCCAAGATTGCTCATGG + Intronic
1202951670 15_KI270727v1_random:44621-44643 GGAGTACCCAAGAAGCCCCAGGG + Intergenic
1136050810 16:27648617-27648639 TCAGAACAGAAGCTGGCCCACGG + Exonic
1141743977 16:85913644-85913666 TCAGAACCAAAGAGAGCCCAGGG + Intronic
1147543355 17:41379523-41379545 TCAGGACCCGAGGTGCCCCAGGG - Intronic
1152863971 17:82711303-82711325 GCTGTGCCCAGGATGGCCCAGGG - Intergenic
1154141998 18:11832428-11832450 TCAGTGCCAAAGAGGGCCAATGG - Intronic
1156519665 18:37711531-37711553 TTAGGACCCAAGAAGGCCCCAGG + Intergenic
1156993189 18:43435153-43435175 TAAGTCCCAAAGTTGGCCCATGG - Intergenic
1158489613 18:57898267-57898289 TCAGTCCCCGTGATGGCCCTTGG + Intergenic
1158531135 18:58262744-58262766 TCTGTATCCTAGTTGGCCCAAGG - Intronic
1159080176 18:63727347-63727369 TCACCTCCCAAGATGGCCTATGG + Intergenic
1159471423 18:68861528-68861550 TCAGTAGGTAAGATAGCCCAAGG - Intronic
1166666854 19:44685354-44685376 TCAACACTCACGATGGCCCATGG - Intergenic
942223912 2:173798270-173798292 TCAGTACCAAGGCTAGCCCAGGG - Intergenic
943521660 2:188959267-188959289 TCAGTCCCCAATATGGGACATGG - Intergenic
945257026 2:207811373-207811395 TTTGTACCCAGGATGACCCATGG - Intergenic
1171101023 20:22384229-22384251 TCCCTACCCAAGAGGGCCCTTGG - Intergenic
1171118543 20:22548358-22548380 GCAGGACACAAGATGGTCCAAGG + Intergenic
1173310569 20:41892891-41892913 TCAGTACCACAGATGGCTTATGG - Intergenic
1175425604 20:58863959-58863981 CCAGAACCCAAGAAGGGCCATGG + Intronic
1176943135 21:14947895-14947917 TGAGAACCCCTGATGGCCCATGG - Intergenic
1179482050 21:41684781-41684803 TCTGTTCCCGAGATGGCCCCGGG + Intergenic
1179984648 21:44913726-44913748 CCAGCAGCCAGGATGGCCCACGG + Intronic
1181039121 22:20183710-20183732 CCAGGACCCAAGACGGCTCAGGG + Intergenic
1181528774 22:23504245-23504267 CTATTAGCCAAGATGGCCCAGGG - Intergenic
1184252467 22:43268524-43268546 TTGGTGCCCAAGATGGGCCAGGG + Intronic
1184775111 22:46619223-46619245 TCAGGACCCCAGAGGGCCCAGGG + Intronic
952173743 3:30838744-30838766 TGAGGACCAAAGATGGCTCATGG + Intronic
956688455 3:71854424-71854446 GCAGCACCCAGGAGGGCCCATGG + Intergenic
957155059 3:76535861-76535883 TCAGCATCCATGATGGTCCAGGG + Intronic
960785996 3:121373328-121373350 TCAGGGCCCAAGAGGGCCAAAGG - Intronic
961111849 3:124291029-124291051 TCAGTACCCAAGATGGCCCATGG - Intronic
961627752 3:128275506-128275528 TCAGAGCCCAAGCTGGCCCTGGG + Intronic
963286478 3:143438860-143438882 TCAGTGCCCAAGAGGACTCAAGG + Intronic
965425733 3:168520385-168520407 GCAGTACCCAGGGTGGCCTAGGG + Intergenic
967267066 3:187700245-187700267 ACAGTACCCAGAATGGCCCAAGG + Intronic
969868556 4:10091106-10091128 GCAGTACCCAGGCGGGCCCAGGG + Intronic
971309831 4:25515515-25515537 TATGTACCCATGATGGCCAAAGG - Intergenic
971423138 4:26491927-26491949 TCAGTACACAAGGAGCCCCACGG - Intergenic
982465897 4:155731771-155731793 TTAGTACCCAGGCTAGCCCATGG + Exonic
983386709 4:167072262-167072284 TCAGCAGCCATGATGGCCTATGG + Intronic
983963181 4:173778706-173778728 TCAGTCCCCAAAGCGGCCCAGGG - Intergenic
984846237 4:184110288-184110310 TCAGAACCAAAGCTGACCCAAGG + Intronic
994408870 5:99381340-99381362 CCTGTTCCCTAGATGGCCCAGGG + Intergenic
995801848 5:116005296-116005318 TCAGTCCCTAAGGGGGCCCAAGG - Intronic
996574946 5:124969814-124969836 TCAGCATCCATGATGGTCCAGGG + Intergenic
1002526248 5:179817415-179817437 TCAGTGCCCCTGAGGGCCCAGGG + Intronic
1002741485 5:181438049-181438071 TCACTCCCCTAGCTGGCCCAGGG + Intergenic
1004141143 6:13018805-13018827 CAAGTACCAAAGATGGCACAGGG + Intronic
1007272560 6:40649557-40649579 TCAGTACAGTAGCTGGCCCATGG - Intergenic
1009244036 6:61213060-61213082 TCAGTACTGAAGATGGCAAAAGG + Intergenic
1009399580 6:63238365-63238387 TCACTACCCAAAAAGGCCAAAGG + Intergenic
1009981063 6:70726261-70726283 GCAGTAACCCAGATGGCTCAAGG + Intronic
1011409304 6:87050253-87050275 TCAGGAGCCAGGAAGGCCCATGG + Intergenic
1012499925 6:99877018-99877040 TCAGTCCCCAAAATTGCACATGG - Intergenic
1013175304 6:107671296-107671318 TCAGTGCCCAAGAGGCTCCATGG + Intergenic
1017882032 6:158568623-158568645 TCAGTGACCAAGAGAGCCCATGG - Intronic
1017945745 6:159095011-159095033 GCAGTGCCAAATATGGCCCATGG + Intergenic
1021204949 7:17769084-17769106 CCAGTACCGTTGATGGCCCAGGG - Intergenic
1026524391 7:71141628-71141650 TGAGTACCTACCATGGCCCAGGG - Intronic
1028589860 7:92482998-92483020 TCAGTATCCGTGATGGTCCAGGG + Intergenic
1032401571 7:131627957-131627979 TCAGAACCCAAGATTGCCTCTGG - Intergenic
1035501520 8:94147-94169 TCACTCCCCTAGCTGGCCCAGGG - Intergenic
1038796207 8:30712384-30712406 TAAACACCCAAGATGGGCCAGGG + Intronic
1039695211 8:39903225-39903247 TCATTACCACAGATGGCGCAGGG - Intronic
1042391112 8:68235657-68235679 TCTGTACCAAAAATGGCCCCAGG + Exonic
1044046409 8:87439956-87439978 TCAGGAGCCAAGTTGGCCCTGGG + Intronic
1047380076 8:124353205-124353227 TCAGTGCCCAAGTTGGTGCAAGG + Intronic
1050506750 9:6356660-6356682 TTATTACCAAAGATTGCCCAGGG + Intergenic
1051303769 9:15684926-15684948 TCATCACCCAACATGACCCACGG - Intronic
1053222326 9:36322808-36322830 GCAGCATCCAAGATGGCCCCAGG + Intergenic
1057133447 9:92670239-92670261 CCAGTACCTAAGATGGCCGCCGG - Exonic
1061207072 9:129171018-129171040 CCTGTACCCAAGATGTCCCTAGG + Intergenic
1061842575 9:133367940-133367962 GCAGCACCCAGGATGACCCACGG - Intronic
1203607396 Un_KI270748v1:69265-69287 TCACTCCCCTAGCTGGCCCAGGG + Intergenic
1185481819 X:451947-451969 TCAGCCCACAAGGTGGCCCAAGG + Intergenic
1188415113 X:29923445-29923467 TCATAAACCAATATGGCCCATGG - Intronic
1194705020 X:97164875-97164897 TCTGTTCTCAAGATGCCCCAAGG + Intronic
1198402705 X:136282854-136282876 TCAGTACCTGAGCTGTCCCAGGG + Intergenic