ID: 961115353

View in Genome Browser
Species Human (GRCh38)
Location 3:124324359-124324381
Sequence ATAGAGAGGAAGAATGGGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 1219
Summary {0: 1, 1: 0, 2: 14, 3: 94, 4: 1110}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961115353_961115359 -6 Left 961115353 3:124324359-124324381 CCCTCCCCATTCTTCCTCTCTAT 0: 1
1: 0
2: 14
3: 94
4: 1110
Right 961115359 3:124324376-124324398 CTCTATTTCTAAGTGCAGAGTGG 0: 1
1: 0
2: 2
3: 9
4: 157

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961115353 Original CRISPR ATAGAGAGGAAGAATGGGGA GGG (reversed) Intronic
900031185 1:374078-374100 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900031200 1:374127-374149 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900051754 1:602327-602349 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
900332027 1:2140053-2140075 ATAGAGAGTGAGGGTGGGGAAGG + Intronic
900883513 1:5399357-5399379 AATGAGTGGAAGGATGGGGATGG + Intergenic
901078668 1:6571378-6571400 AAAGAGAGGAAGGCTGGGGCAGG - Intronic
901192280 1:7419824-7419846 GTGGAGAGGAAGAATGGGGTGGG - Intronic
901354316 1:8630306-8630328 ATAGAGTTGAGGAATGGTGATGG - Intronic
901714468 1:11142094-11142116 ATAGAGAGTCAGGTTGGGGACGG + Intronic
901783934 1:11612184-11612206 AGAGAGAAGAAGACAGGGGAAGG + Intergenic
902108900 1:14061261-14061283 ACAGGGAGGAGTAATGGGGAGGG + Intergenic
902483354 1:16724478-16724500 ATAGAGAGAGAGAGGGGGGAAGG + Intergenic
902654763 1:17859614-17859636 AGAGAGAGAAAGATGGGGGAGGG + Intergenic
903125681 1:21245906-21245928 GTAGAGAGAAAGCATGGGGGAGG - Intronic
903303323 1:22394210-22394232 AAAGAGAACAAGAAAGGGGAAGG + Intergenic
903517672 1:23922933-23922955 ATAGAGAGTTAGAATGGGGCTGG - Intergenic
903818845 1:26085474-26085496 ATAGAAGGGGAGAACGGGGAGGG - Intergenic
903999112 1:27328259-27328281 ATACAGAGAAAGCATGGGGTGGG + Intronic
904424234 1:30413310-30413332 ATAATGAAGAAGATTGGGGAGGG + Intergenic
904754726 1:32761834-32761856 TAAGAGGGGAAGAGTGGGGAAGG + Intronic
904902679 1:33869775-33869797 AGAGAAAGGGAGAGTGGGGAGGG - Intronic
905234715 1:36538075-36538097 CTATACAGGAAGAAAGGGGAGGG - Intergenic
905323168 1:37131895-37131917 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
905601335 1:39254392-39254414 ACAGCCTGGAAGAATGGGGAAGG - Intronic
905865127 1:41372384-41372406 AGAAAGAGGAAGAGTGGGCATGG - Intronic
906182416 1:43833699-43833721 AATGAGAGGCAGAAAGGGGAAGG + Intronic
906248751 1:44295204-44295226 TGGGAGAGGAAGAATGGGCAGGG + Intronic
906882571 1:49608164-49608186 AAAGAAAGGAAGAAAGGGGAAGG + Intronic
906907172 1:49908429-49908451 ATAGAGAGGAAGGGGGAGGAGGG - Intronic
906949651 1:50323799-50323821 CCAGAGAGGAAGAACGGTGAGGG - Intergenic
907014880 1:51002842-51002864 AGTGAGAGGAAGAGAGGGGAGGG + Intergenic
907181286 1:52572641-52572663 AGAGAGAGGGAGAAGGGAGAGGG - Intergenic
907188135 1:52627150-52627172 AAAGAGAGAAAGAAAGAGGAGGG - Intergenic
907327247 1:53646837-53646859 AGAGAGAGAAAGAGAGGGGAAGG + Intronic
907350163 1:53822886-53822908 ATAGAGGGTCAGAATGGGAATGG + Intronic
907550469 1:55300696-55300718 ACAGCGAGAAAGAATGGGGCAGG + Intergenic
907861591 1:58358882-58358904 AGAGAGAGGCAGAAGGTGGACGG - Intronic
907886050 1:58593284-58593306 AAAGAAGGGAGGAATGGGGAAGG - Intergenic
908440843 1:64152294-64152316 CTAGAGGAGAAGAATGGGGAAGG - Intronic
908577321 1:65474664-65474686 AAATAGAGGAAGAAAGTGGATGG + Intronic
909096362 1:71293176-71293198 AGAGAGAGAAAGAAGAGGGAGGG - Intergenic
909699776 1:78510415-78510437 AGAGAGAGTAAGAAAGAGGAAGG + Intronic
909742852 1:79054210-79054232 AGGAAGAGGAAGACTGGGGAGGG + Intergenic
910280863 1:85500036-85500058 AGAGAGAGAAAGAAAGGGGAAGG - Intronic
910666815 1:89734501-89734523 ATAGAGAGGAAGGAGGGGAAGGG + Intronic
911170672 1:94768198-94768220 ATAGACTGGAAAATTGGGGAAGG - Intergenic
911210981 1:95137662-95137684 ACAGAGAGGAAGAAGGAAGAGGG - Intronic
911247209 1:95531713-95531735 AGAGAGAGAAAGAAAGAGGAGGG + Intergenic
911984573 1:104604742-104604764 ATAGAAAGAAAGAATGAAGAGGG - Intergenic
912124028 1:106510734-106510756 AGAGGGAGGAAGAATAGAGAGGG + Intergenic
912157335 1:106937911-106937933 ATGGAGAGAAAGACTGAGGATGG - Intergenic
912214032 1:107586698-107586720 GTAGGAAGGAAGCATGGGGAAGG + Intronic
913241333 1:116832602-116832624 ATGTAAAGGAAGAAAGGGGAGGG - Intergenic
913509312 1:119547805-119547827 AAAGAGAGGAAGAAATTGGATGG + Intergenic
913969127 1:143401088-143401110 ATAGAAAGAAAGAAAAGGGAAGG - Intergenic
914063504 1:144226687-144226709 ATAGAAAGAAAGAAAAGGGAAGG - Intergenic
914115646 1:144739667-144739689 ATAGAAAGAAAGAAAAGGGAAGG + Intergenic
914242900 1:145864015-145864037 ACTGAGAGAAGGAATGGGGAGGG + Intergenic
915107890 1:153545792-153545814 AGAGAGGGGAAGAATGGGGACGG + Exonic
915956725 1:160226400-160226422 AGAGAGAGGAAGGAAGGTGAAGG - Intronic
916260732 1:162839697-162839719 AGAAAGAGGAAGGAAGGGGAAGG + Intronic
916336829 1:163681774-163681796 AGAGAGTGGCAAAATGGGGATGG - Intergenic
916474897 1:165159835-165159857 ATAAAGAGCAATAAAGGGGAGGG + Intergenic
916510654 1:165469796-165469818 TGAGAGAGGAAAAATGGGAAAGG - Intergenic
916811282 1:168307656-168307678 AGAGAGAGGAAGAAGGCAGAGGG - Intronic
917374661 1:174336900-174336922 AGAGAGAGAAAGAATGGAGGAGG + Intronic
917493449 1:175518395-175518417 CATGAGAGGAGGAATGGGGATGG - Intronic
917497238 1:175551835-175551857 ATATATTGGAAGAATGGGGAGGG + Intronic
917669174 1:177256492-177256514 ATAGAGAGGAAGAGGGGTCAGGG - Intronic
917731477 1:177879283-177879305 GTTTTGAGGAAGAATGGGGAGGG + Intergenic
917779624 1:178379388-178379410 ACAGAGAGAAAGGAAGGGGAGGG + Intronic
918028547 1:180779193-180779215 ATAGAGTGTAAGAACTGGGATGG - Intronic
918093723 1:181317944-181317966 ATCCACAGAAAGAATGGGGAAGG - Intergenic
918976815 1:191499275-191499297 ATAGATAGCAATAATGGGAAAGG + Intergenic
919056943 1:192583024-192583046 AGAGAGAGGGAGAAAGGGAAAGG + Intergenic
919058852 1:192605950-192605972 ATAGAGAGAAAGAAAGAAGAGGG + Intergenic
919138046 1:193535337-193535359 TGATAGAGGAAGAATGGGGATGG - Intergenic
919161803 1:193840171-193840193 AGAGAGAGGAGAGATGGGGAAGG + Intergenic
919169580 1:193937292-193937314 ATAGAAAGGGAAAGTGGGGATGG - Intergenic
919455329 1:197814196-197814218 AGAGTGGGGAAGAATGGGGCAGG + Intergenic
919536464 1:198793918-198793940 AAAGAGAGGAAGAATGTCGCTGG - Intergenic
920044946 1:203127111-203127133 ATGAAGAGGAAGAAGGAGGAAGG + Exonic
920205226 1:204286425-204286447 ACAGAGAGGAGGAAAGGGAAAGG + Intronic
920253830 1:204640624-204640646 ATGGAAAGCAAGCATGGGGAAGG - Intronic
920270657 1:204761128-204761150 TTAGAAAGAAAGAATGGAGATGG + Intergenic
920441125 1:205980898-205980920 AAAGAAAGGAAGAAAGGGGAAGG - Intronic
920544482 1:206804036-206804058 ACAGAGAGCAAGAAAGGGAAGGG - Intronic
921046318 1:211480227-211480249 ATCTGGAGGAAGAAAGGGGAGGG + Intronic
921221714 1:212978371-212978393 ATGGGGAGAAAGACTGGGGAAGG + Intronic
921561138 1:216659649-216659671 ATAGAGAGGAGCAATAGGAAAGG - Intronic
921562070 1:216670806-216670828 GGAGAGAGAAAGAAAGGGGATGG + Intronic
921582900 1:216915442-216915464 GTGGAGAGGAAGAAGGGAGAAGG + Intronic
921627212 1:217389993-217390015 ATAAAGATGAAGATTAGGGAGGG + Intergenic
921770653 1:219035384-219035406 ATTTAAAGGAAGAATTGGGAGGG + Intergenic
921949155 1:220911102-220911124 ATAGAGAGCCAGAATGGGTCAGG - Intergenic
922165641 1:223113499-223113521 ATAGAGAGCAAGAATAGGCCAGG - Intronic
922503252 1:226111680-226111702 AGTGAAAGGTAGAATGGGGAAGG - Intergenic
923001053 1:230006727-230006749 AGAGAGAGGAGGAATGGGATGGG - Intergenic
923571256 1:235116837-235116859 TTAAAGAGTAAGAATGGGGCTGG + Intronic
923849379 1:237776712-237776734 GGAGAGAGGAGGTATGGGGAAGG + Intronic
923963594 1:239110251-239110273 AAGGAGATGAACAATGGGGAGGG + Intergenic
924021199 1:239785543-239785565 ATGGAGAGGAAGACTGACGAGGG - Intronic
924204583 1:241698673-241698695 AAGAAGAGGAAGAATGGGGAGGG - Intronic
924402955 1:243707701-243707723 TAAGAAAGGAAGAGTGGGGAAGG - Intronic
924628773 1:245717193-245717215 ATAGGGAGGAAAAAGGAGGATGG + Intergenic
924674215 1:246159359-246159381 CCAGTGATGAAGAATGGGGAAGG + Intronic
1063109385 10:3021262-3021284 TTAGAGAGGAAGACTGGAGATGG - Intergenic
1063109882 10:3026364-3026386 AGTGGGAGGAGGAATGGGGAGGG - Intergenic
1063201982 10:3792936-3792958 ACTGAGAGAAAGAAAGGGGAAGG + Intergenic
1063541735 10:6941056-6941078 TTAGAGAGGAGGAATCAGGAAGG - Intergenic
1063657314 10:8004696-8004718 ATAGAGAGGAAAAATCTGAAAGG - Intronic
1063733838 10:8729975-8729997 ATAGGCAGGAAGAGTTGGGAGGG + Intergenic
1064096731 10:12429325-12429347 AAAGAGAGAGAGAATGGGGAAGG - Intronic
1064429578 10:15259113-15259135 ATAGATAGGGAGAATGATGATGG - Intronic
1064460333 10:15529002-15529024 ACAGGGAGGAAGGAAGGGGAAGG - Intronic
1064577893 10:16764343-16764365 ATGGAGAGGAAGAGAGTGGAAGG - Intronic
1064631327 10:17315747-17315769 ACAGGGAGGAAGAAGAGGGAGGG + Intergenic
1065422003 10:25555301-25555323 GTTAAGAGGAAGAATGGGAAAGG + Intronic
1065695045 10:28371972-28371994 AGAGAGAGGAGAAATGAGGAGGG + Intergenic
1065773247 10:29096879-29096901 GTAGACAAGAAGGATGGGGATGG - Intergenic
1065813698 10:29465195-29465217 AGAAAGAGAAAGAAAGGGGAAGG - Intronic
1065953700 10:30674826-30674848 AAAGAAAGAAAGAAAGGGGAAGG + Intergenic
1066382576 10:34913732-34913754 AAAGAGAGGAGGAGAGGGGAGGG + Intergenic
1066420099 10:35257235-35257257 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1066588454 10:36964541-36964563 ATAGAAAGGAAGGGAGGGGAGGG + Intergenic
1066728904 10:38419092-38419114 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
1067012310 10:42726002-42726024 ATGGAGAGGAAGAGAGTGGAAGG + Intergenic
1067081197 10:43213399-43213421 ATAGAGAGCAAGAATGGAAGTGG + Intronic
1067545112 10:47187414-47187436 AAAGAGAGAAAGAAGGGGGCAGG - Intergenic
1067677270 10:48392655-48392677 AAAGAGAGGAAGAGTGAGAATGG - Intronic
1067991931 10:51224053-51224075 ATAGAGAGGAACCATGGAGTGGG + Intronic
1068017982 10:51542236-51542258 ATAGAGAGAGAGAATTTGGAGGG + Intronic
1068075577 10:52249086-52249108 AAAGAGAGGAAGGAAGGGAAGGG - Intronic
1068606968 10:59016229-59016251 ATAAGGATGAAGAATGGGGGTGG + Intergenic
1068933864 10:62617523-62617545 GGAGAGAGGAAGAAAGGAGAAGG + Intronic
1068987179 10:63118227-63118249 AAAGATAGGAAGCAAGGGGAAGG - Intergenic
1069040484 10:63690946-63690968 AGATAAAGGAAGAAAGGGGATGG + Intergenic
1069101883 10:64332240-64332262 GTAGAAAGGAAGAAGTGGGAGGG + Intergenic
1069455717 10:68552228-68552250 AAAGAGAGAAAGGAAGGGGAGGG + Intergenic
1070314106 10:75294709-75294731 AGAGAGAGGAGGGGTGGGGAAGG + Intergenic
1070597915 10:77845644-77845666 AGAGAGAGAAAGAAAGGGAAAGG + Intronic
1070668461 10:78361783-78361805 AAAGAAAGAAAGAATGGGGCAGG - Intergenic
1070754654 10:78984530-78984552 ATAGAAAGCAGGGATGGGGAAGG + Intergenic
1070769299 10:79072998-79073020 TTAGAGAGGATGAAGGGAGAAGG + Intronic
1071018750 10:81028129-81028151 ATGCAGAGGAAGAGTGGGGAGGG - Intergenic
1071021478 10:81062075-81062097 CTAGAGATGAAGAATGGTGATGG - Intergenic
1071213333 10:83369750-83369772 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071213355 10:83369974-83369996 TTAGAGAGGGAGAAGGGAGATGG - Intergenic
1071237707 10:83668364-83668386 AAAGAGTGGAAGGATGTGGAAGG - Intergenic
1071479322 10:86052693-86052715 ATAGAGAAGAAGAATGGGAAAGG + Intronic
1071541950 10:86493398-86493420 ATAGAGAGGGAGAAAGGAAAGGG + Intronic
1071817075 10:89243133-89243155 ATAGATAAAAAGAATGGAGAAGG - Intronic
1072282313 10:93877879-93877901 AGAGAGAGAAAGAAAGGAGAGGG + Intergenic
1072295218 10:94002663-94002685 ATTGAGGGGAAGAAAGGAGAAGG + Intronic
1072508253 10:96091758-96091780 ATAGAAAGGAAAAATGAGAAGGG + Intergenic
1072719609 10:97772260-97772282 ATAAGGAGGAAGGATGGAGAAGG - Intergenic
1072728172 10:97827574-97827596 AGAGGGAGGAAAGATGGGGAGGG - Intergenic
1072807868 10:98435948-98435970 GTGGTTAGGAAGAATGGGGAGGG + Intronic
1072897177 10:99376991-99377013 GTGGGGAGGAAGAAGGGGGAGGG - Intronic
1072900551 10:99403207-99403229 ATGGAGAGGAAGACTGGGTGGGG + Intronic
1073314642 10:102570616-102570638 ATCGAGAAGAGGAAGGGGGAAGG - Intronic
1073546882 10:104356939-104356961 ATAATGAAGAAGAATGGGTATGG - Intronic
1073786938 10:106899902-106899924 ATAGAGAGGAAGAGTGCAAAAGG - Intronic
1074255159 10:111794685-111794707 ATAGAGAGGAAAAAAAGGGTGGG + Intergenic
1074495391 10:113975814-113975836 AAAGAGAGGAAGTAGGGGAAGGG + Intergenic
1074712868 10:116192197-116192219 ATAGAGACAAGGAATGGGGATGG - Intronic
1075149098 10:119910643-119910665 ATGGAGAGGAGAAATGAGGAAGG - Intronic
1075151228 10:119934440-119934462 ATAGAGGGAAAGAATAGAGAAGG + Intronic
1076778140 10:132709413-132709435 AGAAAGAGGAAGAAGAGGGAGGG + Intronic
1077644623 11:3912264-3912286 AGAGAGGGGAAGAGAGGGGAGGG - Intronic
1077678212 11:4216036-4216058 AGAGAGAGGAAGCAGTGGGATGG - Intergenic
1077762553 11:5118988-5119010 AGAGAGAGGAGGAGAGGGGAGGG + Intergenic
1077786404 11:5389199-5389221 ATACAGAGGAAAACTGGTGAGGG + Intronic
1077934228 11:6767054-6767076 ATAGAAAGAAAGAATGGAAAAGG - Intergenic
1078096789 11:8302446-8302468 AGAGAGAAGAAGAAAGGAGAAGG + Intergenic
1078525571 11:12098477-12098499 ATAGGGATGAATAGTGGGGAGGG + Intronic
1078551743 11:12285948-12285970 CTGGAGAGAAAGGATGGGGACGG - Intronic
1079033814 11:17005549-17005571 AGAGAGAGAGAGAATGGAGAGGG + Intronic
1079433118 11:20416239-20416261 ATAAAGAGGAAGAAGGGGTGGGG + Intronic
1079827476 11:25214876-25214898 TAAGAAAGGAAGAAAGGGGAGGG - Intergenic
1079944621 11:26726216-26726238 ATAGAGAGGGAGAAGAAGGAAGG - Intergenic
1079946013 11:26741536-26741558 ATAAATAGGAAGAATGGGGATGG - Intergenic
1080018464 11:27532872-27532894 CTAGAAAGGAGCAATGGGGAGGG - Intergenic
1080109663 11:28551826-28551848 AAGGTGAGGAAGAATGGAGAGGG + Intergenic
1080321389 11:31014234-31014256 AAAGAGAGGAAGGGAGGGGAGGG - Intronic
1080446362 11:32341405-32341427 ATAGAGGAGAACAATGGAGATGG - Intergenic
1080858004 11:36129076-36129098 GTAGAGAGGAATAATGATGAGGG + Intronic
1080875609 11:36271678-36271700 ATAAGGAGGAAGAGTGGGAATGG + Intergenic
1082897280 11:58205277-58205299 TCAGGGAGGAAGAATGGGGATGG - Intergenic
1083569154 11:63747426-63747448 AAGGAGAGAAAGAATTGGGAGGG - Intronic
1084596947 11:70122627-70122649 ACAGAGAGAGAGAAGGGGGAGGG - Intronic
1085041494 11:73328927-73328949 CTAGAGAGGCAGGATGGAGAAGG + Intronic
1085273660 11:75284606-75284628 ATAGAGAGGCAAAATGGGCCGGG + Intronic
1085474354 11:76780609-76780631 ACAGACATGAAGAATGGAGAAGG + Intergenic
1085579493 11:77637920-77637942 ATGGCGAGGAAGAAGGGGAAGGG - Intergenic
1085855837 11:80174698-80174720 AGAGAGAGGCAGAAAGAGGAAGG + Intergenic
1085907918 11:80787046-80787068 AAAGAGGGGAATAATGGGGAGGG + Intergenic
1085957193 11:81413846-81413868 ATACAGAGGTGGAATGGGGTGGG - Intergenic
1085998282 11:81948929-81948951 AGAGAGAGAGAGAAAGGGGAAGG + Intergenic
1086056320 11:82651562-82651584 AGAGAGAGGAAGAGAGGGGGAGG + Intergenic
1086249682 11:84798394-84798416 AAAGAGAGGAAAGAGGGGGAAGG - Intronic
1086276882 11:85140707-85140729 ATGGAGGGGAAAAGTGGGGATGG - Intronic
1086867953 11:92002867-92002889 AGAAAGAGGAAGTGTGGGGATGG + Intergenic
1087026102 11:93651250-93651272 ACAGAGAGGAAAAATGGCAAAGG + Intergenic
1087600709 11:100311449-100311471 GTTAAGAGGAAGACTGGGGATGG + Intronic
1087741206 11:101889229-101889251 AAAGAAAGGAAGAAAGAGGAAGG + Intergenic
1087908901 11:103729916-103729938 GTGGAGAGGAAGAAGGGGGGTGG + Intergenic
1087948149 11:104190237-104190259 AGAAAGAGGAACAATGGTGAAGG + Intergenic
1088047641 11:105472913-105472935 AGAAAGAGAAAGAAAGGGGAAGG + Intergenic
1088275616 11:108082255-108082277 AGAGAGAAGAAGGAAGGGGAAGG - Intronic
1088400192 11:109415208-109415230 AGAAAGAGGAAGAATTGAGATGG + Intergenic
1088423611 11:109675832-109675854 ATGGAGAAGAAGTCTGGGGAGGG + Intergenic
1088520043 11:110687459-110687481 ATAGGGAGGCAGTGTGGGGAAGG + Intronic
1088990287 11:114947879-114947901 ATAGAGAGTGAAAATGGAGAGGG - Intergenic
1088998082 11:115021147-115021169 AGGGAGGGGAAGAAAGGGGAAGG - Intergenic
1089035851 11:115390350-115390372 AGAGAGAGGGAGAAGGGGAAAGG + Intronic
1089272959 11:117314740-117314762 ATTGTCAGGAAGGATGGGGAGGG + Intronic
1089326331 11:117660083-117660105 AGAGAGAGGAAGAAATGGAAAGG - Intronic
1090050644 11:123375628-123375650 ATAAAGAGGAAGTTTGGAGAAGG + Intergenic
1090508714 11:127348299-127348321 ATAGAAAGGAAGTAATGGGAAGG + Intergenic
1090833710 11:130438552-130438574 AGAGAAAGAAAGAAAGGGGAAGG - Intergenic
1091144428 11:133265233-133265255 ATAGTGAGGAAGAAGTGGGGTGG + Intronic
1091182079 11:133614426-133614448 AAAGAAAAGAAGAATAGGGAAGG + Intergenic
1091569177 12:1669615-1669637 TTAGGGAGGAGGAATGGGAATGG + Intergenic
1091755894 12:3051240-3051262 AAAGAAAGAAAGAAAGGGGAGGG - Intergenic
1091851681 12:3704606-3704628 ATAGAAAAGAAGAATGGGTCTGG + Intronic
1091907490 12:4200694-4200716 TGTGAGAGGTAGAATGGGGATGG - Intergenic
1092173857 12:6390025-6390047 AAAGAGAGAAAGAAGAGGGAGGG + Intronic
1092173943 12:6390359-6390381 GAAGAGAGGAAGGATGGGGAGGG + Intronic
1092227563 12:6757887-6757909 AAAGCAAGGTAGAATGGGGATGG + Intronic
1092470475 12:8773979-8774001 ATAGAGAGGCAGAATAGGTGGGG + Exonic
1092618752 12:10239512-10239534 AAAGAAAGAAAGAAAGGGGAGGG - Intergenic
1092889591 12:12956286-12956308 AGAGGGAGGAAGGAAGGGGAAGG - Intergenic
1092931521 12:13320244-13320266 ATAGAAGGTGAGAATGGGGAAGG + Intergenic
1093369695 12:18352721-18352743 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1093813455 12:23514802-23514824 ATATATAGGAAGAACGGTGAGGG - Intergenic
1093841497 12:23907995-23908017 GGAGAGAGCAAGAGTGGGGATGG - Intronic
1093993628 12:25617584-25617606 CTAGAGAGTGAAAATGGGGAAGG + Intronic
1094455906 12:30632653-30632675 ATAGAGACCTGGAATGGGGAGGG - Intronic
1094686963 12:32727157-32727179 CTACAGAGGAAGAATGTGAATGG - Intronic
1095136933 12:38615936-38615958 ATAGAAAGGAAAAAAGGAGAGGG + Intergenic
1095515903 12:43005131-43005153 AAACAGAGGAAGAAGGGGGGAGG - Intergenic
1095631179 12:44379129-44379151 AAAGAAAGGAAGAAAGAGGAGGG + Intronic
1095775363 12:46004144-46004166 ATTAGGAGAAAGAATGGGGAGGG - Intergenic
1096586152 12:52621276-52621298 AAAGAGAGAAAGAAAGGGGGGGG + Intergenic
1096591595 12:52663644-52663666 ATACAGAGTAGGAATGTGGAGGG + Intergenic
1096655856 12:53091746-53091768 ATAGGGATGAAGAGAGGGGATGG - Intergenic
1096841622 12:54383402-54383424 AGAGAAAGGGAGAATGGGGGAGG - Intronic
1096848768 12:54422022-54422044 ATGGAGAGGAAGAAGGGTGAAGG + Intergenic
1097142293 12:56912168-56912190 ACAGAGAGGAAGATGGGGGCTGG + Intergenic
1097459934 12:59849047-59849069 AGAGAGAGAGAGAGTGGGGAAGG - Intergenic
1098993310 12:77090256-77090278 AAAGAGAGAAAGAAGGAGGAAGG - Intergenic
1099461036 12:82921507-82921529 AGAGAGCGAAAGAATGGGAAGGG - Intronic
1099627989 12:85100719-85100741 ATTGAGAGGATGAAGGGAGAAGG + Intronic
1099808974 12:87556641-87556663 TTAGAGAGTCAGTATGGGGAAGG + Intergenic
1100262983 12:92950281-92950303 AAAGAAAAGAAGAATGGGTACGG + Intergenic
1100550736 12:95644376-95644398 AAGGAGAAGAAGAAGGGGGAAGG - Intergenic
1100795489 12:98177373-98177395 AGAGAGAGAGAGAGTGGGGAGGG - Intergenic
1101283668 12:103286626-103286648 ATAGAGAGGAAAAATGTGTGTGG + Intronic
1101289340 12:103351935-103351957 AAAGAGAGGAAGAGGGTGGAGGG - Intronic
1101316982 12:103638294-103638316 ATTGAAAGGGAGAATTGGGATGG - Intronic
1101344125 12:103869601-103869623 AGAGAGAGAGAGATTGGGGAAGG - Intergenic
1101542512 12:105677628-105677650 ATAGAGAGGCAAAATGGCAAGGG + Intergenic
1101842862 12:108340513-108340535 AAAGAAAGGAAGAAAAGGGAGGG + Intergenic
1101844091 12:108348724-108348746 ATAGAGAGGGAGAAAGAGGAAGG - Intergenic
1101994457 12:109514898-109514920 AAAAAGAAGAAGAAAGGGGATGG - Intronic
1102001563 12:109560980-109561002 AGGGAGAGGAACAAGGGGGAGGG - Intronic
1102016901 12:109654216-109654238 AGAGAGGGGAGGAATGAGGAGGG - Intergenic
1102520965 12:113477219-113477241 ATGCAGAGGAAGATTGGGCAGGG - Intergenic
1102746988 12:115258064-115258086 ATGGAGAGGAAAAATGGGGAAGG - Intergenic
1102913422 12:116736267-116736289 ATAGAGAGGAAGGCAGAGGACGG + Intronic
1103526997 12:121575735-121575757 TTAGGGAGGAAGACGGGGGAAGG + Intronic
1103790382 12:123466067-123466089 ATAGAGAGGGAAAACGGGAAAGG + Exonic
1104044171 12:125150051-125150073 ACAGAGAGAAAGAAGGGGCATGG - Intergenic
1104496072 12:129240536-129240558 ATATAAAGGAAGAATGAAGAAGG + Intronic
1104559651 12:129832257-129832279 AAGGAGAGGAAAAAGGGGGAGGG + Intronic
1104928684 12:132327196-132327218 AAAGAAAGGAGGAAGGGGGAGGG + Intronic
1106238406 13:27886147-27886169 AGAGAGAGGAAGCAAGGGCAGGG + Intergenic
1106307729 13:28528223-28528245 ATAGAGCGGGGAAATGGGGAGGG + Intergenic
1106401641 13:29436791-29436813 AAAGAAAGGAAGGAAGGGGATGG - Intronic
1106708179 13:32303507-32303529 ATAGAGATGATGAAGGGGCAAGG - Intergenic
1107050598 13:36044125-36044147 ACAGAGAGCAAGAGAGGGGAAGG - Intronic
1107328834 13:39274891-39274913 GGAGAGAAGCAGAATGGGGAAGG + Intergenic
1107481027 13:40786458-40786480 ATGGAGAGGAGAAATGTGGAAGG + Intergenic
1107867595 13:44717909-44717931 CTATATTGGAAGAATGGGGAAGG - Intergenic
1107957301 13:45527933-45527955 AGAGCTAGGAAAAATGGGGATGG + Intronic
1108136640 13:47370258-47370280 ACTGAAAGGAAAAATGGGGAGGG + Intergenic
1108447287 13:50522177-50522199 AAAGAGAGGGAGAGAGGGGAGGG + Intronic
1108588309 13:51890394-51890416 CAAGAGAGGGAGAAAGGGGAGGG - Intergenic
1108623760 13:52208320-52208342 GTAGAGAGGAGAAATGTGGAAGG + Intergenic
1108662956 13:52602711-52602733 GTAGAGAGGAGAAATGTGGAAGG - Intergenic
1108783530 13:53866952-53866974 AGAAAGAGGAAGATAGGGGAGGG + Intergenic
1109375645 13:61488394-61488416 ATAGAAAGGAGGAGTGGGAAAGG - Intergenic
1109438392 13:62337009-62337031 ATAGAGGGGAGGAAGGGGGAAGG - Intergenic
1109759177 13:66804471-66804493 ATAGAGAGGAAGATTGTAAAGGG + Intronic
1109965061 13:69681301-69681323 AGAGAGAGAAAGAAGAGGGACGG + Intergenic
1110214859 13:73014079-73014101 CTAGGGAGGAAAAAGGGGGAGGG - Intronic
1110246735 13:73334046-73334068 AGAAAGTGGAAGAATGTGGAAGG - Intergenic
1110264881 13:73526024-73526046 ATGGATTGGAAGCATGGGGAGGG + Intergenic
1111033191 13:82633907-82633929 TTAGAGAGAAAGAATGGGGTGGG + Intergenic
1111147710 13:84206082-84206104 TTTGAGAAGAAGAATGGGAAAGG + Intergenic
1111390100 13:87582645-87582667 AAAGAGAGGAAGGAAAGGGAAGG - Intergenic
1111469483 13:88659672-88659694 AGAGAGAGGAAGACAGAGGAGGG + Intergenic
1111531479 13:89542431-89542453 AGAGAAAGAAAGCATGGGGAGGG - Intergenic
1111641938 13:90980176-90980198 ATAGAGAGGAAATGTGGGGTTGG - Intergenic
1111670271 13:91321112-91321134 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1111681967 13:91453788-91453810 AAAGAAAGGAAGAAGGAGGAGGG - Intronic
1111696035 13:91625524-91625546 AGAGAGTGGAAGAAGGGAGATGG + Intronic
1112185224 13:97121648-97121670 AAAGAGAATAAGAATGTGGAAGG - Intergenic
1112888649 13:104205598-104205620 ATACAGAGGAGGATTGTGGAAGG + Intergenic
1114066589 14:19064430-19064452 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1114095677 14:19335593-19335615 AGATAGAGGGGGAATGGGGAAGG + Intergenic
1114215329 14:20653752-20653774 ATCGGGAGGAAGAACGGGGGTGG - Intergenic
1115631531 14:35250651-35250673 GTAGAGAGGTAGATTGAGGAAGG + Intronic
1115649114 14:35390532-35390554 TTACAGAGGCAGGATGGGGAGGG + Intergenic
1115724189 14:36194740-36194762 AGGGAGAGGAAGGAAGGGGAGGG + Intergenic
1115872266 14:37817769-37817791 ATAGAGTACAAAAATGGGGAGGG + Intronic
1116333893 14:43632164-43632186 AAAGAAAGGAAGCATAGGGAAGG + Intergenic
1116408724 14:44598306-44598328 CAAGAGAGAAAGAATGAGGAGGG + Intergenic
1116500827 14:45618852-45618874 AGAGAGAGGAAGAAGGGAGGAGG - Intergenic
1116762903 14:49037055-49037077 AGAGAGAAAAAGAATGGGAAAGG + Intergenic
1117064244 14:51993852-51993874 AGAGAGAGGAAAGATGGGAAAGG + Intronic
1117647054 14:57864532-57864554 ATAGAGAGGAAGCATGGTAGGGG + Intronic
1117722801 14:58643818-58643840 TGGGAGAGGAAGGATGGGGAAGG + Intronic
1117730798 14:58719978-58720000 AGAAAGAGGAAAAATGGAGAAGG + Intergenic
1117886756 14:60372050-60372072 ACAGAGAGGAAACATGGGGTTGG + Intergenic
1117895657 14:60483876-60483898 ATAGAGAAAAAAAATGGGTATGG + Intronic
1118034926 14:61856557-61856579 TTAGAGGGGAAGACTGTGGAAGG + Intergenic
1118083672 14:62390874-62390896 AGAGAGAGGAAGGGTGGGTATGG + Intergenic
1118346232 14:64943047-64943069 ATGGAGAGGAAAAAAAGGGAGGG + Intronic
1118647749 14:67856174-67856196 GGAGAGAGGAAGAGTAGGGATGG - Intronic
1118736601 14:68705624-68705646 ATTGATGGGGAGAATGGGGAAGG - Intronic
1119030248 14:71186771-71186793 AGAGAGATGCAGCATGGGGAAGG + Intergenic
1119131341 14:72175827-72175849 AAAGGGAGGAAGAGAGGGGAAGG + Intronic
1119193121 14:72697764-72697786 ATGGAGAGGAAAAATGGGGTGGG + Intronic
1119399068 14:74349514-74349536 AGGGAGAGGAAGAAAAGGGAGGG + Intronic
1119636727 14:76279381-76279403 AAAGAGTGGAAGGAGGGGGATGG - Intergenic
1119858189 14:77916715-77916737 ATAGTGAGGAAGAAAGAAGAGGG - Intronic
1119925383 14:78488764-78488786 ATGAAGAAGAAGAAAGGGGAGGG + Intronic
1119976383 14:79028930-79028952 ACAGAGAGAAAGCATTGGGATGG + Intronic
1119976599 14:79031029-79031051 AAAGAAAGGCAGAAAGGGGAAGG - Intronic
1120025486 14:79578927-79578949 ATTGAGAGGAAGAAAGTAGAGGG - Intronic
1120091527 14:80337700-80337722 AGAGAGAGGAAAAAGGAGGAAGG + Intronic
1120262167 14:82199534-82199556 ATAGAGACAATGAGTGGGGAGGG - Intergenic
1120717439 14:87854980-87855002 AAGGACAGGAGGAATGGGGAAGG + Intronic
1120721538 14:87894390-87894412 ATTGATAGGGAGAATGGAGAAGG + Intronic
1120811710 14:88810568-88810590 AGGGAGAGGAAGAATGGTAAAGG - Intergenic
1121031090 14:90659306-90659328 GGAGAAAGGGAGAATGGGGAAGG + Intronic
1121037041 14:90714882-90714904 ATAGAGATGAAAATTGGGGAGGG - Intronic
1121105070 14:91274186-91274208 AGAGAGAGGCAGAATGGGGATGG + Intronic
1121206419 14:92172333-92172355 ATTGAGAGGAGAAATGGGTACGG + Intergenic
1121290905 14:92774380-92774402 TTAAAAAGGAAGAATGGGGCCGG + Intergenic
1121657572 14:95608585-95608607 AGACACAGGAAGAATGGTGATGG - Intergenic
1121780459 14:96618840-96618862 ATAGACAGGAGGAAGGAGGAGGG - Intergenic
1122139596 14:99654562-99654584 GTAGAGAGGAGGTAGGGGGAGGG + Intronic
1122457336 14:101864654-101864676 ATATAGAGGAGGGAAGGGGAGGG + Intronic
1122662698 14:103308717-103308739 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1202830218 14_GL000009v2_random:19817-19839 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1124069511 15:26378462-26378484 ATAGAAAGGAAGAAAGGAAAGGG - Intergenic
1124816358 15:32997836-32997858 GAAGAGAGGAAGAAAGGGAAAGG + Intronic
1124996500 15:34728068-34728090 ATTTAGATGGAGAATGGGGAGGG - Intergenic
1125199465 15:37088667-37088689 ATAGAGAGGTAGAAGTGGGGAGG - Intronic
1125263882 15:37856985-37857007 AAATAAAGGAAAAATGGGGAAGG + Intergenic
1125320893 15:38487014-38487036 AAAGAGAAGAAAAAAGGGGAAGG - Exonic
1125431533 15:39599530-39599552 AGAGAGAGAAAGAAGGAGGAGGG - Intergenic
1125516160 15:40322593-40322615 AGAGAGCGGAAGGAGGGGGAGGG + Intergenic
1125800140 15:42438498-42438520 ATAGAATAGGAGAATGGGGAGGG - Intronic
1126273580 15:46849394-46849416 AAAGAGAGGAAGTATGAAGATGG - Intergenic
1126475838 15:49064104-49064126 AGAGAGTGGCAAAATGGGGAAGG - Intergenic
1126716816 15:51526159-51526181 AGAGAGAGAAAGAAGGGGGGTGG + Intronic
1127309163 15:57737239-57737261 AGAGAGAGGAAGAGTGAGAAAGG - Intronic
1127391883 15:58512474-58512496 ATAGATGTGAAAAATGGGGATGG + Intronic
1127743351 15:61937053-61937075 AGAGAGAGACAGAATGGAGATGG - Intronic
1127782028 15:62325436-62325458 AGAGAGAGGAAGGAGGAGGAGGG + Intergenic
1127946138 15:63755796-63755818 AAAGAGAGGAAGAGAGAGGAGGG + Intronic
1128747346 15:70123824-70123846 ATGGAGAGGCAAGATGGGGACGG + Intergenic
1128759476 15:70206106-70206128 TCAGAGAGGAAGGATGGGGAAGG + Intergenic
1128825636 15:70713330-70713352 AGAGCGAGAAAGAATAGGGAAGG + Intronic
1129050126 15:72774278-72774300 ATGAGGAGGAAGAATGGGGTGGG + Intronic
1129182188 15:73884527-73884549 ACAGAGAGGAAGGGTGGGGGAGG + Intronic
1129354414 15:74980001-74980023 AAAGAGAGAGAGAATGAGGAGGG - Intronic
1129429816 15:75491433-75491455 ACAGAGAGAAGGAGTGGGGATGG + Intronic
1129681800 15:77662352-77662374 AGAGGGAGGAAGGATGGGGTTGG + Intronic
1129849516 15:78784393-78784415 AGGGAGAGGAAGAGGGGGGAGGG + Intronic
1129905262 15:79182793-79182815 AGAGAAAGGAAGGAAGGGGAGGG - Intergenic
1129973460 15:79801106-79801128 AGAGAGAGAGAGGATGGGGAGGG - Intergenic
1129976973 15:79830810-79830832 TTAGAGAGGAAAAGAGGGGAAGG + Intergenic
1129990104 15:79954718-79954740 AAAAAGAGGGAGTATGGGGATGG + Intergenic
1130047073 15:80453796-80453818 AGAGAGAGGAGGAATGGGGGTGG + Intronic
1130171780 15:81522696-81522718 ATAGAAAGGAAGAAGGGGAAAGG + Intergenic
1130205315 15:81870071-81870093 AAAGAGATAGAGAATGGGGAGGG - Intergenic
1130358816 15:83161113-83161135 ATAGAGTCAAAGACTGGGGAAGG - Intronic
1130430439 15:83842031-83842053 ATGGGGAGGCAGAAGGGGGATGG - Intronic
1130726661 15:86446001-86446023 AGAGGGAGGAAGAATGAAGAAGG + Intronic
1130927346 15:88395688-88395710 ATAGGGAGTTAGAAGGGGGATGG + Intergenic
1130971872 15:88739966-88739988 ATAATGGAGAAGAATGGGGATGG + Intergenic
1131014142 15:89043472-89043494 AAGGAGAGGAAGAAGGGGGAGGG + Intergenic
1131066348 15:89437073-89437095 ATAGAGAGGAAGGGAGAGGAAGG - Intergenic
1131456899 15:92588651-92588673 ATAGAAAGGAAGAAAGGTGAGGG - Intergenic
1131641526 15:94298874-94298896 AGAGAGAGAAAGAGGGGGGAGGG - Intronic
1131821463 15:96278508-96278530 GTAGAGAGGAAGAAGGGAGGTGG - Intergenic
1132127154 15:99237873-99237895 TTGAAGAGGAGGAATGGGGAGGG - Intronic
1133304454 16:4800801-4800823 AAAGAGGTGAAGAAAGGGGAAGG + Intronic
1133330171 16:4967990-4968012 ATAGAGAGGGAGAAAGGGAAGGG - Intronic
1133392753 16:5422766-5422788 ATGGAGAGGGAGAAGGGAGAGGG + Intergenic
1133460758 16:5984197-5984219 GAAGAGAAGAAGAAGGGGGAGGG - Intergenic
1133526121 16:6607479-6607501 AGAGAGAGGAAGAAAGAGTAAGG - Intronic
1133527310 16:6618094-6618116 ATAAGGTGGAAGAAAGGGGATGG - Intronic
1133608723 16:7413327-7413349 CTACAGAGGAAGACTGGGGAAGG - Intronic
1133919371 16:10138433-10138455 ACACAGCGGAAGGATGGGGATGG + Intronic
1134013770 16:10874328-10874350 ACAGAGAGGAAGCCTGGGGTGGG + Intergenic
1134596288 16:15498623-15498645 AGAGAAAGGAAGAAAGAGGAAGG + Intronic
1134718959 16:16370590-16370612 AGAGAGATGGAGAAAGGGGAGGG - Intergenic
1134799627 16:17071801-17071823 AGAGAGGGGAGGAAAGGGGAGGG - Intergenic
1134834033 16:17346524-17346546 AGAGAGGGGAAGAGTGGGGTTGG - Intronic
1134855178 16:17512597-17512619 ATTGAGAAGATAAATGGGGAGGG + Intergenic
1135660177 16:24289606-24289628 GTAGGGAGCTAGAATGGGGATGG - Intronic
1135660537 16:24292613-24292635 GTAGAGAGGAAGAAGGGGAGAGG - Intronic
1135964037 16:27021300-27021322 AGTGAGAGGAAGGATGGGGGAGG - Intergenic
1137367489 16:47873402-47873424 ACAGAGAGAAAGAAAGAGGAAGG - Intergenic
1137439221 16:48483868-48483890 AGAGAGAGGGAGACTGTGGAGGG + Intergenic
1137465261 16:48702703-48702725 AGAGAGAGAAAGAAGGGGGAGGG - Intergenic
1137929780 16:52576012-52576034 AAAGAGAGGAAGAGAGAGGAAGG + Intergenic
1138406901 16:56802970-56802992 AAAGAAAGGAAGTCTGGGGAGGG - Intronic
1138499989 16:57435185-57435207 AAAGAGAGGAAGAGTCGGGGTGG - Intronic
1138787431 16:59864105-59864127 ATCTATAGGAACAATGGGGATGG - Intergenic
1138802665 16:60052978-60053000 AAAGAGAGGAAGAAAGGAAAGGG - Intergenic
1138817163 16:60215715-60215737 TTAGAGAGGATGAATGGGCCTGG + Intergenic
1138818243 16:60227485-60227507 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1138920556 16:61523411-61523433 ATAAACAGAAACAATGGGGAGGG - Intergenic
1139042000 16:63009047-63009069 ATAGAAAAGAAGAATTAGGAAGG + Intergenic
1139147479 16:64341688-64341710 AGAGAGAGGAAGGAAGGAGAGGG - Intergenic
1139350311 16:66330919-66330941 AGAGGGAGAAATAATGGGGAAGG + Intergenic
1139743200 16:69053263-69053285 CTAAATAGGGAGAATGGGGAGGG - Intronic
1140018683 16:71215257-71215279 AAAGGGAGGAAGGAGGGGGAAGG + Intronic
1140056287 16:71528619-71528641 AAAGAGAGAGAGAATGGGGTTGG - Intronic
1140137565 16:72221024-72221046 AGAGAGAGCAAGGGTGGGGAAGG + Intergenic
1140257382 16:73348973-73348995 ATTTGGAGCAAGAATGGGGATGG + Intergenic
1140332719 16:74073324-74073346 ATGGAGGGGAAGAGAGGGGAAGG - Intergenic
1140509659 16:75497893-75497915 GGAGGGAGGAAGAATAGGGAGGG - Intergenic
1140766883 16:78168228-78168250 AGGAAGAGGAAGAATGGGCAGGG - Intronic
1141199418 16:81885520-81885542 AAAGAAATGAAGAAAGGGGAAGG - Intronic
1141761311 16:86030416-86030438 GTAGAAAGGAAGACAGGGGACGG + Intergenic
1141793607 16:86253321-86253343 ATAGCGATGAATAATGGTGATGG + Intergenic
1142207513 16:88791180-88791202 ATGGAGGGGAAGAGAGGGGAGGG + Intergenic
1142968089 17:3593443-3593465 AGGGAGGGGAAGCATGGGGATGG - Intronic
1143008264 17:3851303-3851325 GGAGAGAGGGAGAATGGAGAAGG - Intergenic
1143126650 17:4645709-4645731 AGAAAGAGGGAGAGTGGGGAGGG - Intergenic
1143157565 17:4848038-4848060 AGAGAGAGGAAGAAGGAGGGAGG + Intronic
1143186521 17:5013583-5013605 ATAGAAAGGAAGAAAGGGAGCGG - Intronic
1143366500 17:6412169-6412191 AGAGAGAGGAAGGAAGGGAAGGG + Intronic
1143478912 17:7217626-7217648 GGAGAGAGGAAGCAGGGGGAGGG + Intronic
1144027186 17:11287681-11287703 AGAGAGAGAGAGAAAGGGGAAGG + Intronic
1144156914 17:12513322-12513344 CCAGGGAGGAAGAATGGGGTGGG + Intergenic
1144217646 17:13070479-13070501 AGAGAGAGAAAGAAAGGGGGGGG + Intergenic
1144230634 17:13199646-13199668 AAAGAAAGGAAGAAAGGGAAGGG - Intergenic
1144508582 17:15855842-15855864 GGAGAGTGGTAGAATGGGGAGGG - Intergenic
1144693690 17:17286711-17286733 ATAGAAATGGAGAATGTGGAAGG - Intergenic
1144888168 17:18477853-18477875 GTGGGGAGGCAGAATGGGGAGGG + Intronic
1145122312 17:20271349-20271371 AAAGACAGGAAGCATGGGGGGGG - Intronic
1146172397 17:30644109-30644131 AAATAAAGGAAAAATGGGGAAGG + Intergenic
1146187193 17:30731747-30731769 AGAGAGGGGAGGAAAGGGGAAGG - Intergenic
1146345851 17:32060120-32060142 AAATAAAGGAAAAATGGGGAAGG + Intergenic
1146484474 17:33231853-33231875 ATTGAGATGAGCAATGGGGAGGG + Intronic
1146555949 17:33824110-33824132 AGGGAGAGGAGCAATGGGGATGG + Intronic
1146565369 17:33908393-33908415 ATAGAGAAGCAGACAGGGGAGGG + Intronic
1146795127 17:35775161-35775183 ATAGGGAGGATGAATAGGAATGG + Intronic
1147135220 17:38430162-38430184 ATAAACAGGAAGAATGGGAGTGG + Intronic
1147392541 17:40119257-40119279 AAAGAGAGGAAGACTGGGCTGGG + Intergenic
1147445233 17:40471292-40471314 CCAGAGAGGAAGAATGAGGAGGG - Intergenic
1147529613 17:41263268-41263290 AAAGAAAGAAAGAAAGGGGAGGG + Intergenic
1147604438 17:41766290-41766312 AAAGAGAGGAAGAGAGGGAAAGG + Intronic
1147873488 17:43604225-43604247 ATACAGAGAAAGGATGGGGAAGG + Intergenic
1148171604 17:45525770-45525792 ATAGAAAGAAGGAAGGGGGAGGG - Intergenic
1148217937 17:45844075-45844097 ATGGAGAGGAAGAAAGTGAAGGG - Intergenic
1148277767 17:46320639-46320661 ATAGAAAGAAGGAAGGGGGAGGG + Intronic
1148299974 17:46538494-46538516 ATAGAAAGAAGGAAGGGGGAGGG + Intronic
1148364417 17:47042779-47042801 ATAGAAAGAAGGAAGGGGGAGGG + Intronic
1148621599 17:49038624-49038646 ATAGGGAGGGAGAATGGGTCTGG + Intronic
1148741784 17:49897267-49897289 AGAGAGAGAAAGAATGGGGAAGG + Intergenic
1148805952 17:50264169-50264191 AGAGGGAGGGAGAGTGGGGAAGG + Intergenic
1148810308 17:50286059-50286081 GGAGAGAGGAAGAAAGGGAAGGG - Intergenic
1149025110 17:52018168-52018190 ATAGAGGGGAAGTGTGGGGTTGG + Intronic
1149242368 17:54664819-54664841 TTAGAGAGTAAGAAGGGAGAGGG + Intergenic
1149939337 17:60846224-60846246 ATAAAGAAGTAGAATGGGGCTGG - Intronic
1149946580 17:60934265-60934287 ATAGTGATGAAGAATGGAAAAGG - Intronic
1150152242 17:62819584-62819606 AAGGAGAGGAAGGATGGAGAGGG - Intergenic
1150572396 17:66398530-66398552 GGAGAGAGTAAGATTGGGGAAGG + Intronic
1150754942 17:67903100-67903122 AAAGAGAGGAAGGATGAGGAAGG - Intronic
1150930433 17:69578986-69579008 ACAGACATGAAGAATGGGCAAGG - Intergenic
1150996910 17:70329225-70329247 ACAAAGAAAAAGAATGGGGAGGG + Intergenic
1151133648 17:71924389-71924411 AGAGAGAGGAAGGAAGGAGAAGG + Intergenic
1151429830 17:74055001-74055023 AGAGAGAGGGAGAAAGGGAAAGG - Intergenic
1151656482 17:75498619-75498641 ATGGAAATGAAGACTGGGGAAGG - Exonic
1152018881 17:77770251-77770273 GAAGAGAGGAAGACAGGGGAGGG - Intergenic
1152198471 17:78931274-78931296 ATAGAGAACAAGAATGCAGATGG + Intergenic
1152709366 17:81862932-81862954 AAAGTGAGGAGGAATGGAGAGGG - Intergenic
1152786008 17:82248482-82248504 AGAATGAGGAAGAATGAGGAAGG + Intronic
1152948453 17:83211586-83211608 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1152948468 17:83211635-83211657 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1153601596 18:6786064-6786086 ATTGGGAGGAACAATTGGGAGGG + Intronic
1153980129 18:10301707-10301729 TCAGAGAGGGAGAATGGTGAAGG - Intergenic
1154205802 18:12335696-12335718 ATAGAGCTGAAGGAAGGGGAAGG - Intronic
1155048964 18:22130007-22130029 AGAGAGAGAAAGAAAGGGAAGGG - Intergenic
1155145417 18:23079207-23079229 ACAGAGAGGGAGAAGAGGGATGG + Intergenic
1155627725 18:27854024-27854046 AGAGAGAAGAAGAAAGAGGAGGG + Intergenic
1155739668 18:29272527-29272549 CTATAGAGGAAGAAGAGGGAAGG - Intergenic
1156438099 18:37155389-37155411 ATACAGAGGAGGATTGGGGAAGG - Intronic
1156723856 18:40103755-40103777 AGAGAGAGGAAGAATGGAAAAGG - Intergenic
1156985057 18:43341307-43341329 GGAGAGAGGGAGAAGGGGGAAGG + Intergenic
1157011131 18:43650242-43650264 GGAGAGAGGAAGGATGGAGAAGG + Intergenic
1157524140 18:48366054-48366076 TTAGAGAGGAATAAGGTGGAAGG - Intronic
1158321617 18:56270423-56270445 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1158648965 18:59269709-59269731 AGAGAGAGAGAGAAAGGGGATGG - Intronic
1158744360 18:60181483-60181505 ACAGAGATGAAAAATGGTGAAGG - Intergenic
1158951516 18:62499578-62499600 AGAGGAAGGAAGAAGGGGGAAGG - Intergenic
1158966581 18:62627504-62627526 GAAGAGAGTAAGATTGGGGATGG - Intergenic
1159207057 18:65266408-65266430 AGAGAGAGAAAAAAAGGGGAAGG + Intergenic
1159502998 18:69298083-69298105 AGGGAAAGGAAGAATGGGGGAGG - Intergenic
1159534474 18:69698377-69698399 GAAGAGACGAAGAATGGAGAAGG - Intronic
1159684813 18:71405399-71405421 ATAGGAAGAGAGAATGGGGAGGG + Intergenic
1159770312 18:72541266-72541288 AAAGTGAGGAAGAACAGGGATGG - Intronic
1160090150 18:75819205-75819227 ATGGAGAGGAAGAATGAACATGG + Intergenic
1160129576 18:76212844-76212866 ATAGAAAGGAAGGAGGGAGATGG - Intergenic
1160341041 18:78088927-78088949 AGAGAGAGGAAGATTGGGAGAGG + Intergenic
1160951567 19:1670013-1670035 AGAGAGAGAGAGAAGGGGGAGGG - Intergenic
1161241646 19:3226404-3226426 AAAGAGATGGGGAATGGGGAGGG - Intronic
1161389886 19:4015455-4015477 AGAGAGAGGCAGGGTGGGGATGG - Intronic
1161500349 19:4611256-4611278 CCAGAGAGGAAAATTGGGGAGGG - Intergenic
1161779938 19:6285246-6285268 ATCGAAAAGAATAATGGGGAAGG + Intergenic
1162990029 19:14295955-14295977 AAATAAAGGAAAAATGGGGAAGG - Intergenic
1163101415 19:15099292-15099314 AGAGAAAGAAAGAAAGGGGAAGG + Intergenic
1163174857 19:15557128-15557150 ATGGAGAAGAGGGATGGGGAAGG - Intergenic
1163378449 19:16948800-16948822 AGAGAGGGGAAGAGAGGGGAAGG + Intronic
1163619086 19:18347467-18347489 ATAGAGAGGAAGAGAGAGAAAGG - Intronic
1163632566 19:18424862-18424884 AGGGAGGGGGAGAATGGGGAAGG + Intronic
1163755743 19:19105353-19105375 ATAGGGAGGAAGGACGGGGCTGG + Intronic
1163864899 19:19764840-19764862 AAAGAAAGGAAGGAAGGGGAGGG - Intergenic
1164389607 19:27806255-27806277 AAAGAAAGAAAGAAAGGGGAAGG - Intergenic
1164591928 19:29512133-29512155 ATGAAGAGGAAGAAGAGGGAGGG + Intergenic
1165900050 19:39165124-39165146 GTAGACAGAAAGAATGGGAACGG + Intronic
1166108860 19:40610869-40610891 ATGGAGAAGCAGAATGAGGAGGG + Intronic
1166167656 19:41003743-41003765 ACAGAAAGGAAGGATGAGGAAGG + Intronic
1166194033 19:41194515-41194537 GTAGGGAGGAAGAAAGAGGAGGG - Intronic
1166197126 19:41214431-41214453 TTAGAGAGGATGATGGGGGAAGG - Intergenic
1166300668 19:41910404-41910426 ACAGTGAGGAGGAATGGGGAGGG + Intronic
1166530555 19:43540667-43540689 ATAGATAGGATGATTGGGGATGG - Intergenic
1166778721 19:45328422-45328444 AGAGAAAGGAGGAATGGGCAGGG - Intergenic
1167103638 19:47418728-47418750 ATAGAGAGGCAGAAAGAGGGGGG + Intronic
1167286666 19:48602267-48602289 ACAGAGAGGGTGAAAGGGGAAGG + Intronic
1167880001 19:52449345-52449367 AGAGAGAGAGAGAATGAGGATGG - Intronic
1167977246 19:53239414-53239436 ATAAAGATGAAGAATTAGGAGGG + Intronic
1168105626 19:54164317-54164339 TTAGAGAGGAAGTATGGGAGAGG - Intronic
1168205839 19:54850529-54850551 AGAGGGAGGGAGAGTGGGGATGG + Intronic
1168290102 19:55353399-55353421 ATGGAGAGGGAGAAGGGGGACGG + Intronic
1202642473 1_KI270706v1_random:107955-107977 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
925834235 2:7928667-7928689 ATTGAGAGGAAGAAAGGGATGGG - Intergenic
926390321 2:12383940-12383962 ATAGAGAGGAAGAACAGGAAAGG - Intergenic
926491572 2:13531516-13531538 AGAGAGAGAAAAAAAGGGGAGGG - Intergenic
926744431 2:16139229-16139251 AGAGAGAGGAAGAAAGGAGCTGG + Intergenic
926881763 2:17552567-17552589 AGAGAGAGGAAGGATGGGGACGG - Intronic
926908632 2:17829082-17829104 ATAGAGGGGAAGAATGAGTTTGG + Intergenic
927099105 2:19774254-19774276 AGAGAGAGGGAGGAAGGGGAAGG - Intergenic
927337472 2:21941649-21941671 ACAGAGAAGCAGAATGGGGGAGG - Intergenic
927372165 2:22368809-22368831 ACAAAGAGAGAGAATGGGGAGGG + Intergenic
927414120 2:22858976-22858998 AGAGAAAGGAGGGATGGGGACGG - Intergenic
927659514 2:24981045-24981067 AGAGAGAAGAAGGAGGGGGAGGG + Intergenic
928191938 2:29178738-29178760 AGAGATAGGAAGTATTGGGAAGG - Intronic
929456744 2:42071581-42071603 ACAGAGAAGAAGAAAGGAGAGGG - Intergenic
929863469 2:45698607-45698629 AAAGAGAGGAAGAGAGGGGGAGG + Intronic
929973662 2:46609694-46609716 AGAGAGAGGGAGGGTGGGGAAGG + Intronic
930021702 2:47005582-47005604 AGAGAGAGGAACATTGAGGAAGG + Intronic
930050855 2:47215302-47215324 ATGGGGATGAAGGATGGGGAGGG + Intergenic
930581808 2:53220656-53220678 ATAAAGAGGAAGAAGGGGGTAGG + Intergenic
930717239 2:54604520-54604542 TTAGAGAGGAAGGAGGGGGCTGG - Intronic
930927128 2:56831850-56831872 AAAGAGAGGAAGAAAAGGAAGGG + Intergenic
930927630 2:56838530-56838552 AGAGAGAGAGAGCATGGGGAGGG + Intergenic
931330080 2:61271689-61271711 AAGGAGGGGAAGAAGGGGGAAGG + Intronic
931546997 2:63399588-63399610 AGAGAGAGGAAGAAGGGCGGGGG + Intronic
932279432 2:70477215-70477237 ATAAAAAGGAAGAAGGAGGAAGG + Intronic
932501884 2:72189733-72189755 AAAGAAAGGAAGGAAGGGGAGGG - Intronic
932569926 2:72933256-72933278 ACAGAGAGGCAGAATGGGCATGG - Intronic
932577806 2:72972390-72972412 ATAGGAAGCAAGAATGGAGAAGG - Intronic
932628454 2:73317967-73317989 AAAGAGAGGAGGAGAGGGGAGGG - Intergenic
933119659 2:78521051-78521073 ATAGAGAGGAGGAAAAGGGAAGG + Intergenic
933488658 2:82955951-82955973 AGAGAGAAGAAGAAAGAGGAAGG + Intergenic
933637160 2:84720746-84720768 AAAGATAGGAAGAATGGGCGAGG - Intronic
933785522 2:85838202-85838224 ACAGGGAGGAGGGATGGGGATGG + Intergenic
934118037 2:88814098-88814120 AGAGAGAGGAAAACTGGGGTGGG + Intergenic
934173822 2:89561992-89562014 ATAGAAAGAAAGAAAAGGGAAGG - Intergenic
934284136 2:91636341-91636363 ATAGAAAGAAAGAAAAGGGAAGG - Intergenic
934913338 2:98278544-98278566 ATGGAGAGCTAGAAAGGGGATGG + Intronic
935421076 2:102869479-102869501 CCAGAGAGGAAGAAGGGGAAAGG + Intergenic
935456120 2:103269316-103269338 ATTTAGAGGAAGAATTGGAAGGG + Intergenic
936039750 2:109141236-109141258 ACAGAGGGGAAGAGTGAGGAAGG - Intronic
936439132 2:112534958-112534980 AGAGAGAGGAAGAAAGAGAAAGG + Exonic
936548565 2:113414292-113414314 ATAGGGAAGAAAAATGAGGAAGG - Intergenic
936734564 2:115425899-115425921 AGAGCAAGGAAGAAAGGGGAAGG + Intronic
937701642 2:124868934-124868956 AAAGTGAGAATGAATGGGGAGGG + Intronic
937873019 2:126799255-126799277 AAAGAGAGGAAGAAAGAGGGAGG - Intergenic
938122635 2:128644731-128644753 GTAGAGAGGGAGAAAGGGGAAGG - Intergenic
938483980 2:131684558-131684580 AGATAGAGGGGGAATGGGGAAGG - Intergenic
938710892 2:133975525-133975547 AGAGTGGGGAAGAGTGGGGAAGG - Intergenic
938772547 2:134512716-134512738 AGAAAGAGGGAGAATGGTGAAGG + Intronic
938809036 2:134834751-134834773 AGAGAGAGAAAGAGAGGGGAGGG + Intergenic
939737879 2:145872098-145872120 AGAGAGAGGAAGAAAGGGAAAGG + Intergenic
939918717 2:148081782-148081804 ATGTAGAATAAGAATGGGGAAGG - Intronic
940020350 2:149149790-149149812 ATGGAGATAAAGAAAGGGGAAGG - Intronic
940112014 2:150165438-150165460 AAAGAGAGGTGGACTGGGGATGG + Intergenic
941060470 2:160841821-160841843 AGAGAGAGGAAGATGGTGGATGG + Intergenic
941064698 2:160888787-160888809 AGAGAGAGGAAGATAGGAGAAGG + Intergenic
941175711 2:162195332-162195354 AAAGGGAGGAAGAATAGGGCAGG + Intronic
941180117 2:162249382-162249404 ATAGAGGTTAAAAATGGGGAAGG - Intergenic
941381854 2:164802846-164802868 AGAGGGAGGAAGGAAGGGGAGGG + Intronic
941573126 2:167196352-167196374 AAAAAAAGGAAGACTGGGGATGG + Intronic
941880578 2:170476487-170476509 ATGGAGAGCTGGAATGGGGATGG + Intronic
941999711 2:171633784-171633806 AGAGAGAGGAAGGAAGAGGAGGG - Intergenic
942137502 2:172942347-172942369 TTAGAGAGGAAGAAAGCAGATGG - Intronic
942228420 2:173837109-173837131 ACTTAGAGGAAGAATGGTGAAGG + Intergenic
942832185 2:180250516-180250538 AGAGAGGGCAAGAATGGGGCAGG - Intergenic
943332260 2:186573523-186573545 ATTAAGAGGAAAAATGAGGAAGG + Intergenic
943665281 2:190602621-190602643 GTAGAGTGGAAAGATGGGGAGGG - Intergenic
943713868 2:191128357-191128379 ATAGAGGGGAAGGAAGAGGAGGG + Intronic
944667732 2:201971152-201971174 AGACAGAGGGAGAAAGGGGATGG + Intergenic
945528593 2:210921797-210921819 AGAGAGAGAAAGTATTGGGAAGG + Intergenic
945946817 2:216002760-216002782 ACAAAGAAGGAGAATGGGGAGGG - Intronic
945958698 2:216109698-216109720 GTAGAGAGGGAGAAGAGGGATGG - Intronic
946040730 2:216781123-216781145 ACAGAGAGGAAGGGAGGGGAAGG - Intergenic
946061574 2:216946297-216946319 AAAGAGAGGAAGACGGGAGAAGG - Intergenic
946145080 2:217724474-217724496 GTAAAGAGGGAGAATGGTGAGGG + Intronic
946413073 2:219525268-219525290 AAAGAGAGGAAGTATGTGAAAGG - Intronic
946650443 2:221887483-221887505 AGGGAGAAGAAGAATGGGTAGGG + Intergenic
946686984 2:222280358-222280380 AAAGAGAGAAATAAAGGGGAAGG + Intronic
946775930 2:223140964-223140986 AAAGAGGGGAAGAAGGGAGAGGG + Intronic
946819987 2:223619582-223619604 TGAGAGAGGAAGACTGGGGCTGG + Intergenic
946907171 2:224428634-224428656 ATAAAGAGAGAGAATGGGGCGGG - Intergenic
947082913 2:226419036-226419058 ACAGAGAGAGAGAATAGGGATGG + Intergenic
947339019 2:229117494-229117516 AGAGAAAGGAAGGATGGAGAAGG - Intronic
947628176 2:231634451-231634473 AAAGAAAGAAAGAAGGGGGAGGG + Intergenic
947690124 2:232127699-232127721 ACAGTGAGCAAGAATGGGCATGG - Intronic
947965384 2:234276377-234276399 AAACAGAGGAAAAGTGGGGAAGG - Intergenic
948313775 2:237010992-237011014 TTACAGATGAGGAATGGGGAGGG - Intergenic
948746781 2:240102205-240102227 TTAGAGACTAAGAAAGGGGAGGG + Intergenic
948815838 2:240510053-240510075 AGGGAGGGCAAGAATGGGGAAGG - Intronic
1168771135 20:417698-417720 AAAGAGAGGGAGAGTGGGAAGGG - Intronic
1168987903 20:2066154-2066176 CCAGACAGGGAGAATGGGGAAGG + Intergenic
1169663461 20:8006684-8006706 ATAGAGAGGGAGAAGTAGGAGGG - Intronic
1169920617 20:10730955-10730977 AAAGGGAGGAAGGAAGGGGAGGG - Intergenic
1171199302 20:23228227-23228249 ATACAGTGGAAGAATCTGGACGG + Intergenic
1171990058 20:31689228-31689250 AAGGAAAGGAAGAAAGGGGAAGG + Intronic
1172038168 20:32025112-32025134 AAAGAAAGAAAGAAAGGGGAAGG - Intronic
1172038175 20:32025147-32025169 AAAGAAAGAAAGAAAGGGGAAGG - Intronic
1172410774 20:34721216-34721238 GTATAGAGGAAGAAGGGGAAGGG - Intronic
1172504363 20:35450483-35450505 ATGGAGAGGAAGATGGGGGTGGG + Intronic
1172566485 20:35934630-35934652 AAAGAGAGAAAGAAGAGGGAGGG + Intronic
1172800399 20:37572371-37572393 AAAGAAAGAAAGAAAGGGGAAGG - Intergenic
1173000859 20:39104648-39104670 ATCGAGATGGAAAATGGGGAAGG + Intergenic
1173112405 20:40204604-40204626 AAAGAAAGGAAGAAGGAGGAAGG - Intergenic
1173254901 20:41387306-41387328 ATAGACAGGCAGCTTGGGGAGGG + Intergenic
1173283449 20:41649468-41649490 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
1173310987 20:41895628-41895650 ACTGAGAGGGAGAAAGGGGAGGG + Intergenic
1173443141 20:43095684-43095706 AGAGAGAGGAAGCAGGGAGAGGG - Intronic
1173722038 20:45268008-45268030 AAAGAGAGAAAGAAAGGGAAAGG + Intergenic
1174317242 20:49713012-49713034 AAGTAGAGGAAGAAAGGGGAGGG + Intronic
1175004704 20:55669923-55669945 AGAGAGAGAAAGAGTGGGAAGGG - Intergenic
1175064857 20:56276070-56276092 GTAGAGAGGGAGAAAGGAGAGGG - Intergenic
1175298803 20:57928500-57928522 AAAGGGAGGAGGAAGGGGGAAGG - Intergenic
1175614887 20:60389544-60389566 AGAGAAAGGAAGAATGAGTATGG + Intergenic
1175779063 20:61670816-61670838 ATAGAAAGGAAGGAAGGGGCTGG + Intronic
1176123286 20:63463848-63463870 ATACAGAGGAAGAATCTAGAAGG + Intronic
1176529004 21:7943684-7943706 ATGGAGAGGAATAAAGTGGAAGG - Intergenic
1176609405 21:8864655-8864677 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1177755172 21:25337800-25337822 ATAGATAAGAAGACTGGAGAAGG + Intergenic
1178088143 21:29133645-29133667 AAAGAAAGCTAGAATGGGGAGGG - Intronic
1178598317 21:33974660-33974682 AAGGAAAGGAAGAAGGGGGATGG - Intergenic
1179147200 21:38778577-38778599 AGAGAGAGCAAGTAGGGGGAAGG - Intergenic
1179282331 21:39944621-39944643 AAACAGATGAAGAATGGGAAGGG + Intergenic
1179358304 21:40682626-40682648 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
1180300327 22:11031955-11031977 AGAGAGAGAAAGAGAGGGGAGGG - Intergenic
1180359500 22:11874502-11874524 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1180485070 22:15787020-15787042 AGATAGAGGGGGAATGGGGAAGG - Intergenic
1180583723 22:16866780-16866802 AGAGAGAGAAAGAACAGGGAGGG - Intergenic
1181012956 22:20052926-20052948 AGAGACAGGAAGAGTGAGGAGGG + Intronic
1181389798 22:22571946-22571968 AAAGAAAGGAAGGAAGGGGAAGG + Intergenic
1181646115 22:24232539-24232561 AGAGAGAGGAAGAAGGAGGCCGG + Intronic
1181685156 22:24523087-24523109 ATAGAGATGCAGAAAGGGCAGGG + Intronic
1181826535 22:25520771-25520793 ATAGAAAGGCAGACTGGAGAAGG + Intergenic
1182100736 22:27655775-27655797 GAAGAGAGGAAGGAAGGGGAAGG + Intergenic
1182415670 22:30219917-30219939 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1182491351 22:30674348-30674370 ATAGAGGGGACGCATGGGGAAGG - Intergenic
1182577093 22:31280339-31280361 ATAGAGAGGATGAAAGGGTAGGG - Intergenic
1182806383 22:33074172-33074194 ATAAAGAAGAAGAGTGAGGAGGG - Intergenic
1182862166 22:33569651-33569673 AAAGAGGGGGAGAATGTGGATGG - Intronic
1182990068 22:34759182-34759204 ATGGATAGGAAGAAAGTGGAAGG + Intergenic
1183337035 22:37255768-37255790 AGAGAGAGAAAGAAAAGGGAGGG + Intergenic
1183660832 22:39220312-39220334 AAAGGGAGGAAGAAAGAGGATGG + Intergenic
1183903565 22:41023145-41023167 ATAGGGAGGAACAGTGGGTAGGG - Intergenic
1184309347 22:43631164-43631186 ATCCAGAGGCAGAATGGAGATGG - Intronic
1184472821 22:44705306-44705328 ATAGAGAGAGAGAAAGGAGAGGG - Intronic
1184519996 22:44987795-44987817 ATAGAGAGAAGGAAGGGGGAGGG - Intronic
1184804818 22:46787769-46787791 GTAGAGAACCAGAATGGGGAGGG + Intronic
1184990895 22:48169341-48169363 ACAGGGAGGAAGAAGGAGGAGGG + Intergenic
949155931 3:827267-827289 ATGGAGAGGAAAAAGTGGGAAGG + Intergenic
949332505 3:2937836-2937858 AGAGAGAGGAAGAGAGGGAAGGG + Intronic
949915962 3:8964820-8964842 AAAAAGAGAAAGAATGGGTAAGG + Intergenic
950037077 3:9893966-9893988 ATAGAGAAGTAGACTGGGTATGG + Exonic
950156590 3:10725603-10725625 ACAGAGAGGAACAATGGACATGG + Intergenic
950383590 3:12638031-12638053 AAAGAGAAGAATGATGGGGAAGG - Intronic
950739815 3:15041296-15041318 AGAGATACAAAGAATGGGGAGGG - Intronic
951034086 3:17913883-17913905 GTAGTGAGGAGGAATGGGGCAGG + Intronic
951362021 3:21736703-21736725 ATAGAGAAGTAGACTGGGGAGGG + Intronic
951413014 3:22387959-22387981 AGAGAGAGGAAGAAAGGAGAAGG + Intergenic
951612926 3:24511640-24511662 ATATAAAGAAAGAATGGGGCCGG - Intergenic
952256719 3:31701962-31701984 ATAGAGGGAAAAGATGGGGAAGG - Intronic
952554493 3:34516813-34516835 AGTGAGTGTAAGAATGGGGAAGG + Intergenic
952580130 3:34823653-34823675 AAATAGAGAAAGAATGGGGGTGG + Intergenic
952709735 3:36417331-36417353 ATAGACAGGAAGAAGGTTGAAGG - Intronic
953106404 3:39884929-39884951 ATAGGGAGGGAGAAGGGGGGTGG - Intronic
953401072 3:42618009-42618031 ATAAATAGAAAAAATGGGGAGGG + Intronic
953550453 3:43898472-43898494 AACGTGAGGGAGAATGGGGAGGG + Intergenic
953551678 3:43908230-43908252 ATAGTGAGGAAGAGTGAGAAGGG + Intergenic
953553540 3:43923906-43923928 AAAGAGAGAATGAAAGGGGAAGG - Intergenic
953563619 3:44013308-44013330 AGACAGAGGCAGAATGAGGATGG - Intergenic
953761921 3:45695089-45695111 AAAGGGAGGATGAATGGGGGAGG + Intronic
955484391 3:59420938-59420960 AAAGAGAGGTAGAATGCTGAAGG - Intergenic
955501535 3:59589216-59589238 AAAGAGAGAGAGAATGGGAAAGG - Intergenic
955602700 3:60664433-60664455 AGGAAGAGGAAGAAGGGGGAGGG - Intronic
956321416 3:68000777-68000799 ATGGAGAGGGAGAAAGTGGATGG + Intergenic
956374046 3:68595099-68595121 ATAGAGAGGAAGAGAAAGGAAGG - Intergenic
956538332 3:70304912-70304934 ATAGAAAGGAAGGAAGGGAAAGG - Intergenic
956880289 3:73503869-73503891 AAAGAAAGCAAGAGTGGGGAGGG + Intronic
957225496 3:77439747-77439769 AATGAGAGGAAAATTGGGGAGGG - Intronic
957684523 3:83483934-83483956 CTAGAGAGGAAGAATTAGAATGG - Intergenic
958080474 3:88740212-88740234 AGAAAGAGGAAGAAGGTGGAGGG - Intergenic
958431220 3:94043652-94043674 AAAGAAAGAAAGAAAGGGGAGGG - Intronic
958877735 3:99635039-99635061 ATGGAGAGGAGGGATGAGGAGGG - Intergenic
959105116 3:102056989-102057011 GGAGAAAGGGAGAATGGGGAAGG + Intergenic
959840217 3:110966588-110966610 ATAGAGAGAAAGACTGAGAAGGG + Intergenic
960203824 3:114870874-114870896 AGAGACAGGAAAAATGAGGAGGG - Intronic
960358178 3:116678771-116678793 ATGGAGAGCTGGAATGGGGATGG - Intronic
960378434 3:116931190-116931212 ATAGAGAGAAAAAGTGTGGAGGG + Intronic
960708139 3:120500966-120500988 AAAGTGAGGAAGAGTAGGGATGG + Intergenic
960811515 3:121631654-121631676 ATAGAGAGGACTCTTGGGGAAGG + Exonic
960906441 3:122606459-122606481 AAACACAGGAAGAATGAGGAGGG + Intronic
960932613 3:122869224-122869246 TTAGAGAGGAAAACTGGGGGGGG - Intronic
961115353 3:124324359-124324381 ATAGAGAGGAAGAATGGGGAGGG - Intronic
961175871 3:124834605-124834627 AGAGAAGGGAAGGATGGGGAGGG + Intronic
961460301 3:127045724-127045746 GTAGAGAGGAAGAGAGGGGAAGG + Intergenic
961914210 3:130354097-130354119 AGAAAGAGAAAGAAAGGGGAAGG + Intronic
962003340 3:131323494-131323516 AAAGAGAGGAAGATGGGGGAAGG - Intronic
962072143 3:132044561-132044583 AAAGAGAGGAAGGGAGGGGAAGG + Intronic
962694085 3:137930495-137930517 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
962891979 3:139679833-139679855 TCAGAGGGGAAGAATGGGAAGGG + Intergenic
963090610 3:141480410-141480432 AAAGAGGGCAAGATTGGGGATGG - Intergenic
963176059 3:142299003-142299025 ATCCAGAGGAGGGATGGGGAGGG - Intergenic
963249535 3:143090329-143090351 ATATAGAGAAGGAAAGGGGAGGG - Intergenic
963700107 3:148614946-148614968 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
964059856 3:152508006-152508028 ATAGGAAGGAGGAAGGGGGAAGG + Intergenic
964168674 3:153739813-153739835 AACGACAGGAAGAATGAGGAGGG + Intergenic
964236841 3:154541227-154541249 ATAGTGATGGACAATGGGGAAGG + Intergenic
964847075 3:161055766-161055788 AGAGAGAGAGAGATTGGGGAGGG - Intronic
964945168 3:162213646-162213668 ATAGGAAGGAAGGATGGGAAAGG + Intergenic
965059844 3:163771804-163771826 TTAAAGAGGAAGAAGGGAGAGGG - Intergenic
965177415 3:165353271-165353293 GAAGAGAGGCAGAATGGGGAAGG - Intergenic
965370731 3:167858998-167859020 TTAGATAGGAAGAATAGGCATGG + Intergenic
965565422 3:170111379-170111401 AGAGAGAGAAAGAAAGAGGAAGG + Intronic
965599699 3:170442635-170442657 AGAGACAGCAAGAATGGAGAGGG - Intronic
965686971 3:171314460-171314482 ACAGAGAGGCAGAAATGGGATGG - Intronic
966695350 3:182784647-182784669 AGAGAGGGGAAGATGGGGGAGGG - Intergenic
966748147 3:183297663-183297685 ACAGAGAGAAAGAAAGAGGAAGG - Intronic
966804448 3:183795690-183795712 ATAGGGAGGTGGAATGGGGTTGG + Intronic
966842370 3:184100112-184100134 GATGAGATGAAGAATGGGGAGGG - Intronic
967274771 3:187763505-187763527 AAAGAGAGGAAGTATGGGGAGGG + Intergenic
967669899 3:192220309-192220331 ATAGGGAAGTAGAATGGTGAAGG - Intronic
967895932 3:194396489-194396511 GAAGAGAGGAGGAGTGGGGAGGG + Exonic
968604077 4:1523360-1523382 AAACAGAAGAAGAATGGGGCAGG - Intergenic
968665298 4:1818128-1818150 ACCATGAGGAAGAATGGGGAAGG + Intronic
968738768 4:2316174-2316196 AAAGAAAGAAAGAAAGGGGAAGG - Intronic
968817432 4:2829275-2829297 ATAGGGAGGATGAATGGGGAAGG + Intronic
969180017 4:5433183-5433205 ATAGAGAGGAAGTTTCTGGAAGG + Intronic
969827675 4:9770805-9770827 ATAGAAAGAAAGAAAAGGGAAGG - Intergenic
970242305 4:14022218-14022240 AGAGGGAGGAAGATTGGGTAGGG + Intergenic
970273164 4:14368493-14368515 ATGGAGAGCCAGAAGGGGGATGG + Intergenic
970479326 4:16457734-16457756 AAAGAAGGGAAGAAGGGGGAGGG - Intergenic
970954174 4:21791468-21791490 AAAAGGAGGAAGAATGGGAAGGG + Intronic
970992015 4:22223549-22223571 TTAGAGAGGGAGACCGGGGAAGG - Intergenic
971090556 4:23338928-23338950 ACAGAAAGGAAGAATTGGAATGG + Intergenic
971666577 4:29494054-29494076 TTAGACACAAAGAATGGGGATGG - Intergenic
971782647 4:31056502-31056524 AAAGAAAGAAAGAAAGGGGAAGG + Intronic
972281447 4:37605892-37605914 AAAGAAAGGAAGAAAGAGGAAGG + Intronic
972341676 4:38157490-38157512 CAAGAGAGGAAGCAAGGGGAGGG + Intergenic
972408675 4:38769966-38769988 ATGGAGACAAAGCATGGGGAAGG - Intergenic
972727178 4:41755095-41755117 TGAGAGAGGAAGAATTGGGTAGG - Intergenic
972732930 4:41813044-41813066 ATAGAGAGCAAGGGTGTGGAAGG - Intergenic
973007231 4:45028220-45028242 AAAGCAAGGAAGAATGGGGTTGG + Intergenic
973200186 4:47491804-47491826 ATAGAAAGGAAGAAGAGGAAAGG - Intronic
973712855 4:53646358-53646380 ATAGAGACTGAGAATGGGGTGGG - Intronic
973715604 4:53672819-53672841 GTAGAGAGGAAGAATTGGGTTGG + Intronic
973943186 4:55931233-55931255 TTACAAAGGAAGAATGGGCAGGG - Intergenic
974291364 4:59935729-59935751 AGAGAGAGTAAAAATGAGGATGG + Intergenic
974327368 4:60431545-60431567 ATGGAGTGGATGAAAGGGGATGG - Intergenic
974412887 4:61564847-61564869 AAAGAGAGGAAGAGAGGAGATGG + Intronic
974510556 4:62834802-62834824 ATAGAGAGAAAGACTGGTGGTGG - Intergenic
974556843 4:63461651-63461673 AGAGAGAAGGAGAAGGGGGAAGG + Intergenic
974600814 4:64076762-64076784 ATGGGGAGGAATAATGTGGATGG + Intergenic
975246989 4:72130961-72130983 ATAGAGAGCTGGAACGGGGATGG + Intronic
975317320 4:72969635-72969657 ACAGTTAGGAAGAATTGGGATGG - Intergenic
975359223 4:73447369-73447391 AGAAAAAGGAAGAAAGGGGAGGG - Intronic
976267255 4:83195755-83195777 AAAGAAAGGAAGAAGGTGGAAGG - Intergenic
976439598 4:85058193-85058215 AAAGGGAGGAGGAATGGAGAGGG - Intergenic
976849934 4:89533265-89533287 AAAGAGAGAAAGAAAGGGAAAGG + Intergenic
977128268 4:93198655-93198677 TTAGAGAGGTAGGATGGGAAGGG + Intronic
977317388 4:95467412-95467434 ACAGAGAGAGAGAATGGGGCTGG + Intronic
977377339 4:96222527-96222549 AAAGAAAGGAAGGAAGGGGAAGG - Intergenic
977600724 4:98931330-98931352 AGGGAGAGGAAGGGTGGGGAAGG - Intergenic
978413918 4:108455559-108455581 ACAGAGAAGAGGACTGGGGATGG - Intergenic
978467158 4:109020474-109020496 ACAGAGAGCAAGAATGAGCATGG + Intronic
978849191 4:113312665-113312687 ATGGTGAGGAAAAGTGGGGAGGG + Intronic
978858327 4:113418670-113418692 AGAGAGAGGAAGGAAGGAGAGGG - Intergenic
978988448 4:115046218-115046240 ATAGGGAGGCAGAATGGGGCAGG - Intronic
979101055 4:116615254-116615276 AGAGAGAGAGAGAAAGGGGAGGG + Intergenic
979570327 4:122215835-122215857 CTCGAGAGGAAGGATGGGGGGGG - Intronic
980734494 4:136867419-136867441 ATACAAAGCAAGAAGGGGGATGG - Intergenic
980806406 4:137820295-137820317 CTAGAGACAAAGAATGGGGATGG - Intergenic
981075200 4:140584379-140584401 TTAGGGAGGAAGAATGGGGAAGG - Intergenic
981417833 4:144513691-144513713 AAAGAGAGGAAAAATACGGAAGG + Intergenic
981532435 4:145765353-145765375 ATGGGGTGGAAGGATGGGGAGGG - Intronic
981766654 4:148258470-148258492 ATCTAGACCAAGAATGGGGAAGG - Intronic
982217244 4:153093017-153093039 GTGGAGAGGGAGAATGGAGATGG - Intergenic
982786457 4:159542933-159542955 ATAGAGAAAAAGAAAGGTGAGGG + Intergenic
982927496 4:161357193-161357215 AAAGAGGGGAAAAGTGGGGATGG + Intergenic
983335997 4:166393238-166393260 ATGGAGAGGAAAAATGGGGTTGG - Intergenic
984245315 4:177268484-177268506 ATAGAGAGTTGGAAAGGGGATGG - Intergenic
984467982 4:180125697-180125719 AGAGAGTGGAGGAAAGGGGAGGG + Intergenic
985080205 4:186257032-186257054 ATAGACAGTAAAAATTGGGAAGG - Intronic
985203615 4:187508746-187508768 AGACAGAGGAAGAAAGGTGATGG - Intergenic
985209820 4:187580856-187580878 AAAGAGAGAAAGAAAGAGGAGGG + Intergenic
1202769838 4_GL000008v2_random:193852-193874 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
985910805 5:2879514-2879536 AGAGAGAGAAAGAAAGGGAAAGG + Intergenic
985983022 5:3488134-3488156 AGAGAGGGGAGGAAGGGGGAGGG + Intergenic
986028732 5:3875183-3875205 AAAGAGAAAAAGAAAGGGGAAGG + Intergenic
986457404 5:7933119-7933141 ACAGAAGGGAAGAAGGGGGAGGG - Intergenic
987022415 5:13888242-13888264 GTAGAGAGGAAGAAAGGGGTAGG - Intronic
987783668 5:22470706-22470728 ATAGAAAAGAAGACTGGGCAAGG - Intronic
988205339 5:28126516-28126538 ATGGAGAGCCAGAAGGGGGATGG - Intergenic
988672769 5:33399712-33399734 AGAGAGAGAGAGAATGGAGATGG + Intergenic
988801151 5:34698055-34698077 AAAGGGAGGGAGAAAGGGGAGGG - Intronic
988889025 5:35594338-35594360 TTAGAGACTCAGAATGGGGAGGG - Intergenic
988942862 5:36163598-36163620 ATAGGGTGAAAGAATGGTGATGG + Intronic
989104284 5:37846417-37846439 ATATGGAGGAAAAATGGAGAAGG - Intergenic
989105702 5:37861400-37861422 AGAGAGAGAAAGAGCGGGGAAGG - Intergenic
989122895 5:38021760-38021782 ATAGAGGAGAAGGAAGGGGAAGG - Intergenic
989141987 5:38210591-38210613 AAAGAGAGGAGGAAAGGGGGAGG + Intergenic
989146376 5:38254671-38254693 CTAGAGAGGAAGCATGAAGAGGG + Intergenic
989322380 5:40151371-40151393 AAAGAGAGGAAGAAAGGAGATGG - Intergenic
989387375 5:40867108-40867130 ATAAAGAGAAAGAGAGGGGATGG - Intergenic
989823184 5:45820258-45820280 ATAAAGAGGCAGAATGGCAATGG + Intergenic
990021680 5:51135475-51135497 ACAGAGAGGTTTAATGGGGATGG - Intergenic
990136174 5:52646026-52646048 AAAGAAAGGGAGAAGGGGGATGG - Intergenic
990210102 5:53473503-53473525 ACAGAGAGGATGAATGGGTCAGG + Intergenic
990210475 5:53478577-53478599 AAAGAGAGGGAGAAAAGGGAGGG + Intergenic
990224518 5:53634599-53634621 AGGGAGAGGAAGGAGGGGGAAGG - Intronic
990584751 5:57200155-57200177 AAAGAGAGGAAGGAAAGGGAAGG - Intronic
991503694 5:67302967-67302989 ACAGAGAGGGAGAAGGGGTAGGG + Intergenic
991544636 5:67767810-67767832 ATAGAGATGATAAATGGGGATGG + Intergenic
991605437 5:68396135-68396157 AGACAGTGGAAGAATGAGGAAGG + Intergenic
992108227 5:73468145-73468167 AAACAGAGCAAGAATGGGGGGGG + Intergenic
993011737 5:82490984-82491006 GTAGAGAGAAAGAAGGGAGAAGG - Intergenic
993052318 5:82939896-82939918 ACAGAGAGAGAGAAGGGGGAGGG - Intergenic
993354189 5:86885315-86885337 TTAGGAAGGAAGAATGGAGAGGG + Intergenic
993391522 5:87324284-87324306 AAAGAGAGGAGGAAAAGGGAGGG - Intronic
993854367 5:93055158-93055180 ATAGAGATGGAGAATGGGAATGG - Intergenic
994279451 5:97884366-97884388 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
994585979 5:101709995-101710017 AAATAGAGGAAGATTGGGGTAGG + Intergenic
994638087 5:102367534-102367556 AGAGAGAGGAGGGAAGGGGAAGG + Intergenic
994760988 5:103853759-103853781 AGAGGGAGAAAGACTGGGGATGG + Intergenic
995926549 5:117381837-117381859 ATAGAGAGGCAGGAGAGGGAGGG - Intergenic
996277825 5:121689043-121689065 ATGAAGAGCAAAAATGGGGAAGG + Intergenic
996280990 5:121728878-121728900 AAAGAGGGGGAGGATGGGGATGG - Intergenic
996508736 5:124295749-124295771 GGAGAGAGGAAGAATGATGAGGG - Intergenic
996962189 5:129264431-129264453 ATAGGAAGGAAGAATCTGGAGGG - Intergenic
997153296 5:131523594-131523616 ATGGAGAGGAAAAAAGGTGAAGG + Intronic
997259157 5:132452501-132452523 GGAGAGAGGAAAAGTGGGGATGG - Intronic
997719453 5:136065952-136065974 AAGGAGAGGAAGAAGGGGAATGG + Intergenic
998307439 5:141093561-141093583 ATAGCTAGGAAGAAGAGGGAGGG - Intergenic
998448387 5:142215991-142216013 TTAGAGAGGAAGGATTGAGAGGG - Intergenic
998584722 5:143415268-143415290 AAAGAGGGGAATAATGGGGTGGG - Intronic
998620413 5:143788454-143788476 AAAGAAAAGAAGAATGGGGAAGG + Intergenic
998630992 5:143898475-143898497 AGAGAGAGGAAGAGAGGGAAGGG - Intergenic
999037853 5:148373609-148373631 ATAGGGACTGAGAATGGGGAGGG - Intergenic
999039712 5:148393955-148393977 GGAGAGAGGAGGAATGGAGAGGG - Intronic
999124084 5:149233715-149233737 ATAAAGAGGCAGAAAGGAGAAGG + Intronic
999255977 5:150210235-150210257 AGAGAGAGGAAGAAGAGGGCAGG + Exonic
999525333 5:152399305-152399327 TTAAAGACTAAGAATGGGGAAGG - Intronic
999541363 5:152576023-152576045 ATGGTGAGGAGGAATGGGAAGGG + Intergenic
999719562 5:154388918-154388940 AGAGAGAGAAGGAGTGGGGAGGG + Intronic
999798518 5:155010651-155010673 AGAGAGAGGAAGAAGAGAGAAGG - Intergenic
999827308 5:155286168-155286190 AGAGAATGGAAGAAGGGGGAGGG - Intergenic
999914923 5:156248134-156248156 AGAGAGAGAGAGAATGGGAATGG + Intronic
999969373 5:156843917-156843939 ATTGAGAGTGAGGATGGGGAAGG + Intergenic
1000064055 5:157680179-157680201 ATAGAGGGGATGCATGGGCAAGG - Intergenic
1000839020 5:166193129-166193151 ATGCAGATTAAGAATGGGGAAGG + Intergenic
1000909791 5:167008037-167008059 GTAGAGAAGAGGAACGGGGAAGG - Intergenic
1000932708 5:167271195-167271217 ATGGTGAGGAGGAGTGGGGAGGG + Intergenic
1000966472 5:167663118-167663140 AGAGACAGAGAGAATGGGGATGG + Intronic
1001229283 5:169971807-169971829 TTAGAGGGGAAGAATATGGAAGG - Intronic
1001296037 5:170499729-170499751 ACAAAGAGGAAGAAAGGAGAGGG + Intronic
1001469541 5:172001099-172001121 ATAGAGAAGAAAGATGGGGAGGG - Intronic
1001570353 5:172726828-172726850 TTAGACTGGAAGATTGGGGAAGG - Intergenic
1001786539 5:174418709-174418731 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1001800780 5:174542253-174542275 AGAGAGAGAAAGAAAGGGAAAGG + Intergenic
1001977908 5:176015454-176015476 AGAGGGAGGAAGGATAGGGAAGG - Intronic
1002239512 5:177828308-177828330 AGAGGGAGGAAGGATAGGGAAGG + Intergenic
1002742620 5:181444741-181444763 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002742635 5:181444790-181444812 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1002867169 6:1131702-1131724 ATAGAGAGGAGGAGAGGGAAGGG - Intergenic
1002890371 6:1326697-1326719 AGAGAGAGGAAGTGAGGGGAGGG - Intergenic
1002935921 6:1672293-1672315 ATGGAGTGGAAGAACAGGGAAGG + Intronic
1003377403 6:5592691-5592713 ATAGCCAGTAAGAATGGGGAAGG + Intronic
1003436415 6:6092646-6092668 AGAGAGAGAAAGAAAGGTGAAGG + Intergenic
1003634438 6:7819542-7819564 AGAGAAAGGAAGAAAGGGAAGGG + Intronic
1003698734 6:8439027-8439049 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1003737770 6:8896814-8896836 AGAGAGAGGAAAAAAGAGGAAGG - Intergenic
1004526464 6:16413068-16413090 TTAGAAATGAAGAAAGGGGAAGG + Intronic
1004755630 6:18607737-18607759 CAAGAGAGGAAGAAGGGAGAAGG + Intergenic
1004765267 6:18719810-18719832 ATAAAGAGGAAGATTGGGCCCGG - Intergenic
1005254332 6:23983923-23983945 ACAGAGAGAGAGAATGGGAAGGG + Intergenic
1005585111 6:27268743-27268765 AGAAAGAGGAAGATTGTGGACGG + Intergenic
1006207001 6:32355386-32355408 ATAGAGAGGGAAAAAAGGGAGGG - Intronic
1006337702 6:33428988-33429010 GTAAAGAGGAAAAGTGGGGAGGG + Intronic
1006564421 6:34942834-34942856 AAAGAAAAGAAGGATGGGGAGGG - Intronic
1006732819 6:36248954-36248976 CTAGAGAGGCCCAATGGGGAAGG + Intronic
1006761285 6:36463881-36463903 ATTGAGAGGGAAAAAGGGGAAGG + Intronic
1006860571 6:37169733-37169755 CGAGGGAGGAAGGATGGGGAGGG - Intergenic
1007057549 6:38902732-38902754 ATAGAGAGGAAGACTCAGCAGGG + Intronic
1007481365 6:42152315-42152337 GTAGAGAGGTAAAATGGGGTGGG + Intergenic
1007524184 6:42476776-42476798 GTAGAGAAGAAGAATGAGGCTGG - Intergenic
1007594526 6:43043346-43043368 AGGGAGGGGAAGGATGGGGATGG + Intronic
1007665717 6:43511894-43511916 ATAAAGAGGAAGGAAGGGGTAGG + Exonic
1007756486 6:44102857-44102879 ATAGTGAAGGAGAATGGGGTAGG - Intergenic
1007840039 6:44708611-44708633 AAAGACAGGAAGAATGAGGTAGG - Intergenic
1007949741 6:45860654-45860676 CTAATGAGGAAGAATGAGGATGG + Intergenic
1007977136 6:46113308-46113330 CTAGAGAGTAAGAAGTGGGAAGG + Intergenic
1007985904 6:46206617-46206639 AGAGAGAGGAAAAAAGGGCAGGG + Intergenic
1008162134 6:48091632-48091654 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1008229403 6:48965846-48965868 ATTTAGTGAAAGAATGGGGAGGG + Intergenic
1008291468 6:49721414-49721436 AGAGAGAGAAAGTAAGGGGAAGG + Intergenic
1008880819 6:56378500-56378522 AGAGGAAGGAAGAATGGGAAGGG + Intronic
1009552570 6:65118021-65118043 AGTACGAGGAAGAATGGGGAAGG + Intronic
1009782879 6:68293066-68293088 AGGAAGAGGAAGAATGGGGAGGG + Intergenic
1010716611 6:79237528-79237550 AGAGAGAGGGAGAAGGGAGAAGG + Intergenic
1010731364 6:79394928-79394950 AAAGTGAGGGAGAATGTGGATGG + Intergenic
1010977522 6:82332537-82332559 ATAGAGAAGAAGAAGGGAGAAGG - Intergenic
1010995822 6:82531313-82531335 ATAGAGAGGAAGAAAGGTAGGGG + Intergenic
1010998962 6:82565622-82565644 ATAGAGAGGAAGAGTAATGATGG - Intergenic
1011152502 6:84289948-84289970 GTAGAAAGGAAATATGGGGAGGG - Intergenic
1011888316 6:92125768-92125790 GGAGAGAGGCAGAATGGGGTGGG - Intergenic
1011894546 6:92208714-92208736 AGAGAAAGGAGGAGTGGGGAAGG - Intergenic
1012066799 6:94558946-94558968 ATAGTGAGGAAGGTTGGAGAAGG + Intergenic
1012915447 6:105165512-105165534 ATAGAGAGTGAGAAGGGAGAAGG - Intronic
1013036543 6:106390381-106390403 AGAGAGAGGAGGGAAGGGGAGGG - Intergenic
1013269631 6:108533998-108534020 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269643 6:108534054-108534076 AGAGAGAGGAAGGAAGGGGAAGG + Intergenic
1013269662 6:108534225-108534247 AGAGAGAGAAAGAAAGAGGAAGG + Intergenic
1013290993 6:108718724-108718746 TAAGAGAGGAAGAAGAGGGAAGG + Intergenic
1013826063 6:114213095-114213117 ATGGAGAGCTAGAAAGGGGATGG + Intronic
1013878096 6:114858506-114858528 CTACAGAGGAAGAAGGGGGTGGG + Intergenic
1013892771 6:115044892-115044914 ATTGAGAGGAAGCATGGAAAGGG - Intergenic
1014117503 6:117682191-117682213 AGACAGAGTAAGACTGGGGATGG - Intronic
1014184492 6:118419792-118419814 ATAGAGAGGAAGGGGAGGGAGGG - Intergenic
1014411079 6:121122044-121122066 ATTGAGAGGAAGAATAGGAAAGG - Intronic
1014761306 6:125359741-125359763 AGAGAGAGGGAGAAGAGGGAGGG + Intergenic
1014908555 6:127061098-127061120 AGGGAGAGGAAAAATGGGTAAGG + Intergenic
1015433642 6:133159891-133159913 ATACACAGGAGCAATGGGGAAGG + Intergenic
1015553005 6:134431619-134431641 ATAGGGAGTAAGAAGGAGGACGG + Intergenic
1016060417 6:139624002-139624024 ATAGTGAGAAAGACTGAGGAAGG + Intergenic
1016098281 6:140065155-140065177 AAAGACAGGAAGAAAGGGAAGGG + Intergenic
1016444128 6:144115786-144115808 GTAGTGAGGAGGAGTGGGGATGG - Intergenic
1016882749 6:148927177-148927199 AGAGAGAGAGAGAAAGGGGAGGG + Intronic
1016991635 6:149933764-149933786 ATGGAGAGGAAGAGTGGGAAGGG + Intergenic
1017388666 6:153914243-153914265 AGAGAGAGAAAGAGTGGGGATGG + Intergenic
1017447210 6:154517800-154517822 AAAGAAAGGAAGGAAGGGGAGGG + Intergenic
1018986382 6:168640346-168640368 ATGGAGAGGAAGCATGGGGCAGG + Intronic
1019178610 6:170173796-170173818 AGGGAGAGGAAGAAGGGGCAGGG + Intergenic
1019247755 6:170720480-170720502 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019247770 6:170720529-170720551 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1019327638 7:446120-446142 AGAGGGAGGAAGAAGAGGGAGGG + Intergenic
1019416957 7:932256-932278 CTGGAGAGGAAGGCTGGGGAGGG - Intronic
1019551887 7:1607138-1607160 AGAGAGAGGAAAGATGGGGTGGG - Intergenic
1019557770 7:1641177-1641199 AGATAGGGGAAGACTGGGGAAGG - Intergenic
1019580901 7:1762046-1762068 ATAGAAAGGAATAATGAAGAGGG - Intergenic
1020011514 7:4808087-4808109 GAAGAGAGGAAGAAGGAGGAGGG - Intronic
1020546491 7:9539881-9539903 AGAGAGAGAGAGAATGGGGGAGG - Intergenic
1020746194 7:12080749-12080771 AAAGAGTGGAAGCTTGGGGAAGG - Intergenic
1021108841 7:16671191-16671213 AAGGACAGGAAGTATGGGGATGG - Intronic
1021132503 7:16928191-16928213 TTAGAGAGGAAAAATGATGATGG - Intergenic
1021362096 7:19728183-19728205 AGAGAGAGAAAGAAAGAGGAGGG - Intronic
1021974065 7:25994842-25994864 CAAGAGAAGAAGAAAGGGGAAGG + Intergenic
1022320885 7:29286533-29286555 AATGAGAGGAAGAAAGGGTAAGG - Intronic
1022554277 7:31276220-31276242 ACAGGGAGGAAGAGTGGGAAAGG + Intergenic
1022773415 7:33499153-33499175 ATAGAGGGGAAGAAGTGGCATGG + Intronic
1023021662 7:36016952-36016974 AGAGAGAGGCAGGATGGGGCTGG - Intergenic
1023210785 7:37802834-37802856 AGAGAGAGAAAGAAAGGGAAGGG - Intronic
1023615171 7:42012381-42012403 AGAGAGAAGAAGAAAAGGGAGGG - Intronic
1024104344 7:46067032-46067054 AGAGAGATGAAGAATGGGGAGGG - Intergenic
1024534727 7:50420599-50420621 AGAGAGAGAAAGAAAGGGGGTGG - Intergenic
1024867172 7:53917008-53917030 GTAGAGAAGAATAATGGTGATGG + Intergenic
1024937250 7:54722831-54722853 AAAGAGAGAAAGAAAGGGGAGGG - Intergenic
1024985408 7:55189613-55189635 ATAGAGAGGGAGAAAGGGAGAGG + Intronic
1025111452 7:56220129-56220151 AAAGAGAGGAAGGAGGAGGAGGG + Intergenic
1026101275 7:67386445-67386467 ATAGAAAGGAAACAAGGGGAGGG + Intergenic
1026220633 7:68393296-68393318 ATTGAGAGGAAGATGAGGGAAGG - Intergenic
1026529553 7:71185148-71185170 ACAGAGAGGAAGGAAGGGGAGGG - Intronic
1026837580 7:73648645-73648667 AGAGAGAGAAAGAAAGAGGAGGG - Intergenic
1026927525 7:74204424-74204446 AGAGGGAGGAAGAAAGGGAAAGG + Intronic
1027828290 7:83144994-83145016 AGAGAGAGAAAGAATAGGAAAGG + Intronic
1027970825 7:85078846-85078868 CTAGAGAGGAAGAAGGAGAAAGG + Intronic
1028165835 7:87537549-87537571 ATATAGGGGAAGAGTGGGTAAGG + Intronic
1028251624 7:88545011-88545033 AAAGAAAGGAAGAAAAGGGAAGG - Intergenic
1028573959 7:92325220-92325242 ATATAGACTAAGAGTGGGGAAGG - Intronic
1028944647 7:96563313-96563335 ATTGAGAGTGAGGATGGGGAGGG + Intronic
1029233382 7:99090494-99090516 ACAGAGAGGAGGAGTGGGAAAGG + Intronic
1029310958 7:99663804-99663826 ATAAAGAAGGAGATTGGGGAAGG - Intronic
1029392203 7:100282631-100282653 AGAGAAAGAAAGAAAGGGGAGGG - Intergenic
1029646605 7:101860788-101860810 AGAGAGAAGAAGAGAGGGGAAGG - Intronic
1029843970 7:103394179-103394201 AAACAGAGGAAGAAAGGGAAAGG + Intronic
1030539643 7:110814188-110814210 CCAGAGAGGAAAACTGGGGATGG - Intronic
1031010295 7:116519634-116519656 AAAGAGGGGAAGATTAGGGAAGG + Intergenic
1031014899 7:116562875-116562897 AAAGAGAGAAAGAAAGAGGAAGG + Intergenic
1031503933 7:122557523-122557545 ATCCTGAGGCAGAATGGGGAGGG + Intronic
1031538760 7:122967119-122967141 ATAGAGAGGAGAAAAGGAGAGGG - Intergenic
1031910919 7:127515902-127515924 ACAGAGATAAAGAATGGGGGAGG - Intergenic
1032199299 7:129808127-129808149 ATAGAGAAGAGGGAAGGGGAGGG - Intergenic
1032355953 7:131210719-131210741 AAAGAGAGAGAGAAAGGGGAAGG + Intronic
1032954823 7:136958767-136958789 GTTGAGAGTAAGAATGGGTAAGG + Intronic
1033200212 7:139361610-139361632 GTAGAGAGGAAAGATTGGGAAGG + Intronic
1033259347 7:139829203-139829225 ATAAAGAGGAAGGAAGAGGAGGG - Intronic
1033348378 7:140542500-140542522 AGAGAGAGGAAGATGGGGGAGGG - Intronic
1034059148 7:148069778-148069800 AAAGAAAGAAAGAATGGGGAGGG + Intronic
1034302940 7:150032031-150032053 ATAGACCGGAAGAAGGGGCAAGG - Intergenic
1034440900 7:151085789-151085811 ACATAGAGGAAGAAGAGGGAGGG - Intergenic
1034532418 7:151704657-151704679 AGAGAGATGAGGAAAGGGGAGGG + Intronic
1034803107 7:154065237-154065259 ATAGACCGGAAGAAGGGGCAAGG + Intronic
1035100189 7:156389832-156389854 AGAGAGAGGAAGAAGGCTGAGGG - Intergenic
1035500348 8:87334-87356 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500366 8:87407-87429 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035500381 8:87456-87478 ATGGAGAGGGAGAAAGGAGAGGG - Intergenic
1035724462 8:1815950-1815972 AAAGAAAGGAAGCATGGGGGAGG + Intergenic
1035861778 8:3036959-3036981 ATAGATAGGAAGATGGGTGAGGG - Intronic
1036134772 8:6150645-6150667 AGAGAGAGAAAGAAAGGGAAAGG + Intergenic
1036181836 8:6592524-6592546 AGAGAGAGGAAGAATGGAATTGG - Intronic
1036187548 8:6637297-6637319 ATAGAGAGGAGGAGTGAGGTAGG + Intronic
1036556535 8:9864881-9864903 GCAGAGAGGAAGGATGGAGAAGG - Intergenic
1037469627 8:19194680-19194702 ATAAAGAAGAAGAATGACGAGGG + Intergenic
1037874132 8:22530535-22530557 ATAAAAAGGAAGAATGGGCCGGG + Intronic
1037894905 8:22645503-22645525 ACAGAAGGGAAGAAAGGGGAAGG + Intronic
1038162482 8:25053004-25053026 TTAGCCAGGCAGAATGGGGAAGG - Intergenic
1038328141 8:26587884-26587906 ATAGAGGGGAAGACTGAGGCCGG + Intronic
1038531348 8:28320299-28320321 AATGAAAGGATGAATGGGGAAGG - Intronic
1039220605 8:35326376-35326398 TTAGAAAGGAAGGAAGGGGAAGG + Intronic
1039639913 8:39207690-39207712 AGAGAGAGGAAGACTGGGAGAGG - Intronic
1039763358 8:40601520-40601542 AGAAAGAGGGAGAAAGGGGAAGG + Intronic
1039839406 8:41283101-41283123 AAAGAGAGGAAGAAACAGGATGG - Intronic
1039987687 8:42461768-42461790 AGAGAGAGAAAGAAAGTGGAGGG - Intronic
1040602361 8:48897362-48897384 ATGGGGAGCAAGAAGGGGGATGG + Intergenic
1040629265 8:49190808-49190830 AAAGAAAGGGAGAGTGGGGAGGG - Intergenic
1041051975 8:53943165-53943187 AAAGAGAGGAAGAAATGAGATGG + Intronic
1041166552 8:55098136-55098158 GGGGAGAGTAAGAATGGGGAAGG + Intergenic
1041365531 8:57099613-57099635 ATAGAGGGGAGGAAAGGAGATGG - Intergenic
1041521986 8:58767256-58767278 AAAGAGAGGAAGGATAGAGAGGG + Intergenic
1041539431 8:58966487-58966509 ATGGAGAGGAAGAATGGCCTGGG + Intronic
1042074867 8:64981282-64981304 GTAGTGAGGAAGAATGGGGAGGG + Intergenic
1042224375 8:66504125-66504147 GTGGGGAGGGAGAATGGGGAGGG - Intronic
1042458304 8:69031381-69031403 ATAGAGAGGAAGAAAGGAGGAGG + Intergenic
1042601726 8:70505622-70505644 ATAAAGAGGGAGGAAGGGGAAGG - Intergenic
1043009279 8:74861709-74861731 AGACAGAGGAAGAACAGGGAGGG + Intergenic
1043238762 8:77903637-77903659 ACATAGAGGAAAAAAGGGGATGG - Intergenic
1043390940 8:79790995-79791017 AGAGAGAGAGAGAATGTGGAAGG + Intergenic
1043410802 8:79992380-79992402 ATAGAGAGGGAGTGTTGGGATGG - Intronic
1043438195 8:80254383-80254405 ATAGAGGAGAAGAATGAGGGTGG + Intergenic
1043914169 8:85901220-85901242 ATCATCAGGAAGAATGGGGAAGG - Intergenic
1044319486 8:90786455-90786477 AAAGAGAACAAGAATGGGAAGGG + Intronic
1044454048 8:92370875-92370897 ATGGAGAGGAAGGACTGGGAAGG + Intergenic
1044516365 8:93143320-93143342 AGAGAGAGAAAGAAAGAGGAAGG - Intronic
1044906520 8:97009802-97009824 GTACAGTGGAAGAATGGAGACGG + Intronic
1045430757 8:102112840-102112862 CCAGAGAGGAAGCAAGGGGAGGG - Intronic
1045546151 8:103130524-103130546 ATAGAGAGAGAGAAAGAGGATGG - Intergenic
1046032279 8:108797544-108797566 ATAGTGGGGAAGGATGGGGAGGG - Intergenic
1046105048 8:109655018-109655040 CTAGAGAGATAGGATGGGGAAGG - Intronic
1046527547 8:115399787-115399809 ATAGAGATAAATAATGGGTAGGG + Intergenic
1046538392 8:115547300-115547322 AGAGAGAGGGAGAAAGGGAAGGG - Intronic
1046956286 8:120066046-120066068 ATTGTGAGTAAAAATGGGGAAGG - Intronic
1047631012 8:126708577-126708599 ATTGAGAGGGAAGATGGGGAAGG - Intergenic
1047640903 8:126820878-126820900 TTGGAGAGGAAGAAGGGAGATGG + Intergenic
1047980807 8:130180011-130180033 AGAGAGAGAAAGAAAGGAGAGGG + Intronic
1048161871 8:132028777-132028799 AAAGAGAGGAAGAAAGAAGAAGG + Intronic
1048833554 8:138497744-138497766 AGGGAGAGGAAGATTGGGGAGGG + Intergenic
1049350591 8:142162443-142162465 AAAGAGATGAAGATGGGGGATGG + Intergenic
1049465806 8:142750796-142750818 GGAGAGAGGAAGGAAGGGGAGGG + Intronic
1049904431 9:202880-202902 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1050066036 9:1760277-1760299 GTAGTGGGGAAGAATGGGCATGG + Intergenic
1050348727 9:4719341-4719363 AAAGAAAGGAAGTATGGGGTGGG + Intronic
1050568684 9:6914744-6914766 AGAGATAGAAGGAATGGGGAAGG - Intronic
1050606154 9:7303525-7303547 AAGGAGAGGAAGAAGGGAGAGGG + Intergenic
1050968526 9:11839235-11839257 ATAGAGATGAAAAAATGGGAGGG + Intergenic
1051106509 9:13587024-13587046 AGAGAGAAGGAGAATGGGGAGGG - Intergenic
1051109485 9:13619583-13619605 ATAGTCAGGAAGAAGGGGAAGGG - Intergenic
1051388930 9:16542382-16542404 AGAGAGAAGAAGATGGGGGAGGG + Intronic
1051480417 9:17554036-17554058 AAAGAGAGAGAGAAAGGGGAGGG - Intergenic
1051794284 9:20847214-20847236 AGAGAGATGAAGGATTGGGAAGG - Intronic
1052057219 9:23919370-23919392 ATAGAGAGGAATATTGAGTATGG + Intergenic
1052282256 9:26746832-26746854 ACAGACCGGAAGAATGCGGATGG - Intergenic
1052334335 9:27304239-27304261 ATTCCGAGGAAGAATGGGGAAGG + Intergenic
1052551488 9:29955834-29955856 ATGGAGACTCAGAATGGGGAGGG - Intergenic
1053148015 9:35725105-35725127 ATAGGAAGAAAGCATGGGGAGGG + Intronic
1053727003 9:41014454-41014476 ATAGGGAAGAAAAATGAGGAAGG + Intergenic
1054706313 9:68466030-68466052 CAAGAGACAAAGAATGGGGAAGG - Intronic
1054762565 9:69016073-69016095 TTAGAGAGGAAGAAGAGGAAAGG + Intergenic
1055056311 9:72027512-72027534 ATAGAGCGGATGAATAGGCAAGG + Intergenic
1055074237 9:72197286-72197308 ATAGAGAGGCAGCAGGGAGAGGG - Intronic
1055716025 9:79119047-79119069 CTAGAGAGAAAGAATTGGCAGGG - Intergenic
1056422501 9:86442979-86443001 AGAGAGAGAAAGAAAGAGGAAGG - Intergenic
1056499407 9:87193070-87193092 AGAAAGAGGGAGAATGGGCAGGG + Intergenic
1056688032 9:88782848-88782870 CTGGAAATGAAGAATGGGGAAGG + Intergenic
1057168741 9:92948100-92948122 AGAAATGGGAAGAATGGGGAAGG - Intronic
1057226740 9:93296700-93296722 ATAGAGAGGGAGGAAGGTGAGGG - Intronic
1057226804 9:93296909-93296931 CGAGGGAGGTAGAATGGGGAGGG - Intronic
1057367987 9:94442054-94442076 ATACAGAGGAAGACGGGAGAAGG - Intronic
1057932778 9:99210690-99210712 AGAGAGAGAAAGAAAGGGGAAGG - Intergenic
1058090814 9:100803588-100803610 GCAGAGAGGAAGAACGTGGAAGG - Intergenic
1058144973 9:101400433-101400455 ATTGAGACAAAGGATGGGGAAGG - Intronic
1058328515 9:103728190-103728212 ATAAAAAGGAAGAGTGGGAAGGG - Intergenic
1058961424 9:109995900-109995922 ATGGAGAGGAAGGATGAGGCAGG + Intronic
1059054101 9:110960688-110960710 AGAGAGAGGAAGAAATGGGAGGG + Intronic
1059141661 9:111858722-111858744 AAAGAGAGGAATAATGAGGCTGG + Intergenic
1059164032 9:112061935-112061957 TTAGAGAGGAAGATTGAGGTTGG - Intronic
1059266032 9:113031470-113031492 ATGGAGATGGAGAATGGTGATGG + Intergenic
1059366363 9:113789539-113789561 AGAGAGAAGAAGAAGGAGGAGGG - Intergenic
1059453254 9:114383905-114383927 GTAGAGAGGAAGACTGGGCGGGG - Intronic
1059612039 9:115908895-115908917 ATGGAGAGGCAGATTGGAGAGGG + Intergenic
1059775081 9:117466113-117466135 ATAGAGAGGAAGAAGGAGGGAGG + Intergenic
1059840734 9:118212686-118212708 ATAGAGATGAGGGTTGGGGAAGG + Intergenic
1060724282 9:125996963-125996985 GCAGAGAGCAAGAAGGGGGAAGG - Intergenic
1061195558 9:129105281-129105303 ATAGAAAGGAAAAAAGGGAAGGG + Intronic
1061275567 9:129568098-129568120 TTGGAGAGGAAGAGTGGGGAGGG - Intergenic
1061318768 9:129814712-129814734 GCAGAGAGGCAGAGTGGGGAAGG + Intronic
1061650389 9:132043405-132043427 GGAGAGAGGGAGAATGAGGAGGG + Intronic
1061942718 9:133891861-133891883 ATGGAGGGGAGGCATGGGGATGG + Intronic
1062143711 9:134976649-134976671 AAAGAGAGAAAGAAAGAGGAAGG - Intergenic
1062192939 9:135257040-135257062 ATAGAGAGGGAGAAAGGGAGAGG - Intergenic
1203694738 Un_GL000214v1:87531-87553 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203704812 Un_KI270742v1:29901-29923 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1203559192 Un_KI270744v1:35910-35932 AGAGAAAGAAAGAATGAGGAGGG - Intergenic
1203608526 Un_KI270748v1:75960-75982 ATGGAGAGGGAGAAAGGAGAGGG + Intergenic
1203641535 Un_KI270751v1:16532-16554 AGAGAAAGAAAGAATGAGGAGGG + Intergenic
1185472169 X:390535-390557 ATAAAAAGCGAGAATGGGGAGGG + Intergenic
1185554817 X:1012977-1012999 AGAGAGAGGGATACTGGGGAGGG - Intergenic
1185683974 X:1911695-1911717 AGAGAGAGGAAGAGAGAGGAGGG - Intergenic
1185716444 X:2346602-2346624 ACAAACAGGAAAAATGGGGAGGG - Intronic
1185780325 X:2838448-2838470 AGAGAGAGGAAGGGAGGGGAGGG - Intronic
1185999789 X:4995914-4995936 AGAGAGAGAGAGAAAGGGGAAGG - Intergenic
1186979273 X:14941481-14941503 ATTGATAGGAACAATGGGGCTGG + Intergenic
1187001278 X:15181637-15181659 AAAGACAGGAAAAATGGGCAAGG + Intergenic
1187254748 X:17632145-17632167 AAAGAGAAGGAGAATGTGGAAGG + Intronic
1187765954 X:22642317-22642339 AGGTAGAGGAACAATGGGGATGG - Intergenic
1187775426 X:22751242-22751264 AGAGGGAGCAAGAAAGGGGAGGG + Intergenic
1187973275 X:24679949-24679971 ATGGAGAAGAGGAAAGGGGAAGG - Intergenic
1188259882 X:28009647-28009669 AGAGAGAGGAAGAATAGAGAAGG + Intergenic
1188344631 X:29048619-29048641 ATAGAGAGGAAAATTAGGGAAGG + Intronic
1188372532 X:29386409-29386431 ATTGAGAGGCAAACTGGGGAAGG - Intronic
1188732953 X:33674554-33674576 CTTGGGAGGAAGAGTGGGGATGG - Intergenic
1188909707 X:35831634-35831656 ACAGAGTGGTAGAATGAGGAAGG - Intergenic
1189038692 X:37519312-37519334 ATAGAGGGGAAAAATGAGAAAGG - Intronic
1189158538 X:38785715-38785737 ACAGAGAGAAACAAAGGGGAAGG + Intergenic
1189194916 X:39144813-39144835 GTAGAGGGGAAGAAGGGGAAAGG + Intergenic
1189689624 X:43602425-43602447 ATAGAGAGCAAGAGTGCAGATGG - Intergenic
1189943962 X:46157853-46157875 ATCATGAGGAAGAATGGGAAAGG - Intergenic
1190436695 X:50432866-50432888 ATAGAAAAGAAGAAGGGGGGAGG - Intronic
1190497026 X:51036529-51036551 AAAGACTGGAAGAATGGGGAGGG - Intergenic
1190626511 X:52343068-52343090 AGAGAGAGGCAGAAAGGGGAAGG + Intergenic
1190627610 X:52351986-52352008 AAAGAGAGGAGGAAGGAGGAAGG - Intergenic
1190723651 X:53172099-53172121 AAAGAGAGGAAGAAGAGGGAGGG + Intergenic
1191591182 X:62887380-62887402 AGAGGGAGGAAGAAAGGGGAAGG - Intergenic
1191593349 X:62913216-62913238 GCAGAGAGGAAGATTGGTGAAGG + Intergenic
1191641784 X:63434341-63434363 ACAGAGAGGAAAGAGGGGGAAGG + Intergenic
1191842404 X:65522625-65522647 ATAGAGAGGAAGCAAGGTCAAGG + Intronic
1192243871 X:69357624-69357646 AAAGAGAGGAGAAAGGGGGAAGG + Intergenic
1192831213 X:74752463-74752485 ACAGAGAGAAAGAAAAGGGAAGG - Intronic
1192985992 X:76398819-76398841 TTAGAAAGAAAGAATGGGGGTGG + Intergenic
1193053134 X:77122878-77122900 ACAGAGAACAAGAATGGGAATGG + Intergenic
1193207309 X:78764484-78764506 AGAGAAAGCAAGAAGGGGGAGGG - Intergenic
1193601538 X:83512572-83512594 ATGGAGAGGAAGAAGAAGGATGG - Intergenic
1193739756 X:85203280-85203302 CCAGTGAGGAAGAATGGGAAAGG + Intergenic
1194668041 X:96697184-96697206 ATAGCCAGCAAGAATGGGCAGGG + Intronic
1194946371 X:100073393-100073415 ATAGAGCAGAACATTGGGGAAGG + Intergenic
1195514954 X:105763539-105763561 ATAGAGAGGAAGAATGGGATAGG + Intronic
1195554127 X:106201825-106201847 AAAGATAGGAAAAATAGGGATGG + Intronic
1195557202 X:106240810-106240832 AGAGAGAGGAAGAAGTGGGAGGG + Intergenic
1196338045 X:114562174-114562196 ATGGAGATGAATATTGGGGATGG + Intergenic
1197260474 X:124312064-124312086 GTAAAGAGGAAGAAAGGGGATGG + Intronic
1197314632 X:124949694-124949716 CTAGAGGGGAAGAATGGGTTTGG + Intronic
1197359493 X:125482466-125482488 AAAGATAGGAAGCATGTGGATGG + Intergenic
1197878665 X:131140453-131140475 ATAGAGAGAGAGAAGGGGAAGGG + Intergenic
1197986125 X:132268327-132268349 AATGTGAGGAAGAATGGAGACGG - Intergenic
1198113484 X:133523114-133523136 TTCAAGAGGAAGAATGTGGAAGG + Intergenic
1198121170 X:133593796-133593818 ATAGAAAGGAAGGATTGGGCTGG + Intronic
1198130673 X:133691604-133691626 AGAGAAAGGAAGAAAAGGGAGGG - Intronic
1198381566 X:136088742-136088764 AAAGAAAAGAAAAATGGGGAGGG - Intergenic
1199029684 X:142982065-142982087 GGGGACAGGAAGAATGGGGAGGG - Intergenic
1199506041 X:148562720-148562742 AAAGAGAGGAAGAGAGAGGAAGG - Intronic
1199598817 X:149528482-149528504 AGAGAGAGGAAGAGAGGGAAGGG - Intronic
1199598883 X:149528751-149528773 AGAGAGAGGGAGAAAGAGGACGG - Intronic
1199780346 X:151052427-151052449 AGAGAGAGGAAGCAGGTGGAAGG - Intergenic
1200136498 X:153877633-153877655 AAAGAGAGAAAGAATGGGGAAGG + Intronic
1200585284 Y:5000222-5000244 ACAGAGGGGGAGAAAGGGGAAGG - Intronic
1200751136 Y:6945243-6945265 AAAGGGAAGAAGAATGGGAAAGG - Intronic
1201339822 Y:12922726-12922748 ATAGGGAGCCAGAAAGGGGATGG + Intergenic
1201593641 Y:15641935-15641957 ATTGAGATGGAGAGTGGGGAGGG + Intergenic
1201741091 Y:17325416-17325438 GGAGAGAGGAAGAGAGGGGAGGG + Intergenic