ID: 961116102

View in Genome Browser
Species Human (GRCh38)
Location 3:124331484-124331506
Sequence GGTAATGTATGTAATGCACT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 364
Summary {0: 1, 1: 1, 2: 9, 3: 55, 4: 298}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961116100_961116102 6 Left 961116100 3:124331455-124331477 CCAACAAAAATTTAAAAAAATAA 0: 5
1: 38
2: 243
3: 1584
4: 8317
Right 961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG 0: 1
1: 1
2: 9
3: 55
4: 298
961116099_961116102 7 Left 961116099 3:124331454-124331476 CCCAACAAAAATTTAAAAAAATA 0: 1
1: 8
2: 59
3: 630
4: 4617
Right 961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG 0: 1
1: 1
2: 9
3: 55
4: 298

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961116102 Original CRISPR GGTAATGTATGTAATGCACT TGG Intronic
902189111 1:14748738-14748760 GGCAATGTATGTGAAGCTCTTGG + Intronic
902438598 1:16414544-16414566 GATAATGTAAATAATGCACTTGG + Intronic
903252431 1:22065592-22065614 GGTAATGTATATAAAGCAACTGG - Intronic
903470558 1:23584236-23584258 GGAAATGTATGTAATGTATATGG + Intronic
903551372 1:24159246-24159268 GGTCATGTATGTGAAGCACTCGG - Intronic
904273183 1:29363618-29363640 GTTAATATGTGTAAAGCACTTGG - Intergenic
904791470 1:33025263-33025285 GATCATGTATATAATGCACTTGG + Intronic
905400035 1:37694621-37694643 GTTAATGTATGTAAAACACTTGG - Intronic
906458462 1:46018913-46018935 GGTAAAGAATGTACTGCATTTGG - Intronic
906706581 1:47899474-47899496 GGCATTGTATGTAATGGAGTGGG - Intronic
907640714 1:56187268-56187290 GGTAATGTATTTTAATCACTGGG - Intergenic
907647640 1:56260147-56260169 AATAATGCATGTAATACACTTGG - Intergenic
908009841 1:59764786-59764808 GATAATGCATATAAAGCACTCGG + Intronic
908053129 1:60254796-60254818 AGTAATGTATGTCAAACACTGGG - Intergenic
909193146 1:72580554-72580576 GGAAGTGCATGAAATGCACTTGG - Intergenic
912857836 1:113187276-113187298 GAAAATGTATGTAAGGCATTTGG + Intergenic
912944915 1:114076812-114076834 GATAATGTATGTAAAGAATTTGG + Intergenic
913460255 1:119077975-119077997 ATTAATATATGTAAAGCACTGGG - Intronic
913700810 1:121372785-121372807 GGTAATGTACGTAAAGCCCATGG + Intronic
914041360 1:144053247-144053269 GGTAATGTACGTAAAGCCCATGG + Intergenic
914136725 1:144907239-144907261 GGTAATGTACGTAAAGCCCATGG - Intronic
914317277 1:146525207-146525229 GAAAATGCATGTAAAGCACTTGG + Intergenic
914497079 1:148208153-148208175 GAAAATGCATGTAAAGCACTTGG - Intergenic
916018075 1:160768103-160768125 GGAAATGAATGAAATTCACTGGG - Intergenic
916067440 1:161147745-161147767 GGAAATGTAGGCAATGCAATAGG - Intergenic
916525786 1:165608094-165608116 AGTAATTCTTGTAATGCACTAGG - Intergenic
918266521 1:182847005-182847027 GGTAGTGTCTGAAATACACTGGG - Intronic
919765237 1:201122946-201122968 GGTAATGTATGTGAGCCACGTGG + Intronic
919859383 1:201729339-201729361 TATAGTGTATGTAATACACTTGG + Intronic
920061113 1:203227622-203227644 GTTAATATATGTAAAACACTCGG + Intronic
920333034 1:205225862-205225884 GGTAATATATGTAAAGCACTTGG - Intergenic
920488229 1:206391518-206391540 GGTAATGTACGTAAAGCCCATGG + Intronic
920600043 1:207315342-207315364 AATAATGTATGTAAAGCATTTGG - Intergenic
921792206 1:219302869-219302891 GCTAATGCATGTAATGCATTAGG - Intergenic
923552380 1:234974202-234974224 GGTAATGTATTTAACACACATGG - Intergenic
1063506122 10:6601279-6601301 CATAATAAATGTAATGCACTTGG - Intergenic
1063642909 10:7849109-7849131 GTTAATGTGTGTGAAGCACTTGG - Intronic
1066291893 10:34022018-34022040 AGTAATGTATCTAATGCCCTGGG + Intergenic
1067539366 10:47140606-47140628 GTTAATGTATGTAGGGCACCAGG - Intergenic
1068329637 10:55545913-55545935 GGGAATGGAAGTGATGCACTGGG + Intronic
1068499936 10:57832315-57832337 GATAATGTGTGTAAAGCATTTGG - Intergenic
1068548613 10:58381112-58381134 GATAATGTATGTAAAATACTTGG + Intergenic
1068615075 10:59105319-59105341 AATAATGTATGTAAAGCATTTGG + Intergenic
1069621234 10:69838470-69838492 GGAGATGTATGTAAAGCACGTGG + Intronic
1070260457 10:74849721-74849743 GATAATAAATGTAAAGCACTTGG - Intronic
1071229958 10:83574245-83574267 AGTAATGTATGTATAGCACTTGG - Intergenic
1071585708 10:86819024-86819046 GGTAATGCATGTAAAGCATTGGG + Intronic
1073446928 10:103586640-103586662 GTTAATGCATGTAATGCTGTTGG + Intronic
1075125952 10:119699055-119699077 GGTAATGCAGGTAAAGCACTTGG - Intergenic
1079523370 11:21355392-21355414 GGTAGTGCATGTAAAGCACTTGG - Intronic
1079796815 11:24813993-24814015 ATTAATGTTTGTAAAGCACTTGG + Intronic
1080711650 11:34753699-34753721 AATAATGTCTGTAAAGCACTTGG - Intergenic
1082937505 11:58670154-58670176 GATATTGTTTGTAATGTACTAGG - Intronic
1083265193 11:61543424-61543446 AGTAATCTCTGAAATGCACTGGG + Intronic
1083274356 11:61588310-61588332 GATAATGCGTGTTATGCACTTGG - Intergenic
1085132417 11:74052321-74052343 GATAATATATGTAAAGTACTTGG - Intronic
1085140510 11:74136611-74136633 GATTATGTATATAAAGCACTTGG + Intronic
1085187311 11:74586928-74586950 GTTAATATTTGTAAAGCACTTGG + Intronic
1085918513 11:80922233-80922255 GATAATATAAGTAAAGCACTGGG + Intergenic
1086030421 11:82348354-82348376 GGAAATGTATGTAATGAGCCTGG - Intergenic
1086212350 11:84335802-84335824 GGTAATGATTGTCATGAACTTGG + Intronic
1086406449 11:86503226-86503248 GTTAATCTATGTAGAGCACTTGG + Intronic
1086423439 11:86660414-86660436 AGTAATGTATGTAAAGCAGATGG - Intronic
1086881157 11:92155197-92155219 GGTAATACATATAAAGCACTAGG - Intergenic
1086943178 11:92819017-92819039 AATAATGTATCTAAGGCACTTGG - Intronic
1087068826 11:94054687-94054709 GGCAATGTGTGTGATGGACTGGG - Intronic
1088773580 11:113059853-113059875 GGTCATGTATGTAAAGCACTTGG + Intronic
1089180676 11:116581039-116581061 GGTCGTGTTTGTAAAGCACTTGG + Intergenic
1090202662 11:124867293-124867315 CATAATGTATGTAAAGCCCTTGG - Intronic
1091566645 12:1653704-1653726 TGTAATGTATGTAAAGCAGCTGG - Intergenic
1091907270 12:4199197-4199219 AATAATGTATGTAATGGACCTGG - Intergenic
1094168350 12:27465238-27465260 GGTAATATATGTAAAACACTTGG + Intergenic
1094320675 12:29179428-29179450 GGGAATGTATGTAAAGAACCTGG - Intronic
1094627537 12:32138342-32138364 GTTAATATATTTAAAGCACTTGG - Intronic
1095446168 12:42284683-42284705 AATAATGTATGTAATGTACATGG + Intronic
1095890225 12:47228900-47228922 GGTAATGTTGGTAAAGCACCTGG + Intronic
1096303644 12:50454603-50454625 GGTAATGCATGTAACAGACTTGG + Intronic
1096937616 12:55300544-55300566 TGCATTGTTTGTAATGCACTGGG - Intergenic
1097666047 12:62478219-62478241 GCTACTGTATGAAAGGCACTGGG + Intronic
1098363578 12:69679272-69679294 GATAACGTATATAAAGCACTTGG + Intronic
1098454242 12:70654166-70654188 GATAATATATGTAAAACACTTGG - Intronic
1099877408 12:88425757-88425779 GTTAATGTACGTAAAGCACTTGG + Intergenic
1100790139 12:98121112-98121134 GATAATGTATATAAAGCACTTGG + Intergenic
1101109182 12:101468945-101468967 GGGAATCTATGTAATGTGCTTGG - Intergenic
1101715375 12:107307181-107307203 GCTGATGTATTTCATGCACTTGG + Intergenic
1101796310 12:107977778-107977800 GAGAATGAATGTAAAGCACTTGG - Intergenic
1101967743 12:109292560-109292582 GTAATTGTATGTAAAGCACTTGG + Intronic
1104249023 12:127072140-127072162 GGTAATAAATGTAAAGCACTTGG + Intergenic
1105051556 12:133057025-133057047 GGTCATGAATGTGATGCATTTGG + Exonic
1107097949 13:36556851-36556873 GGTTGTGTTTGTAATGCACAGGG + Intergenic
1111439030 13:88253827-88253849 GGCAAATTATGTAAGGCACTGGG + Intergenic
1111452839 13:88441491-88441513 GGTAATGTATGTAGTGCTTGAGG - Intergenic
1113191199 13:107748738-107748760 GGAAATGCATGTACTACACTGGG + Intronic
1115102328 14:29717567-29717589 GTTAATATATGTGAAGCACTTGG + Intronic
1116055623 14:39860938-39860960 GGTCATGTATGTAAAGCTCCTGG + Intergenic
1118525157 14:66632193-66632215 GATAGTGTAAGTGATGCACTTGG + Intronic
1118782516 14:69018275-69018297 AATAATGTATGTAAAGCAGTTGG - Intergenic
1120000887 14:79302176-79302198 TGTAATATATGTAAAGCACCTGG - Intronic
1120414315 14:84200220-84200242 GGGAATATAAGTAATCCACTTGG + Intergenic
1120761196 14:88287006-88287028 GTTAATGCATGTAAAGCACTTGG - Intronic
1121399599 14:93661721-93661743 GATAATATATGTAAAGCACTTGG - Intronic
1125094971 15:35840109-35840131 GGTAATGTTTGTAACACACCTGG + Intergenic
1125386657 15:39144005-39144027 GGTAATATTTTGAATGCACTGGG - Intergenic
1125440478 15:39697432-39697454 CTTAATGTATGGAATGAACTGGG + Intronic
1125719816 15:41839923-41839945 GTTAATGTATGCAAAGCCCTTGG + Intronic
1128152810 15:65373785-65373807 AGTAATTCATGTAAAGCACTTGG + Intronic
1128801006 15:70496990-70497012 GATGATGCATGTAATGAACTTGG - Intergenic
1130723434 15:86412864-86412886 GATAATATATGTAAAGTACTTGG - Intronic
1130875665 15:88011926-88011948 GGTAATGTACGTAAGGGATTTGG - Intronic
1133859661 16:9582399-9582421 GGTCATGTAAGTGATGCACGTGG + Intergenic
1133907112 16:10032534-10032556 GTTAATTTATATAAAGCACTTGG - Intronic
1134385844 16:13771654-13771676 GGTAAGGTTTATAAAGCACTTGG - Intergenic
1134606642 16:15576540-15576562 GGAAATGAATGTAATGCCCTAGG - Intronic
1134838775 16:17384151-17384173 AATAATGTATGTAAAACACTTGG + Intronic
1135431577 16:22388275-22388297 GGTAATGTACACAATGCACTTGG - Intronic
1139345276 16:66298997-66299019 GATAATGTATGTAAATCACTTGG + Intergenic
1140001012 16:71024956-71024978 GTAAATGTATGTAATGAACATGG + Intronic
1140789814 16:78380685-78380707 GGCAATGTATCTAAAGCAGTTGG - Intronic
1140925302 16:79576765-79576787 GATAATGTATGTAAAGCACCTGG - Intergenic
1140925304 16:79576797-79576819 GGTAATGTATGTAAAGCACCTGG - Intergenic
1140970230 16:80005576-80005598 GATAATGAGTATAATGCACTTGG - Intergenic
1141817083 16:86418643-86418665 GTTAGTATATGTAGTGCACTTGG + Intergenic
1144317994 17:14082181-14082203 GGTAAGGTATATAATGGACCCGG + Intronic
1146523290 17:33543666-33543688 GGTAATGTACGTAAAGTACTTGG - Intronic
1146606146 17:34259331-34259353 GGAAATGAATGCATTGCACTTGG - Intergenic
1146629774 17:34461533-34461555 GGTAATTAATGTAATGCATTGGG - Intergenic
1147764255 17:42823126-42823148 AGTAATACGTGTAATGCACTTGG + Intronic
1148357052 17:46982464-46982486 GGTAATGTATTTAATGCACTGGG - Intronic
1149322417 17:55494978-55495000 GGCAATGTATGCAAAGCGCTTGG + Intergenic
1151858434 17:76739264-76739286 GACAATGCATGTAAAGCACTTGG + Intronic
1154380330 18:13843836-13843858 GGTAATGCATTTAAAGCACTTGG + Intergenic
1156102829 18:33619042-33619064 GGTAATTTATGTAAAGTCCTTGG - Intronic
1156322012 18:36035356-36035378 GATAATGTATGTAAAGTGCTTGG - Intronic
1156894699 18:42232426-42232448 AATAATGCATGTAAAGCACTTGG - Intergenic
1157815641 18:50727888-50727910 GATAATGTATGTTTGGCACTTGG + Intronic
1158230841 18:55252911-55252933 GGTAATGTGTTAAATACACTTGG - Intronic
1158248270 18:55456327-55456349 GGTAAATTATTTAATGCTCTGGG + Intronic
1158622616 18:59046214-59046236 GATAATGTATGTAAAGAACTTGG + Intergenic
1158738758 18:60114832-60114854 GGTAATTTATGTAAGGCAGGTGG + Intergenic
1163093424 19:15037138-15037160 GTTAATGTATCTAAAACACTTGG - Intergenic
1165380876 19:35479274-35479296 GATAATATATGCAAAGCACTTGG + Intergenic
1165480326 19:36059735-36059757 GGTAATGTCTGTCAGGCCCTAGG - Intronic
1167127933 19:47563951-47563973 GTTAATGCATATAAAGCACTTGG - Intergenic
1168629257 19:57944399-57944421 TGTAATGAATGATATGCACTTGG - Intronic
925242603 2:2345414-2345436 GGTAATTTATGTTGTGTACTTGG + Intergenic
926386429 2:12339973-12339995 GGTAATGTATGTAGACCACTAGG + Intergenic
926589300 2:14722789-14722811 GATAATAAATGTAAAGCACTTGG - Intergenic
926703538 2:15820083-15820105 GATAAGGTATGTAGCGCACTCGG + Intergenic
926932733 2:18056564-18056586 GATAATGCATGTAAAGCACCTGG + Intronic
927424000 2:22960841-22960863 GACAATGTATGCAAAGCACTTGG + Intergenic
927473282 2:23392546-23392568 GATAATATATGTAAAGTACTCGG - Intronic
928694659 2:33837052-33837074 GATAATGTATATAAAACACTTGG - Intergenic
929085080 2:38160033-38160055 GGTATAGAATGTAACGCACTAGG + Intergenic
929407779 2:41662765-41662787 GTTAATATGTGTAAAGCACTTGG - Intergenic
930250535 2:49029638-49029660 AATAATGCATGTCATGCACTAGG + Intronic
930411932 2:51035039-51035061 GTTAATGTAAGTAAAGCACTTGG - Intergenic
932131815 2:69194516-69194538 AGTAATGTTTGTAAAGCATTTGG + Intronic
932155973 2:69418008-69418030 GATAACATATGTAAAGCACTAGG + Intronic
932477432 2:72015032-72015054 GCAAATGTATGTAAAGCATTTGG - Intergenic
932680859 2:73824271-73824293 GGAAATGTAGCAAATGCACTGGG - Intergenic
932782809 2:74572749-74572771 GGTAAAGTATGCAAAACACTTGG + Intronic
933192012 2:79344926-79344948 GATAGTGTATGTAAAGTACTTGG + Intronic
933673003 2:85027110-85027132 GGTAATTTTTGTAATCCCCTAGG + Intronic
933796849 2:85926853-85926875 GGTAATGCATGTAATGCACCTGG + Intergenic
935463479 2:103366486-103366508 GGCACTGTCTGCAATGCACTTGG + Intergenic
936116857 2:109709623-109709645 GGTAATGCATGCGATGCCCTTGG + Intergenic
936133702 2:109870619-109870641 AGTAATATATGTATTACACTGGG + Intergenic
936210995 2:110500866-110500888 AGTAATATATGTATTACACTGGG - Intergenic
936988331 2:118333670-118333692 AATAATGTATGTAAATCACTTGG - Intergenic
937005313 2:118506850-118506872 GATAGTGTATGTAAAGCACCTGG + Intergenic
939113764 2:138037910-138037932 GATAATGTCTGTAACTCACTAGG + Intergenic
939120439 2:138110023-138110045 GCTAATAACTGTAATGCACTTGG + Intergenic
939263812 2:139845653-139845675 GGTAATGAATCTAGTGCACGTGG + Intergenic
940136509 2:150442297-150442319 AATAATGTATGTAAAGCACTTGG + Intergenic
941617339 2:167735721-167735743 GATAATGTATCTAGGGCACTTGG - Intergenic
941798447 2:169627473-169627495 TGAAATGTATTTAATACACTTGG + Intronic
942804702 2:179916536-179916558 AGTAATATATGTAAAGTACTTGG - Intergenic
943728193 2:191273772-191273794 GAGAATGTATGTAGAGCACTGGG - Intronic
944320132 2:198331060-198331082 GATAATATATGTAAAGCGCTTGG + Intronic
944489944 2:200248180-200248202 GATAATGCATGTAAAGCACTTGG + Intergenic
946245936 2:218387443-218387465 GGTAACATATGTTAAGCACTTGG + Intronic
948158044 2:235800494-235800516 GGTAATGTCTGCTATGCACAGGG - Intronic
948249786 2:236517412-236517434 AACAATGTATGTAAAGCACTTGG + Intergenic
1169497652 20:6130408-6130430 GATAATGTATGCAAAGAACTAGG - Intergenic
1169777850 20:9275784-9275806 GATAATGCATGTAATGGAGTTGG - Intronic
1170971247 20:21118576-21118598 GGTGATCTGTGTGATGCACTTGG - Intergenic
1171115878 20:22524387-22524409 GATAATCTATGTAAAGCACCTGG + Intergenic
1172020463 20:31910189-31910211 GGTAACGCAGGTAAAGCACTTGG - Intronic
1172330381 20:34071853-34071875 GGGAATGTATGTAAAGCACCTGG + Intronic
1172681287 20:36717657-36717679 GAGAATGTATGTAAAGCACTTGG + Intronic
1172762096 20:37330145-37330167 GTTAATGCATATAAGGCACTTGG + Intergenic
1173127885 20:40356976-40356998 AGCAATGTATGTAAAGCATTTGG + Intergenic
1174750664 20:53108337-53108359 GATAATGTAAGTTATGCACATGG + Intronic
1174850393 20:53988298-53988320 GGCCAAGTATGTAATGCATTAGG - Intronic
1177193574 21:17879104-17879126 GGGAATGCATGTATTGGACTGGG + Intergenic
1177363759 21:20106204-20106226 GTTAAGGTATATAATGCATTTGG - Intergenic
1177499088 21:21927695-21927717 GGTAATGTTTCTAATGCTTTGGG - Intergenic
1177546912 21:22570075-22570097 GGTGTTAAATGTAATGCACTGGG + Intergenic
1178535550 21:33407454-33407476 GGTAATGTATATAAAGCACTTGG - Intronic
1180748011 22:18104942-18104964 GTGAATGTATGTAAGGTACTTGG + Exonic
1182371780 22:29816323-29816345 GGTCTTTTATGTAATTCACTAGG - Intronic
1183103150 22:35596343-35596365 TGTCATGTATGCAATGCAATGGG + Intergenic
1183398923 22:37589584-37589606 GAGAATGTATGTAATGGGCTTGG + Intergenic
1184534983 22:45080567-45080589 GCAAATGTATGTAAAGCACTTGG - Intergenic
951041186 3:17990314-17990336 GTTAATCAATGTAAAGCACTTGG + Intronic
951547054 3:23837138-23837160 AGAAATGTATATAAAGCACTTGG + Intronic
952457668 3:33489068-33489090 AGTAATGCATCTAATGTACTTGG + Intergenic
953200983 3:40778379-40778401 GGTAATGTCTATAAAGCACCTGG + Intergenic
954211112 3:49097908-49097930 GGGAATGTATGCAGAGCACTTGG + Intronic
954684538 3:52363234-52363256 GGTAATGCCTGTAAAGCACCGGG - Intronic
956657009 3:71562284-71562306 GTTAATGTATGTAATTTACTTGG - Intronic
959835901 3:110917635-110917657 AATAATGTATGTAAAGCAGTTGG - Intergenic
960837842 3:121925906-121925928 GGTAAAGCATGTACAGCACTTGG + Intronic
960908956 3:122629613-122629635 GACAATAAATGTAATGCACTCGG - Intronic
961116102 3:124331484-124331506 GGTAATGTATGTAATGCACTTGG + Intronic
962469803 3:135696386-135696408 TGTAATGTAGGTAAAGCACTTGG - Intergenic
962705077 3:138035406-138035428 GTTAAAGTATATAAAGCACTAGG - Intergenic
963133632 3:141880116-141880138 TTTAATGTATCCAATGCACTTGG - Intronic
963141763 3:141951763-141951785 GGCAAAGTATTTAATGCACATGG + Exonic
963231346 3:142911376-142911398 GGGAATGCATGCAAAGCACTTGG + Intergenic
964232103 3:154482461-154482483 GGAAAGGCATGTAATGAACTAGG - Intergenic
964410935 3:156397303-156397325 GGTAATATATGTAAAGAAATTGG + Intronic
965663623 3:171068234-171068256 GGTAATGGATCTAAAGCAGTTGG - Intronic
965881471 3:173393684-173393706 AATAATGCATGTAAAGCACTTGG - Intergenic
966270354 3:178097282-178097304 GATAATGTATGTAAAGCACCTGG + Intergenic
966603849 3:181802124-181802146 AGTAATGTATGTAAAACAATTGG + Intergenic
966649035 3:182278333-182278355 TGTAATGTCTGTAATTTACTTGG + Intergenic
966659988 3:182403539-182403561 GATAATGTCTGTAAAGCACTTGG + Intergenic
967891317 3:194366292-194366314 GTTAATGCATGTGAAGCACTTGG + Intronic
969201494 4:5609962-5609984 GGTAAAGCATGTAATGAACAAGG + Intronic
971009355 4:22415942-22415964 AGTAATGTTTGTATTGGACTTGG - Intronic
971396276 4:26230414-26230436 GTTAATATATGTAAAGCACTTGG - Intronic
972377990 4:38491040-38491062 GATAATGTATATAAAGTACTTGG - Intergenic
972703353 4:41515570-41515592 AACAATGCATGTAATGCACTTGG - Intronic
973302040 4:48596623-48596645 GTTAATATCTGTAAAGCACTTGG + Intronic
973867502 4:55128145-55128167 GTTACTGCATGTAAGGCACTTGG + Intergenic
975087704 4:70363430-70363452 GATAATGTATGTAATGCATTTGG - Intronic
976459420 4:85291519-85291541 GGTGTTGTAGGTAATGCGCTTGG + Intergenic
978403119 4:108351338-108351360 GATAATGAATGTAAAACACTTGG - Intergenic
978624733 4:110671921-110671943 GATATTGTATGTAATTCACTTGG + Intergenic
979430373 4:120622321-120622343 GTTAATATATGTAAAGCACTTGG - Intergenic
981911409 4:149985628-149985650 GATGATGTATGAAAAGCACTTGG - Intergenic
982428381 4:155293919-155293941 GGTTAAATTTGTAATGCACTTGG + Intergenic
982724707 4:158893402-158893424 GAGAATGAATGTAAAGCACTTGG + Exonic
983859512 4:172687708-172687730 GATAATGTTTGCAATGCATTTGG + Intronic
984655372 4:182311660-182311682 GGTCATATATGTAAAGCACCTGG + Intronic
988907922 5:35809119-35809141 GGTCATGCATGTAAAGCACTTGG + Intronic
989730229 5:44640360-44640382 GGTAATATATATAATACAGTAGG - Intergenic
990570243 5:57071221-57071243 GTTAATGTATGTAAAATACTTGG + Intergenic
990593051 5:57284688-57284710 GGTAACTTATTTAATTCACTTGG - Intergenic
991252943 5:64583942-64583964 GATAATGTGTATAATGCACCTGG - Intronic
992503354 5:77363112-77363134 GTTAATGTATGAAATGCACTTGG - Intronic
992821985 5:80506848-80506870 GCTAATCTATCAAATGCACTAGG + Intronic
995132435 5:108644610-108644632 GGTCAGGTAGGTAATGCACATGG - Intergenic
996299201 5:121961235-121961257 GCTAATTTATGTAAAGCTCTTGG + Intergenic
996915302 5:128704713-128704735 GATAATGTATGTAATGTTCATGG + Intronic
998426034 5:142029429-142029451 GATAATGTGTGAAAAGCACTTGG - Intergenic
998478786 5:142444074-142444096 GGTCTTATATGTAAAGCACTTGG - Intergenic
998531871 5:142892526-142892548 GGTAATGTATGTACAGCTATGGG + Intronic
998666860 5:144307499-144307521 AATAATGTATGTTAAGCACTTGG - Intronic
998706623 5:144769437-144769459 GATAATGTATGTAAATCATTTGG + Intergenic
999084521 5:148875199-148875221 GATAATGTATGAAATGCACCTGG + Intergenic
999134671 5:149310621-149310643 GGTCACGTATGTAAAGCTCTTGG - Intronic
1000447914 5:161347160-161347182 GGCAATGCATGTAAAGTACTTGG - Intronic
1000969721 5:167700345-167700367 GATAATGTTTGTAAAACACTTGG - Intronic
1001086784 5:168706236-168706258 AGTAATGTACGCAATACACTAGG - Intronic
1004146784 6:13075185-13075207 GTTAATATATGTGATGAACTTGG - Intronic
1005033221 6:21530839-21530861 GTTATTACATGTAATGCACTTGG - Intergenic
1005163826 6:22896403-22896425 GGTAATGTCTTTAATTCACCGGG - Intergenic
1005356036 6:24984528-24984550 GATAATGCATTTAAAGCACTTGG + Intronic
1006428012 6:33978218-33978240 GGCAATGTATGTACAGCACTCGG - Intergenic
1007616555 6:43183000-43183022 GATCATGTATGTAAAGCACTTGG - Intronic
1008785992 6:55168843-55168865 GTTAATGTATGTAACGTACTTGG + Intronic
1011094544 6:83645438-83645460 AGTAATGTATGCTATGGACTTGG - Intronic
1012211889 6:96529786-96529808 CCTAATGCATGTAAGGCACTGGG + Intronic
1012393029 6:98764658-98764680 GGTATTGTGTGTAATGCATGGGG - Intergenic
1013069676 6:106717009-106717031 AGTAATATGGGTAATGCACTTGG - Intergenic
1013539654 6:111095364-111095386 TGTTATGTATTTGATGCACTTGG + Intronic
1013586851 6:111586953-111586975 GATAATGTATTAAAGGCACTAGG - Intronic
1015144431 6:129969479-129969501 AAGAATGTATGTAAAGCACTAGG - Intergenic
1015936487 6:138409958-138409980 GTTAATTTATGTAAAACACTTGG + Intronic
1015977918 6:138809955-138809977 GGCAATCTATGTGATGCAGTGGG + Intronic
1018990113 6:168668233-168668255 GTTAATGTATGTAAAGTGCTTGG + Intronic
1020726793 7:11825632-11825654 GGTAATGCATGTAACGTACTAGG - Intronic
1021144542 7:17068841-17068863 TATAATGTAGGTTATGCACTAGG - Intergenic
1021854234 7:24838110-24838132 GGGAATGTCTGTAAAGAACTAGG + Intronic
1022213588 7:28236159-28236181 GATAATGTATGTAAAGTACATGG + Intergenic
1022239963 7:28501027-28501049 CCTAATGTATGTAAAGCACAGGG - Intronic
1023858764 7:44203674-44203696 GGTAATACGTGTAAAGCACTTGG - Intronic
1025985125 7:66443832-66443854 GGTAATGTCTATTATGCACTAGG + Intergenic
1026362772 7:69617986-69618008 GTTAATGCATGTAAAGCTCTGGG - Intronic
1026469906 7:70686264-70686286 ATTCATGTATGTAAAGCACTTGG - Intronic
1026893244 7:73995309-73995331 GGTAATCTCTGTGAAGCACTTGG + Intergenic
1026908989 7:74081725-74081747 GGGGATGTTTGCAATGCACTGGG - Intergenic
1027208336 7:76122431-76122453 GGTAATGCCTGTTATGCACTAGG + Intergenic
1027895522 7:84038440-84038462 ATTAATTTATGTAATGCATTTGG - Intronic
1029129458 7:98319006-98319028 GATAACGTATGTAAATCACTTGG + Intronic
1031130306 7:117825769-117825791 AATAATGCATGTAAGGCACTTGG + Intronic
1031595140 7:123641047-123641069 AGTACTGTAGGTAATGCAGTGGG + Intergenic
1032278757 7:130484034-130484056 GTTAATATGTGTAAAGCACTTGG - Intergenic
1032432306 7:131871984-131872006 GGTAAGTTATATAAAGCACTTGG - Intergenic
1032470075 7:132171879-132171901 GATAATGTATGTAAAGTGCTTGG + Intronic
1032578332 7:133079541-133079563 GGTAAGGTATGTAAAGCACCTGG - Intronic
1033740802 7:144274313-144274335 GGTAATGTATCCACTGCACTAGG - Intergenic
1033753104 7:144375300-144375322 GGTAATGTATCCACTGCACTAGG + Intronic
1033779783 7:144654765-144654787 GTTAATATATATAAAGCACTTGG + Intronic
1034077026 7:148242052-148242074 ATTTATGTATTTAATGCACTTGG - Intronic
1034380799 7:150690506-150690528 GGTAATGCAGGTAAACCACTTGG + Intronic
1034886762 7:154804265-154804287 GATAATGTCTGTAAAGCACTTGG - Intronic
1034891037 7:154839536-154839558 GTTTGTGCATGTAATGCACTGGG + Intronic
1035042519 7:155940290-155940312 TGCAATGTATGTAGTGCCCTAGG - Intergenic
1036048264 8:5167580-5167602 AGTACTGGTTGTAATGCACTTGG + Intergenic
1036423113 8:8616458-8616480 GTTAATTTTTGGAATGCACTTGG - Intergenic
1037726298 8:21485254-21485276 GCTAATGTATGTAATGGGCAAGG - Intergenic
1039156259 8:34561930-34561952 GTTAATATATGTAAGTCACTTGG - Intergenic
1039555736 8:38473549-38473571 GAAAATGTGTGTAATGCACTTGG + Intergenic
1040877934 8:52172461-52172483 GGTCAAGTCTTTAATGCACTTGG - Exonic
1041120354 8:54580176-54580198 GTCAATGTATATAAAGCACTTGG + Intergenic
1042103645 8:65300617-65300639 ATTAATGTATGTAAAGCAATTGG - Intergenic
1044946087 8:97391422-97391444 GATAATTTATGCAAAGCACTCGG - Intergenic
1044995955 8:97838440-97838462 GTTAATCTATGTAAAGCACTCGG - Intronic
1045348096 8:101312878-101312900 AGTAAAGTATATAAAGCACTTGG + Intergenic
1045520598 8:102899682-102899704 AAAAATGTATGTAATGCTCTAGG - Intronic
1045766068 8:105670625-105670647 GGTAATGTATAAAATGTACAGGG - Intronic
1046733213 8:117748226-117748248 GATAATGTAAGTAAAACACTTGG + Intergenic
1047766376 8:127993292-127993314 CGTGATGTCTGCAATGCACTAGG + Intergenic
1047933259 8:129751130-129751152 GTTTATGTATGTAAGGCACTTGG + Intronic
1048073875 8:131047688-131047710 GGTAATTCATGCAAAGCACTTGG + Intergenic
1048211045 8:132454432-132454454 GTTTATTTATGTAAAGCACTTGG - Intronic
1050514825 9:6432254-6432276 GGCACTGTATGTAATGAACATGG - Intronic
1050630853 9:7556926-7556948 AGTAATGTCTGTTTTGCACTGGG - Intergenic
1051210560 9:14737904-14737926 GATAATGCATGTAAAGCTCTTGG + Intronic
1054824633 9:69560583-69560605 GGGAATGCATGTAAAGTACTTGG + Intronic
1055186632 9:73464423-73464445 GGTAATTTCTGACATGCACTTGG - Intergenic
1055920019 9:81450559-81450581 GGTTGTGCATGTAATGCATTTGG + Intergenic
1056325818 9:85478160-85478182 GATAGTGTATATAAAGCACTTGG - Intergenic
1057621028 9:96635261-96635283 GTTAATGTATGTAAAGCACTTGG + Intergenic
1058773270 9:108259626-108259648 GGTAAAGTATGAAAAACACTGGG - Intergenic
1059323730 9:113489038-113489060 GATAATGTATGTAAAGTGCTTGG - Intronic
1059711660 9:116873233-116873255 GATAATGTAGGTAAAGCATTAGG + Intronic
1059813598 9:117885354-117885376 GATAATGTTTGTAAAGCACCTGG + Intergenic
1059949137 9:119443521-119443543 GATAATGTCTGTGAGGCACTTGG - Intergenic
1060229486 9:121816041-121816063 CGTAATGTATGTAAAGAACCGGG - Intergenic
1187296712 X:18009554-18009576 TGTAATGTCTGTTATGCATTTGG - Intergenic
1187475540 X:19607690-19607712 GATAGTGTGTGTAAAGCACTCGG - Intronic
1187546645 X:20260726-20260748 GATAATATATGTAAAGTACTTGG - Intronic
1188440671 X:30212960-30212982 GTTAATGTATGTAAAGCACCTGG - Intergenic
1188442236 X:30223814-30223836 GGTAATGTATGGAAAGCACTTGG - Intergenic
1188445911 X:30253125-30253147 TGTAATGTATGTAAGGCATCTGG - Intergenic
1188458763 X:30397678-30397700 GGACATGTATGTAATTCTCTTGG - Intergenic
1188734087 X:33691075-33691097 GGTAATGGATGAAAAGTACTTGG - Intergenic
1189376218 X:40468189-40468211 GGTAATGCATATAAACCACTTGG - Intergenic
1190015497 X:46823474-46823496 GGAAATGTATGTCAAGCACAAGG + Intergenic
1192230495 X:69261327-69261349 GATAATCTATGAAAAGCACTTGG + Intergenic
1193239130 X:79145329-79145351 GGTTATGGATATAATGAACTTGG + Intergenic
1195720868 X:107866870-107866892 GATAATACATGTAAAGCACTTGG - Intronic
1197220331 X:123906051-123906073 GTTAAAATATGTAATGCATTTGG + Intronic
1197903705 X:131400592-131400614 AGTATTGTAAGTAAAGCACTTGG + Intergenic
1198509773 X:137338610-137338632 GATAATATATGTAAAGCACTTGG + Intergenic
1199635909 X:149811275-149811297 TGTAATGTAAGTGATGCACCTGG - Intergenic
1199948732 X:152688446-152688468 TGCAATGTAAGTAAAGCACTTGG - Intergenic
1199960944 X:152780003-152780025 TGCAATGTAAGTAAAGCACTTGG + Intergenic
1200410810 Y:2859495-2859517 GATAATTTATGTAATCCCCTTGG - Intronic
1202050212 Y:20772991-20773013 GATAATTTATGTAATTCCCTTGG - Intronic