ID: 961117249

View in Genome Browser
Species Human (GRCh38)
Location 3:124341083-124341105
Sequence AGGAAGAAAGGGGGTGATTA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 509
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 478}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961117249 Original CRISPR AGGAAGAAAGGGGGTGATTA GGG Intronic
901460370 1:9387594-9387616 GGGAAGAATGGGGGTGAAGATGG + Intergenic
901738305 1:11326168-11326190 TGGAAGAAAGGAGTTGATCATGG + Intergenic
902082963 1:13833750-13833772 AGGAAGAGAGGGGGTGGGAAGGG + Intergenic
902300926 1:15502265-15502287 GCCAAGAAAGGGGGTGTTTAGGG + Intronic
902806080 1:18862110-18862132 GTGCAGAAAGGGGGTGATGAGGG - Intronic
903090641 1:20912845-20912867 AGGAAAAGAGGTGGTGATTTGGG - Intronic
903254984 1:22090954-22090976 AGAGAGAGAGAGGGTGATTATGG - Intronic
903968826 1:27106094-27106116 GGGAAGGCAGGGGGTGATGAGGG + Intronic
904569249 1:31448826-31448848 AGGTAGAAAGGAGTTTATTAGGG + Intergenic
904860760 1:33536195-33536217 AGGAAGAATGGGTGTGTTCAAGG - Intronic
905933483 1:41806232-41806254 AGGAAGAGAGGGGATGATAAGGG - Intronic
906772761 1:48499974-48499996 AGGAAGAAAGGGGAACATTTTGG + Intergenic
907273097 1:53302127-53302149 TCAAAGAAAGGGGGTGATTTTGG + Intronic
907277877 1:53327083-53327105 AGGAGGAAAGGGGGCGATTATGG + Intronic
907327287 1:53646991-53647013 AGGAAGGAAGGGAGGGATGAAGG + Intronic
907749008 1:57244370-57244392 AGGAACAAATGGGTTGATAAAGG + Intronic
907802061 1:57778900-57778922 AGGAAGGGAGGGAGTGAGTAAGG - Intronic
909802547 1:79829994-79830016 AGAAAGAAAGACGGTAATTAAGG - Intergenic
911331067 1:96526347-96526369 AGGAAGAAACGGGGTTTTTCAGG - Intergenic
911342658 1:96657504-96657526 AGGAAGAAATGGTGTCATTAAGG + Intergenic
912122906 1:106495238-106495260 CAGAAGAAAGGAGATGATTATGG + Intergenic
912259602 1:108097215-108097237 AGAAAGAAAGGGAGTCATGAGGG - Intergenic
912401831 1:109399451-109399473 GGGAGGAAAGGGGGTTATAAAGG + Exonic
912411697 1:109484461-109484483 AGGAACAAGGGGGGTGAGGAAGG - Intronic
913240394 1:116825228-116825250 AGGAGGAAAGGGGGTGGAGAAGG - Intergenic
913940330 1:125097869-125097891 AGAAAGGAAGGGAGGGATTAGGG - Intergenic
913954910 1:143280780-143280802 AGAAAGGAAGGGAGGGATTAGGG - Intergenic
913982526 1:143534585-143534607 AGAAAGGAAGGGAGGGATTAGGG + Intergenic
915295270 1:154916805-154916827 AGCAAGAGAGAGGGAGATTATGG + Intergenic
916875946 1:168969142-168969164 AGGAAGAAATGGGGAGATGTAGG + Intergenic
917234560 1:172876903-172876925 AGGAAGAAGGGAGGTGGGTAGGG - Intergenic
917788380 1:178483707-178483729 AGGAAGAGAGGGGGTGCTGGGGG - Intergenic
917808914 1:178638588-178638610 AGGAAGGAAGGGGCTGGTTTGGG - Intergenic
919493510 1:198235377-198235399 AGGAAGAAAGGGGGAAAAGAAGG - Intronic
919621249 1:199866618-199866640 AGGCAGAAAGGTGATCATTAGGG - Intergenic
920601090 1:207324459-207324481 GTAAAGAAAGGGGGTTATTAGGG + Intronic
921111256 1:212039465-212039487 TGGAAGAAAGGAAGTGATGAAGG + Intronic
921389029 1:214600966-214600988 AGGAAGAAAGGAGGTAAGAATGG + Intergenic
921412444 1:214850186-214850208 ATGAAGAAAGAAGGTGATGAAGG + Intergenic
922081535 1:222302145-222302167 ATGAGCAAAGGGGGTGATGATGG + Intergenic
922410765 1:225373197-225373219 AGAAAGAAAGGGGGAGAGGAGGG + Intronic
923228582 1:231962627-231962649 AGAAAGGCAGGGGGAGATTAGGG + Intronic
923848568 1:237766007-237766029 AGGAATCAAGGGGGTGGATAAGG + Intronic
1063697981 10:8356360-8356382 AGGAAGAAAGGAGGTAAGGAAGG - Intergenic
1064745886 10:18477715-18477737 AGGAGGAAAGGGGCAGGTTAGGG + Intronic
1064932347 10:20641422-20641444 AGGAAGTAGGAGGGTGATGAAGG + Intergenic
1064997500 10:21309642-21309664 AGGAAGTAGGGTGGAGATTAGGG - Intergenic
1066287277 10:33980636-33980658 AGGAGAAAATGCGGTGATTATGG - Intergenic
1067777620 10:49174868-49174890 TGGAAGACAGGCAGTGATTAAGG + Intronic
1068004051 10:51371763-51371785 AAGAAGAAAGGGGTTGATGATGG - Intronic
1068457626 10:57278733-57278755 AGGAAAAAATGGGGAGATAAAGG + Intergenic
1069155684 10:65028069-65028091 AGGTAGAAATGGGGTGAAAAAGG - Intergenic
1070356592 10:75646048-75646070 AGAAAGAATGGGGGTGAGGATGG - Intronic
1070505774 10:77111493-77111515 AGCAAGAATTAGGGTGATTAAGG + Intronic
1070622543 10:78024433-78024455 TGGAAGAAAGTGGGTGTCTAGGG + Intronic
1070765981 10:79056688-79056710 AGGAAGAAAGAGGATGAGTCTGG + Intergenic
1071398268 10:85244393-85244415 AAGAAGAAAGGGAGAGATGAGGG + Intergenic
1071444353 10:85731850-85731872 AGGAAGAAAGGGAGGGAGGAAGG + Intronic
1074231857 10:111545505-111545527 GTGAAGAAAGGGGGTGATATTGG - Intergenic
1075100614 10:119503640-119503662 AGGAAGAAACGAGGGGCTTAGGG + Intronic
1075283473 10:121161807-121161829 AGGAAGCTAGGGGGTGCTCAAGG - Intergenic
1076194388 10:128505786-128505808 AGGAAGAAAGAGGAAAATTAGGG - Intergenic
1079140090 11:17802803-17802825 AGGATGAAATTGGGTGATCAGGG - Intronic
1079504784 11:21141620-21141642 ATGATAAAAGGAGGTGATTAAGG + Intronic
1079840996 11:25399125-25399147 AGGAAGAAAGGGAGGGATAGAGG - Intergenic
1080148029 11:29012230-29012252 AGGAAGAAATGGGGAGGTGATGG - Intergenic
1080586912 11:33690874-33690896 AGCGACAAAGGGGGTGAATATGG - Intergenic
1081415220 11:42806822-42806844 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1081662011 11:44894136-44894158 AGGATGCAAGGGGATGATGAGGG - Intronic
1082859497 11:57840984-57841006 AGGAAGAAAGGGAGGGAATGAGG - Intergenic
1082962994 11:58936931-58936953 AGGAAGAAGGGGGATGTTTAGGG - Intronic
1083045296 11:59729134-59729156 AGGAAGGAAGGGGATGGTGATGG - Intronic
1083348950 11:62013557-62013579 AGGAAGCAATGGGGTGATGGGGG - Intergenic
1083696183 11:64444338-64444360 AGGAAGAGAGGGAGTGAGGAAGG - Intergenic
1083917153 11:65754996-65755018 AGGAAGAAAGGTGGTAAAGATGG - Intergenic
1084845529 11:71896340-71896362 AGGAAGAAAAGGGGTGAGATAGG + Intronic
1085029286 11:73259892-73259914 AGGGAGAACAGGGGTGGTTAAGG - Intergenic
1085273283 11:75283021-75283043 TGGGAGAAAGGGGGTGCTAAGGG - Intronic
1086411663 11:86550392-86550414 AGCCAGAAAGGGGATGATTGAGG + Intronic
1087136013 11:94720825-94720847 AAGAAGAAATGGGGTGCCTAGGG + Intronic
1087357460 11:97112626-97112648 AGGAAGAAAGGTGGGGAGTTTGG - Intergenic
1087548000 11:99609049-99609071 AGGAAGAAAGGGAGACATTTGGG - Intronic
1088722654 11:112608277-112608299 TGGAAGAAGAGGGGTGAGTAAGG - Intergenic
1088774659 11:113070572-113070594 AGGAAGACAGGAGGAGATGAAGG + Intronic
1089894499 11:121915845-121915867 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1091353898 11:134920694-134920716 AGAAAGAAAGAGGGAGATTGGGG + Intergenic
1091654548 12:2336045-2336067 AGGAACAAAGAGGATGCTTAGGG - Intronic
1091984053 12:4893400-4893422 AGGAGGAAAGTGGGTTATTCAGG - Intergenic
1092153175 12:6265164-6265186 AGGAAGACAGGGGGTGAGGGAGG + Intergenic
1093776942 12:23086701-23086723 AGAAAGAAAGGAGGTGATATGGG - Intergenic
1094355127 12:29569441-29569463 AGCAAGAAAGAGAGTGATTAGGG - Intronic
1095656764 12:44679198-44679220 AGGAAGAAAGGGTGGAAGTAAGG + Intronic
1095861030 12:46918259-46918281 AGGAGGAAATGGGATGATTTGGG - Intergenic
1096041091 12:48518179-48518201 AGTAAGAAAAGTTGTGATTATGG - Intronic
1096092834 12:48914793-48914815 AAGAAGAAAGTGGGTGGTGAAGG - Intronic
1096264144 12:50110485-50110507 AGGAAGAAAGGGGTGGAGTCAGG - Exonic
1096761767 12:53847738-53847760 AGGAAGGAAGGCGGGGATGAGGG - Intergenic
1096864899 12:54556689-54556711 AGCTAGAAAGGGGGTGCTTCAGG + Intronic
1097385278 12:58943691-58943713 AGGAAGCAAGGAGGTGGTTTGGG - Intergenic
1097591520 12:61581345-61581367 AGGAAGAAAGGAGGAGAAGAAGG - Intergenic
1099578471 12:84409450-84409472 AGAAAGACAGGGGGTGACAAAGG - Intergenic
1099579955 12:84433139-84433161 AGAAAGAAAGGGGGAGAGAAGGG - Intergenic
1099908351 12:88799134-88799156 AGGGAGAAAGGGAGGGATGAAGG + Intergenic
1100467486 12:94859712-94859734 AGGAAGAAAGAGGGTCAGGAAGG - Intergenic
1100556171 12:95696014-95696036 AGGAAGGAAGGAAGTGAGTATGG - Intronic
1100688141 12:97009224-97009246 AGGAGGAGAGTGAGTGATTACGG + Intergenic
1101148188 12:101861529-101861551 AGGAAGAAAGGGGGGGAGGGAGG - Intergenic
1101377734 12:104185209-104185231 ATGAAGAAAAGGGGTGCTTAAGG + Intergenic
1101758430 12:107639541-107639563 AGGAGGACAGGGGGTGATGATGG + Intronic
1101797791 12:107991858-107991880 AGGAAGAATTGGGGTAATTTTGG + Intergenic
1101803038 12:108039198-108039220 AGGAAGAAAGTGTGTAAATAGGG + Intergenic
1102549511 12:113681422-113681444 GGGAAGAATGGGGGAGATTGAGG + Intergenic
1102732138 12:115121050-115121072 AGGAAGGAAGGGAGTGAGGAAGG - Intergenic
1102848221 12:116211010-116211032 AGGAAGAAAGGAGATGAAGAGGG + Intronic
1104171009 12:126280464-126280486 AGGAAGCAAGGTCCTGATTATGG - Intergenic
1104224968 12:126822664-126822686 AGGAAGGGAGGGGGTGCATATGG + Intergenic
1104371606 12:128228528-128228550 AGGAAGAAGGGGGGTGAGGGAGG + Intergenic
1104678085 12:130729339-130729361 AGGAAGAAAGGGGGAGAGACAGG + Intergenic
1105299454 13:19119002-19119024 AGGAGGAAAGAGGGTGATGGGGG + Intergenic
1105299632 13:19119883-19119905 AGGAAGAAAATGGGTGGTGAGGG + Intergenic
1105328436 13:19391486-19391508 AGGAAGCAAGTGGGTGATTTTGG + Intergenic
1105634102 13:22200805-22200827 GGGAGGAAAAGGGGTGATTGAGG + Intergenic
1105968881 13:25409279-25409301 AGGGAGAAAGGGAATAATTATGG + Intronic
1106681851 13:32016573-32016595 AGAAGGAAAGGGGCTGAATATGG + Intergenic
1106818120 13:33432081-33432103 AGGAAAAATAGGGGTGATTAAGG + Intergenic
1107895186 13:44955007-44955029 AGGAAGAAAGTGGGTCAGTAAGG - Intronic
1109496618 13:63180269-63180291 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1109509138 13:63346380-63346402 AGGAAAAAAGGGGCTGGGTACGG + Intergenic
1109686816 13:65831067-65831089 AGGAGGAAAGGATGTGATGAGGG - Intergenic
1109805974 13:67443509-67443531 AGAAAGAATGGAGGTAATTATGG + Intergenic
1110151545 13:72260712-72260734 AAGAATATAGGGTGTGATTATGG + Intergenic
1110686568 13:78382512-78382534 AGGAAAGAAATGGGTGATTAGGG - Intergenic
1110841696 13:80151509-80151531 AGAAAGAAAGGGAGTGGGTAGGG + Intergenic
1111048366 13:82846592-82846614 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1111088131 13:83403408-83403430 GAGAAAAAAGGTGGTGATTAAGG - Intergenic
1111955080 13:94747789-94747811 AGGAAGGAAGGGGGGAAATAAGG + Intergenic
1112592276 13:100774844-100774866 AGGAAGAAAGAAGGAAATTAGGG - Intergenic
1112752956 13:102600165-102600187 AGGATGAAAGGTGGGGATGAAGG - Intronic
1114296529 14:21334329-21334351 AGGAAGGAAGGGTGAGAGTAAGG - Intronic
1114376083 14:22148229-22148251 AGGAAGAAAGGGGGAAAGCAAGG + Intergenic
1114412754 14:22516207-22516229 AGGAAGACAGGTGGAGGTTAGGG - Intergenic
1115596274 14:34912519-34912541 AGGAAGAAAGGTGCTGACTGGGG + Intergenic
1116201935 14:41808332-41808354 AGGAAGGAAGGGAGGGATGAAGG + Intronic
1116201982 14:41808532-41808554 AGGAAGGAAGGGAGGGATGAAGG + Intronic
1116244032 14:42385144-42385166 AGGAAGATTTGGAGTGATTAAGG - Intergenic
1116464090 14:45212233-45212255 AGGAAGAGAGAGAGAGATTAGGG - Intronic
1116851923 14:49917427-49917449 AGGATGAAAGGGATTGATAATGG + Intergenic
1117660450 14:57998796-57998818 AGGAAGGAAGGAAGTAATTAAGG - Intergenic
1118201381 14:63677215-63677237 AGGAAGAAAGTAGGTGGTTATGG + Intergenic
1118747415 14:68784404-68784426 AGGCAGCAAGGGGGTGACCAGGG + Intergenic
1118846776 14:69553470-69553492 AGGAAGAAAGATGGAAATTATGG - Intergenic
1119288745 14:73477441-73477463 GGGAAGAAAGGATGTGATTAGGG + Intergenic
1121409349 14:93738427-93738449 AAGAGGAAAGGGGATGATGAGGG + Intronic
1121916003 14:97837413-97837435 AGGAAGAAAGGGAGTGGAGAGGG + Intergenic
1122363901 14:101183222-101183244 AGGAAGAAAGGGAGTGGGGAAGG - Intergenic
1122477428 14:102020505-102020527 AGGAAGAGGGGTGGTGGTTACGG - Intronic
1123906752 15:24929334-24929356 AGGAGGCAAGGGGGAGAGTAGGG - Intronic
1124693880 15:31847335-31847357 ATGAAAAAAGGGTGTGATCATGG + Intronic
1124881313 15:33645456-33645478 AGGAAGAAAGTGGGGCATTAAGG - Intronic
1125602347 15:40922661-40922683 AGGAAGAAACGGGGAGAGTCGGG - Intergenic
1125952148 15:43761275-43761297 AGGAGGAAACTGGGTGACTAGGG + Intronic
1126669083 15:51099914-51099936 GGGAAGAAAGGAGTTGATTCCGG + Intronic
1127837990 15:62806299-62806321 AGAAAGAAGGGGGAGGATTAGGG - Intronic
1128491460 15:68150227-68150249 AGGAAGAAGGGGAGTGTTTTTGG + Intronic
1128674509 15:69598741-69598763 AGGGAGAATGGAGGTGATAATGG + Intergenic
1129554898 15:76497517-76497539 AGGAAGGGAGAAGGTGATTATGG + Intronic
1130208495 15:81900948-81900970 AGGTAGAAAGGGGGAGGTCAGGG - Intergenic
1130738141 15:86571640-86571662 AGGAAACAAGGGGGAGATGAAGG - Intronic
1131038358 15:89240646-89240668 AGAAAGAAGGATGGTGATTATGG - Intergenic
1131323865 15:91423480-91423502 AGGAAGAGAGGAGGTTATCAGGG - Intergenic
1133187173 16:4108339-4108361 ATGAAGAAACGGTCTGATTAAGG - Intronic
1133464580 16:6018191-6018213 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1133528438 16:6629567-6629589 AGGATGAATGAGGGTGGTTAGGG + Intronic
1134681802 16:16131616-16131638 AGGATGCAAGGGGGTCATTTGGG + Intronic
1134806569 16:17130903-17130925 AGGAAGGAAGTGGTGGATTAGGG - Intronic
1136130591 16:28218268-28218290 AGGAAGAAAGGGTGAGAGTCTGG + Intergenic
1136283105 16:29225699-29225721 AGGAGGAAAGGGTGTGAATCGGG + Intergenic
1136382183 16:29900808-29900830 GGGAGGAAAGGGGGAGATTGAGG + Exonic
1136580243 16:31147250-31147272 AGGAAGATGGGGGGAGATGAAGG - Intronic
1136769377 16:32822111-32822133 AGAAAGGAAGGGAGGGATTAGGG - Intergenic
1139221378 16:65185946-65185968 AGAAAGAAAGGGAGGGATGAAGG - Intergenic
1139476697 16:67206440-67206462 AGAAAGGAAGGGGGTGATCCAGG - Intergenic
1139605169 16:68013110-68013132 AGGAAGAAAGAGGCTGGGTATGG + Intronic
1140034036 16:71359400-71359422 AGGAAGCAGGGGGGTGTTCAGGG - Intronic
1140045462 16:71437706-71437728 TGGGGGAAAGGGGGTGATCAGGG - Intergenic
1140700331 16:77575379-77575401 AGGAAGGAAGGGGGTAATGACGG - Intergenic
1141028137 16:80566997-80567019 AAGAAGAAAGTGGGAGATTTGGG - Intergenic
1141296683 16:82776228-82776250 AGGAAGGAAGGAAGGGATTAAGG + Intronic
1203071793 16_KI270728v1_random:1084216-1084238 AGAAAGGAAGGGAGGGATTAGGG - Intergenic
1142495823 17:305820-305842 AGGAAGAAAGGGGCTGGGGAGGG - Intronic
1143580566 17:7823403-7823425 AGGAAGAAAGGGATTGACTTGGG - Intronic
1144163398 17:12583419-12583441 AGAAAGAAAGGGGGAGGCTAAGG - Intergenic
1147507698 17:41035971-41035993 AGGAAGGAAGGGAGAGCTTAGGG + Intergenic
1147545976 17:41402157-41402179 AGGAAGAAATGGAGTGGGTAGGG - Intergenic
1148022956 17:44565756-44565778 AGGAAGAAAGGGAGGGAGAAAGG - Intergenic
1148611670 17:48968809-48968831 AAGAAAAAAGGGGGTACTTAGGG - Intergenic
1150474912 17:65467488-65467510 AGGAAGCAAGGGGGAGACTCTGG - Intergenic
1150482928 17:65524457-65524479 AGGAAGATCGGGGGGGATTAAGG + Intergenic
1151271000 17:72995993-72996015 AGGCAGAAGGGTGGGGATTAGGG - Intronic
1151335005 17:73434551-73434573 AGGAAGAATGGGGATGTTCAGGG - Intronic
1151371525 17:73649558-73649580 AGGAAGAAAGAGGGAGAATCAGG + Intergenic
1152036220 17:77874735-77874757 AGGAAGAATGGAGGTGATCATGG + Intergenic
1152362255 17:79838101-79838123 AGGAAGAAAGGGGAGGGGTAAGG + Intronic
1153403277 18:4705311-4705333 AGGCAGCAAGGGATTGATTAAGG - Intergenic
1153403487 18:4707596-4707618 AGGCAGCAAGGGATTGATTAAGG - Intergenic
1155140487 18:23040034-23040056 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155140495 18:23040062-23040084 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155140502 18:23040086-23040108 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1155982238 18:32193708-32193730 AGGAAGTAAGGGAGTGACTTAGG - Intronic
1157239834 18:45998620-45998642 AGGAAGGAAGGGAGAGAGTAAGG - Intronic
1157282621 18:46356069-46356091 GGGAAGAAAGGTGGAGATTTGGG - Intronic
1158203065 18:54961249-54961271 AGGAGGAAATGTGGTGTTTATGG - Intergenic
1158422880 18:57311871-57311893 AGGAACAAAGGGGATGACTGTGG + Intergenic
1159130017 18:64270818-64270840 CTGAAGAAGTGGGGTGATTATGG + Intergenic
1159578484 18:70207615-70207637 AGGAAGGAAGGTGTTAATTACGG + Intergenic
1159971312 18:74657979-74658001 AGGAAGAAAGGGGGAAAGGAGGG - Intronic
1160077510 18:75692410-75692432 AGGATGAAAGGAGGTGACCATGG - Intergenic
1161139553 19:2639538-2639560 AGGAAGGAATGGGGTGTTTCTGG + Intronic
1162044132 19:7987579-7987601 AGGAAGGAGGGGCGTGATGATGG - Intronic
1162461104 19:10814818-10814840 AGCAAGAAACGGGTTGATCAGGG - Intronic
1163664069 19:18594891-18594913 AGGAGGAAAGGGCCTGATCAGGG + Intronic
1164802688 19:31090733-31090755 AGGAAGAAAGGGAGGGAGAAAGG + Intergenic
1164916758 19:32058242-32058264 AGGAAGGAAGGAGGAGATGAAGG - Intergenic
1166021086 19:40030288-40030310 AGGAAGCAAGAGGGTGAGGAAGG + Exonic
1166760421 19:45220877-45220899 GGGATGAAAGGGGGTGAGGAAGG + Intronic
1167419485 19:49394695-49394717 AAGAACAAAGTGGGTGATTATGG + Intronic
1167971696 19:53191934-53191956 AGGAAGAAAGAGGGGGACTATGG - Intronic
1168143897 19:54408517-54408539 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1168331777 19:55574452-55574474 AGCAAGAAAGATGGTGATTGAGG - Intergenic
1168356892 19:55706182-55706204 AGGAAGAAAGGAGGAGAAAAAGG - Intronic
1168433830 19:56302411-56302433 AGGGAGAAAGGGAGGGATGAAGG - Intronic
925079365 2:1051149-1051171 AGGAAGAAAGGGGGAGAGGGAGG - Intronic
925185427 2:1843378-1843400 AGGAACCAAGGGGGGAATTACGG + Intronic
925311429 2:2886944-2886966 AGGAAGAAAAAGGGATATTAAGG + Intergenic
925719550 2:6813754-6813776 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
926244647 2:11113728-11113750 AGGAAGAAAGGTGGGGAGGAAGG - Intergenic
929215938 2:39413381-39413403 ATGAGGAAAGGGGGCAATTAAGG + Intronic
930505326 2:52276118-52276140 AGTAAGTAAGGGTGTGAATATGG - Intergenic
931467292 2:62501743-62501765 AAGAAATAAGGGAGTGATTAGGG + Intronic
932882140 2:75512667-75512689 AGGAAGAAAGGACTTGATGATGG - Intronic
936233674 2:110725400-110725422 AGGGAGAAATGGGATGATTTGGG - Intergenic
936857066 2:116971377-116971399 AGGAAGATAGAGGGTTATTGAGG + Intergenic
937106516 2:119320351-119320373 AGGAATAAAAAGGATGATTAAGG - Intronic
937300641 2:120838106-120838128 AGGGAGAAAGGCCGTGATCATGG - Intronic
937725641 2:125162279-125162301 AGGAAGAAAGAAGGCTATTAAGG + Intergenic
937956403 2:127423811-127423833 AGGAAGCAAGGGGGTAAAGAGGG - Intronic
938519136 2:132048763-132048785 AGGAAGAAAAGGTGGGATGAAGG - Intergenic
938832895 2:135071237-135071259 AGGAAAAAAGTGGGTAATTTTGG - Intronic
939688328 2:145227059-145227081 AGGAAGAAAGTGGCAGATTGAGG - Intergenic
940382928 2:153036543-153036565 AGCAAGAAAGGGGGAGATCTAGG + Intergenic
941338591 2:164276683-164276705 AGGATGAAAGGGAGGGATGAAGG + Intergenic
942276884 2:174329416-174329438 GGGAAGAAAGGGGGTGTTAGTGG + Intergenic
942385332 2:175436735-175436757 AGGAAGAAAAGGGAAGATGATGG + Intergenic
942468730 2:176237451-176237473 TGGAAGAAATGGGGAGATAATGG - Intergenic
943595518 2:189850607-189850629 AGGAAAAAGGGGGCTGATAATGG + Intronic
945092169 2:206185867-206185889 AGGAGGAAAGGGGATGTATAAGG - Intronic
945160794 2:206888439-206888461 AGGAAGAAATGGGGTGATGTTGG + Intergenic
945570593 2:211462555-211462577 AGGAAGAAAAGGGTTTTTTAAGG + Intronic
947037755 2:225878844-225878866 AGGAAGAAAGGAAGTGAGGAAGG - Intergenic
948581051 2:238987320-238987342 AGGATGCAAGGGGGTGAGAAGGG - Intergenic
1169002302 20:2176917-2176939 AGGGAGAGAGGGGATGATGAAGG - Intronic
1169067130 20:2700375-2700397 AGAAAGAAAGGGGGAGAGAAGGG - Intronic
1169784458 20:9344151-9344173 AGGAGGAAAGAGAGAGATTAAGG - Intronic
1169807081 20:9570691-9570713 AGGAAGACACAGGGTGATAATGG - Intronic
1170318599 20:15069521-15069543 AGGAAGGAAGGAATTGATTAGGG + Intronic
1171959955 20:31486125-31486147 ATGAAGAAAGGAGGGGATGAGGG - Intergenic
1172184616 20:33023595-33023617 AGGAAGGAGGGGGGAGATGAGGG - Exonic
1172433707 20:34913676-34913698 ATGAAGAAAGGGGTTGCTCATGG - Intronic
1172454371 20:35056138-35056160 AGGTTGAAAGGTGGTGATAAGGG - Intronic
1173277640 20:41598493-41598515 AAGTAGAAAGGGGATGATTTGGG - Intronic
1173706626 20:45114989-45115011 AGGAAGAAGGGAGGTGAGTGCGG - Exonic
1174140841 20:48412590-48412612 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1174856467 20:54050166-54050188 AGTAGGAAAAGGTGTGATTATGG - Intronic
1174976533 20:55341901-55341923 AAGAGGAAAGGGAGTGATGAAGG + Intergenic
1175100252 20:56574348-56574370 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1175392547 20:58636229-58636251 AGGAAGGAAGGGGGGGAGGAAGG + Intergenic
1176136557 20:63525000-63525022 AGGATGGAAGGGTGTGATCAAGG + Intergenic
1178443234 21:32615279-32615301 AGGAAGAAAAGGGGTGGATGGGG + Intergenic
1179087869 21:38236480-38236502 AGGAAGAAACGGCATGTTTATGG - Intronic
1179452061 21:41474154-41474176 AGGAAGTAAGGGGGTGAGTGAGG + Intronic
1181372870 22:22431920-22431942 ATGAAGAAAGGGAGAGATTTGGG + Intergenic
1181593194 22:23896953-23896975 AGGAACAAAGGGGGTGTCTGTGG + Intronic
1181751368 22:24991311-24991333 AGGAAGAAAGGGGCTGGGCATGG - Intronic
1181829288 22:25546507-25546529 AGGAAGAGAGGGGGAGAGGATGG - Intergenic
1181943040 22:26493722-26493744 AGGTAAAATGGGGCTGATTAAGG + Exonic
1182803673 22:33052470-33052492 AGGAGGAAAGGAGGAGAGTATGG + Intronic
1182956974 22:34435761-34435783 TGGAAGAGAGGGGCTGTTTAGGG + Intergenic
1184897741 22:47421708-47421730 AGGAAGAAGAGGGGATATTATGG - Intergenic
949212691 3:1524518-1524540 AGGGAGTAAGGGGGAAATTAAGG - Intergenic
949246273 3:1928363-1928385 AGGGAGAAAGAGGATGAATAGGG + Intergenic
950935129 3:16831776-16831798 AGAAACAAAGGGGGTGACAAGGG + Intronic
951091809 3:18582599-18582621 AGGAAGAAAGGAGCAGATGATGG + Intergenic
951365416 3:21775424-21775446 AGGAAGAAAGTGGGGGATAAAGG + Intronic
951541105 3:23782949-23782971 GCAAAGAAAGGGGGTGATTGGGG + Intergenic
952010322 3:28893401-28893423 AGGAAAAAAGAGGGGGAATAAGG + Intergenic
952558351 3:34559665-34559687 AGGAAGGAAGGGAGTGAGGAAGG - Intergenic
953388219 3:42519132-42519154 AGGAAGAGAGTGGGTGCCTATGG + Intronic
953639014 3:44688239-44688261 AGGGAGAAAGGGGGTGGTAATGG - Intergenic
953855600 3:46497322-46497344 AGGAGGAAGAGGGGAGATTAGGG - Intergenic
955104321 3:55882205-55882227 AGGAAGCAAGGTGGAGATGAGGG - Intronic
955225977 3:57060702-57060724 AGGAAGAGTGGGGGAGATGAGGG - Exonic
955984266 3:64556749-64556771 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
957377510 3:79377688-79377710 ACGGAGAAAGGTGGTCATTAGGG + Intronic
957740745 3:84265041-84265063 AGGAAGGAAGGGAGTGAGTGGGG - Intergenic
957840424 3:85661477-85661499 AGGAAGCAAGGAGGTGCCTAAGG - Intronic
958748953 3:98172200-98172222 TGAAAGAAATGGGGTGATTATGG - Intronic
959139873 3:102472789-102472811 AGGAAGTAAGAAGGTAATTAAGG - Intronic
960115528 3:113888336-113888358 AGGAAGAAATGGGGAGATGTTGG + Intronic
961117249 3:124341083-124341105 AGGAAGAAAGGGGGTGATTAGGG + Intronic
961623935 3:128246364-128246386 AGGCAGAAGGGGGAGGATTAGGG - Intronic
962752270 3:138442040-138442062 AGGAATAGAGTGGGTGATTCTGG - Intronic
963736099 3:149019425-149019447 AGCAAGACAGGGGGTGAGTGGGG - Intronic
967639827 3:191848610-191848632 AAGAAGGAAGGGAGGGATTAAGG + Intergenic
968618407 4:1592693-1592715 TGGAAGGAAGGAGGTGATTGAGG + Intergenic
968894187 4:3389211-3389233 CAGAAGAAAGGGGCTGATAATGG + Intronic
969493258 4:7511913-7511935 AGGGAGAAAGGGTGGGATTTGGG - Intronic
969548466 4:7848118-7848140 AGGAAGGAAGGGAGTGAGTGAGG + Intronic
970642686 4:18084803-18084825 AGGAAGAAAAGGGGAGAATCAGG + Intergenic
972185574 4:36523876-36523898 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
972298380 4:37761954-37761976 AGGAATAAGGGGAATGATTATGG - Intergenic
973197598 4:47463452-47463474 AGGAGGAAGGGGCGTGATTTCGG - Intronic
973607048 4:52598437-52598459 AGGGAGAAGGGGTGTGATCATGG - Intronic
975143746 4:70944770-70944792 AGAGAGAAAGGGGGAGAGTAGGG + Intronic
975589761 4:75988281-75988303 ATGAGGAAAGGGGGTGAATTTGG - Intronic
976346799 4:84013016-84013038 AGTAAGAAAGGTGGCGAGTAAGG + Intergenic
976828868 4:89290443-89290465 TGGAAAAAAGTGGGTGAATAAGG + Intronic
976858499 4:89632537-89632559 AGGAAGAAAGGGAGAGAGGAAGG + Intergenic
977770366 4:100850822-100850844 AAGAAGAAAGGGGGAGAAAATGG - Intronic
977959419 4:103068957-103068979 AGGAAAAATGGGGGTGGTTGTGG - Intronic
978277375 4:106968057-106968079 ATGAAGAAAGGGGGAGAGAAAGG + Intronic
979404068 4:120287316-120287338 TGGAAGAAATGGGATGTTTAAGG + Intergenic
980713785 4:136605868-136605890 AGGAAGAAATGGCATCATTAGGG - Intergenic
981194883 4:141907249-141907271 AAAAGGAAAGGTGGTGATTAAGG - Intergenic
981600636 4:146484558-146484580 AGGAAGAAATGGGGAGATGTAGG + Intronic
981609948 4:146582616-146582638 AGGAAGCAAGGATGTGTTTAGGG + Intergenic
981690336 4:147500840-147500862 AGGAAGAAAGGGAGGGAGCATGG + Intronic
981792079 4:148549497-148549519 AGGAACACAGAGGGTGTTTAGGG + Intergenic
982514403 4:156326698-156326720 AGGAAGAAAGAGTGTGACTGGGG + Intergenic
983318192 4:166159906-166159928 AGGGAGAAAGGGACAGATTATGG + Intergenic
983392448 4:167149988-167150010 AGGATGAAATTGGGTGATTTGGG + Intronic
984810819 4:183795608-183795630 AGGAAGAAAGGAAGTGATGGTGG - Intergenic
984830187 4:183965844-183965866 ATGAGGGAAGGGGGTGGTTAGGG + Intronic
984830413 4:183967469-183967491 AGGAAGAAAGGGGAACATGATGG + Intronic
986008638 5:3690889-3690911 TGGAAGAAAAGGGATGACTAAGG - Intergenic
986054216 5:4119805-4119827 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
986352045 5:6889396-6889418 GTGAAAAAAGGGGGTGATTGAGG + Intergenic
986850739 5:11810316-11810338 AGGAAGAAAGGGCTTCATGAAGG + Intronic
987378139 5:17256975-17256997 AGGTAGAAAGGTTGTGATAAAGG - Intronic
987568614 5:19625907-19625929 AGGAAGAAAAGGGGGGAAAAGGG - Intronic
988000914 5:25347167-25347189 AGGAAGAAAGAGAATGATGAAGG - Intergenic
989440984 5:41471986-41472008 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
989450714 5:41583498-41583520 AGGGAGGAGGGTGGTGATTAGGG + Intergenic
990143742 5:52734947-52734969 AGAAAGCAAGGGGGAGAGTAAGG + Intergenic
990879174 5:60520660-60520682 AGGAGGAAAGGGCTTGATTCAGG + Intronic
990939275 5:61185647-61185669 TGGAAGAAAAGTGGTGTTTAAGG + Intergenic
991329432 5:65477734-65477756 AGGGAGCAAGGGAGTGATAAAGG - Intronic
992186439 5:74249041-74249063 AGGAAGGAAGGGAGTGAGGAAGG + Intergenic
992986170 5:82232652-82232674 AGAAAGAAGGGGCTTGATTAGGG - Intronic
993498034 5:88630312-88630334 GGGAAGGAATGGGGTGAGTATGG + Intergenic
993962653 5:94319174-94319196 AGGGAGAGAGGGAGTGATCAAGG - Intronic
994613131 5:102071323-102071345 AGGTAGAAATATGGTGATTAGGG - Intergenic
994711127 5:103265417-103265439 GGGAGGAAGGGGGGTTATTACGG + Intronic
995689465 5:114807808-114807830 AGGGAGAAATGGGGAGTTTAAGG + Intergenic
996029535 5:118689564-118689586 AGGGAGAAAGGGACTGATTTAGG + Intergenic
996169553 5:120272512-120272534 AGGAAGAAAGGGAGGGAAGAAGG + Intergenic
996528965 5:124507434-124507456 AGCAAGCAAGGGGGTAAGTATGG + Intergenic
996951596 5:129133227-129133249 AGGAAGAAATGGGGTAATTCAGG + Intergenic
997632504 5:135379373-135379395 AGGAAGAAAGGGAGGGATCCAGG + Intronic
998151445 5:139759720-139759742 CGGAAGAATTGGAGTGATTAGGG - Intergenic
999381882 5:151127082-151127104 AGGAAGAAAGGGGAGGCTGAAGG - Intronic
1000663683 5:163968072-163968094 AGAAAGAAAGAGAGTGAGTAGGG - Intergenic
1000712517 5:164599069-164599091 AGGAAGAAAGGAGGGAATGAAGG - Intergenic
1000778514 5:165449275-165449297 AGGAGGAAAGGGGGAGATGTTGG + Intergenic
1001201350 5:169720449-169720471 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
1002771757 6:296112-296134 AGGAAGAGAGGAGGTGATTTTGG - Intronic
1003321274 6:5054167-5054189 AGGAAGAAAAGGGGTGGGAAAGG + Intergenic
1004300286 6:14451564-14451586 GAGAAGAAAGGGGGTGATGTTGG + Intergenic
1004447067 6:15710162-15710184 AGGAAGGAAGGGAGTGAGTGAGG - Intergenic
1004753284 6:18585207-18585229 AGGAAGATGGGGGGAGATAAAGG - Intergenic
1005168823 6:22957612-22957634 AGGAAGAAAGGAACTGATGAGGG - Intergenic
1006338723 6:33434042-33434064 AAGAAGAAAGGGGGAGACAAAGG - Intronic
1006516207 6:34547018-34547040 AGGCAGGCAGGGGGTGATGAAGG - Intronic
1006599076 6:35213975-35213997 AGGCAGAAAGGGCGTGTTTCTGG + Intergenic
1007254933 6:40522012-40522034 AGGAAGACAGGGAGTCTTTATGG + Intronic
1007428346 6:41761453-41761475 GGGAAGAAATGGAGTGAGTAGGG - Intergenic
1007476135 6:42121366-42121388 AGGAAGAAAGGGAGGGAAGAAGG + Intronic
1007753397 6:44083436-44083458 AGCAGGAAAGGGGGTGAATCTGG + Intergenic
1007928474 6:45669028-45669050 AGGGAGAAAGGAGGTGCTGAAGG + Intergenic
1009632780 6:66220554-66220576 AGGAAGGAAGGGGGGGATGGAGG - Intergenic
1009694487 6:67083554-67083576 AGGAAGACAAGGGGAGATTTTGG + Intergenic
1010288543 6:74108489-74108511 TGAATGAAAGGGGGTTATTAGGG + Intergenic
1010453161 6:76026155-76026177 AGGAAGAAAAGGGGAAAATAGGG - Intronic
1011978420 6:93337929-93337951 AGGAAGAAATGGAGTGAGGATGG + Intronic
1012269997 6:97197359-97197381 AGTAAAAGAGGGGGAGATTATGG + Intronic
1012586981 6:100935459-100935481 AGGGAGAAAGGGAGTGAGAAAGG - Intergenic
1012760753 6:103297594-103297616 AGGGAGAAAGGGGATGGTAATGG - Intergenic
1013173867 6:107661201-107661223 AGGAGGAAAAGGGGTGCTGATGG - Intergenic
1013323539 6:109021042-109021064 AGGCAGTAATGGGGTGATCATGG + Intronic
1014851252 6:126341845-126341867 AGGAAGAAAGGGGTAGATGTGGG - Intronic
1015367992 6:132418624-132418646 AGCAAGAAAGAGGATTATTATGG + Intergenic
1016933261 6:149429351-149429373 AGGAAGAAAGGGCTTCATAAGGG + Intergenic
1017664289 6:156704264-156704286 AGGAAGAAATGCTGTGAATAGGG - Intergenic
1017724219 6:157265666-157265688 AAGAAGAAAGGGGGAGCTTTGGG - Intergenic
1017991801 6:159495241-159495263 AGGGAGCTAGGGGGTGATGAAGG - Intergenic
1018457171 6:163962806-163962828 AGGAGGAAATGGTGTAATTAAGG - Intergenic
1019035374 6:169051407-169051429 AGGAGGAAACGGGGAGATTATGG - Intergenic
1020876561 7:13702257-13702279 AGGAAGAAAGGGGGGAAGGAGGG - Intergenic
1020882699 7:13782297-13782319 AGGAGGAAAGGGGGATTTTAAGG - Intergenic
1021574240 7:22093139-22093161 AGCAAGAAAGGGGGACCTTATGG - Intergenic
1021773348 7:24026958-24026980 AGGAAGAATGGAGGTGACTTTGG + Intergenic
1022646548 7:32235288-32235310 AGGGAGAAAGTGGGGGATGAAGG + Intronic
1022846103 7:34211422-34211444 AGGAAGAAAGGGTGGGAGGAAGG - Intergenic
1022860699 7:34363571-34363593 AGGAAGAAAGGGAGAGATAGTGG - Intergenic
1023565720 7:41522069-41522091 AGGAAGGAAGGGAGTGAGGAAGG + Intergenic
1023724954 7:43133648-43133670 AGGAAGAGAGGGAGAGAGTAAGG - Intronic
1024294090 7:47829027-47829049 AGGAAGAAAGGGAGGGAGGAAGG + Intronic
1024600456 7:50975916-50975938 AGGAAGAAAGAGGAAGATTTGGG + Intergenic
1025245927 7:57317295-57317317 AGGAAGAAAGGGGGGAAGAAAGG - Intergenic
1025251663 7:57355287-57355309 AGGAAGAAAGGGAGAGAGCATGG - Intergenic
1025746429 7:64246781-64246803 AGGAAGGAAGGGAGGGATTTTGG + Intronic
1026658241 7:72276040-72276062 AGGAGGAAGGGGGGAGAATATGG + Intronic
1027345552 7:77255831-77255853 AATAAGAAAGTGGGGGATTAAGG + Intronic
1027634783 7:80657671-80657693 GGGAAAAAAGGGGGAGATTGAGG + Intronic
1027683969 7:81257705-81257727 AGGAAGGAATGGGGAGATAATGG + Intergenic
1027720808 7:81739266-81739288 AGAAATAAAGAGTGTGATTAAGG - Intronic
1027919906 7:84379632-84379654 ATGAAATAAGGGGGTGATTTAGG - Intronic
1028154068 7:87409495-87409517 GGGGAGAAAGGGGATGATTAAGG - Intronic
1030273305 7:107693088-107693110 AGGAAGGAAGGGAGGGATAAGGG + Intronic
1030579589 7:111337350-111337372 AGTAATTAATGGGGTGATTATGG - Intronic
1031072889 7:117181713-117181735 AGGAAAAAAGATGGTGATTGGGG + Intronic
1031819182 7:126477679-126477701 AGGAAGGGAGGGAGTGATGAAGG + Intronic
1031992942 7:128209683-128209705 AGGAAGAAAGGCTGGGTTTACGG + Intergenic
1032196610 7:129792928-129792950 AGGAGGAGAGGGGGTCATTGTGG + Intergenic
1032656313 7:133934367-133934389 AGGTTGTTAGGGGGTGATTATGG + Intronic
1032950392 7:136902554-136902576 AGAAAGAAAGTGGCTGCTTATGG - Intronic
1033460055 7:141538735-141538757 GAGAAGAAAGGGGGTAATTTTGG + Intergenic
1033609877 7:142954663-142954685 ACAAAGAAAGGGAGGGATTAAGG + Intronic
1035339372 7:158150699-158150721 GGGAAGAATGTGGGTGATCATGG + Intronic
1035824166 8:2626885-2626907 AGGGAGAAGGGGGGTTCTTAAGG + Intergenic
1036182600 8:6598137-6598159 AGGAGGAAAGGGGATGCTTCTGG + Intronic
1036740056 8:11352834-11352856 GGGAGGAAAGGGGGTGGTTTCGG - Intergenic
1037525958 8:19724462-19724484 AGAAAGAGAGGTGGTGATGAAGG - Intronic
1037593381 8:20332343-20332365 AGTAAGAAAAGGGGTGTATATGG - Intergenic
1039060821 8:33570899-33570921 AAGATGAAAGGAGGTGATTCAGG - Intergenic
1039378849 8:37065887-37065909 AGGAAGAAATAGGGTGATACTGG + Intergenic
1039514494 8:38120589-38120611 GAGAGGAATGGGGGTGATTAGGG - Intronic
1039635430 8:39159560-39159582 AGGAAGAAAGAGGCTGAGGAAGG - Intronic
1039719751 8:40150611-40150633 AGAAAGAAAAGGAGTTATTAAGG + Intergenic
1040855583 8:51945317-51945339 AGGAAGAAAGGGAATGAGGAGGG - Intergenic
1040931369 8:52738655-52738677 AGGAAGAAAGGGAGGGAGGAAGG - Intronic
1041854918 8:62440659-62440681 AGGAAGGAGGGGAGTGAGTATGG - Intronic
1042089645 8:65144848-65144870 AGGAAGAAAGGGGGCAAGGAAGG - Intergenic
1042266597 8:66914897-66914919 GGGAGGAGAGGGGGTAATTAAGG + Intronic
1042852757 8:73233136-73233158 AGGAAGAAAGGAGGAGAAGAAGG - Intergenic
1043602051 8:81952562-81952584 AGGAAGGAAGGGAGGGAGTAAGG - Intergenic
1043662138 8:82757051-82757073 AGAAAGAAAGGGGGTGGGGAGGG + Intergenic
1043869315 8:85413908-85413930 AGAAAGAAATGGGGTGATGTTGG - Intronic
1043981227 8:86642034-86642056 AGGAAGAGAGAGGGGGAGTAAGG - Intronic
1044109681 8:88256650-88256672 AGAGAGAGATGGGGTGATTATGG - Intronic
1044537517 8:93374401-93374423 TGGAAGTAAGGGGGTTATTGTGG + Intergenic
1045228050 8:100270646-100270668 AGGAAGGAAGGAAGAGATTAAGG + Intronic
1045861642 8:106820455-106820477 AGGAAGAAAGAGGGAGAGAAAGG - Intergenic
1047750526 8:127877023-127877045 TGGAACAAAGGTGGTGCTTATGG + Intergenic
1047806102 8:128361636-128361658 AGGAAGAAAGGTACTGGTTAAGG - Intergenic
1048060754 8:130917176-130917198 AGGATGAAATGAGGTTATTAAGG - Intronic
1048382957 8:133884316-133884338 AGGAAGGAAGGGGGGGAGGAAGG + Intergenic
1048954822 8:139527007-139527029 AAATAGGAAGGGGGTGATTAGGG + Intergenic
1050698171 9:8302790-8302812 AGGAAGCAAGAGGGAGATGAAGG - Intergenic
1051056332 9:12991559-12991581 AGGAATAGAGGGAGTGAGTATGG + Intergenic
1051140562 9:13974695-13974717 AGGAAGAAGGGGGGTCAAGAGGG - Intergenic
1051395589 9:16616727-16616749 AGGAAGAAAGGGGGAAAGGAAGG + Intronic
1051757082 9:20413539-20413561 AGGAAGAAATGAAGTCATTAAGG - Intronic
1051789573 9:20785391-20785413 AGGAAAAAAGGGGGGAATTAGGG - Intronic
1052417221 9:28191555-28191577 TGGAAGAAAGGGGGTTAAGAGGG - Intronic
1052838065 9:33265905-33265927 AGGAAGAAAAGAGGAGCTTAAGG - Intronic
1053011235 9:34634956-34634978 AGGAAGAATGGGGGTCTTTCTGG + Exonic
1053849151 9:42272653-42272675 AGGAAGCAAGGGCGTGAGCAGGG - Intergenic
1054810449 9:69430059-69430081 AGGCAGCAAGAGGGTGTTTATGG + Exonic
1055038216 9:71840807-71840829 AGGAAGAATGGGAGAGATGAAGG + Intergenic
1055263692 9:74471159-74471181 AGGAAGAAGAGGAGTGATGAAGG + Intergenic
1056448913 9:86695768-86695790 TGGAAGAAACTGGGTGATCAGGG - Intergenic
1057317436 9:93978822-93978844 AGGAAGAGAGGTGGTGACAATGG - Intergenic
1058433048 9:104935985-104936007 TGGTAGAATGGGGGTGAGTAAGG - Intergenic
1059105584 9:111508785-111508807 AGGAAAGAAGGGGGTGATAGAGG - Intergenic
1060742158 9:126106252-126106274 GGTAAGAAATGGGGTGATTGAGG + Intergenic
1061082522 9:128380425-128380447 AGGAAGACATGGGGTGCTAAAGG + Intronic
1062097984 9:134712502-134712524 AGGAAGAAAGGGGGACAGGAAGG - Intronic
1062161789 9:135084615-135084637 AGGAAGAAAGGGAGGGAGAAGGG - Intronic
1185843687 X:3417169-3417191 AGGAAGAAAGGGAGGGAGAAAGG - Intergenic
1186878121 X:13837509-13837531 AGAGAGAAAGGGGATGAATAGGG - Intronic
1187070909 X:15887358-15887380 AGATAGAAAGGGGGAGATTATGG - Intergenic
1189221032 X:39372117-39372139 GGGAAGAAAGGTGGTGCTTTAGG - Intergenic
1190260704 X:48795155-48795177 AGAATGAGAGGGGGAGATTAGGG + Intergenic
1190547950 X:51549374-51549396 AGGAAGAAAGGGAGGGAGTGAGG - Intergenic
1190636703 X:52441947-52441969 AGGAGGAAATGGGGAGATGAAGG - Intergenic
1192710043 X:73572097-73572119 GGGAAGAAGGGAGGTGAGTAAGG - Intronic
1194066880 X:89271622-89271644 AGGAAGAAAAGGGGGAAATAGGG + Intergenic
1195138658 X:101935882-101935904 AGGAAACAAGGGTGGGATTAGGG + Intergenic
1195735576 X:108009433-108009455 AGGAAGAAAGGATGTGAACAGGG + Intergenic
1196001854 X:110795393-110795415 AGGAATACAGGCAGTGATTAAGG + Intronic
1196893336 X:120310674-120310696 GAGAAGAAAGGGGGGGATGAGGG - Intronic
1197260476 X:124312070-124312092 AGGAAGAAAGGGGATGGTGGTGG + Intronic
1199705876 X:150424543-150424565 AGGAAAAAAGGGTGTGTTGATGG + Intronic
1200165929 X:154035212-154035234 AGAAAGAAGGGGGGGTATTAAGG + Intronic
1202116457 Y:21472963-21472985 AGGAAGAAAGGAGGGGTGTAAGG - Intergenic
1202234150 Y:22690710-22690732 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1202309008 Y:23505456-23505478 AGGAAGAAAGGGAGGGAGGAAGG - Intergenic
1202561792 Y:26165132-26165154 AGGAAGAAAGGGAGGGAGGAAGG + Intergenic
1202603433 Y:26618107-26618129 AGGAAGCAAATGGGTGATTTTGG - Intergenic