ID: 961122797

View in Genome Browser
Species Human (GRCh38)
Location 3:124387250-124387272
Sequence CCAGTGAGGAAACAAGTCTC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 24, 4: 202}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961122797_961122800 21 Left 961122797 3:124387250-124387272 CCTGAGACTTGTTTCCTCACTGG 0: 1
1: 0
2: 1
3: 24
4: 202
Right 961122800 3:124387294-124387316 TCATGTGAAATACTACTAGAAGG 0: 1
1: 0
2: 0
3: 13
4: 138
961122797_961122801 26 Left 961122797 3:124387250-124387272 CCTGAGACTTGTTTCCTCACTGG 0: 1
1: 0
2: 1
3: 24
4: 202
Right 961122801 3:124387299-124387321 TGAAATACTACTAGAAGGAGTGG 0: 1
1: 0
2: 1
3: 12
4: 238

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961122797 Original CRISPR CCAGTGAGGAAACAAGTCTC AGG (reversed) Intronic
903494841 1:23758805-23758827 CCAGTGTAGAAACAGGTCTAAGG - Intronic
904468310 1:30720761-30720783 ACAGTGAGGATACAAGTCCTGGG + Intronic
904567729 1:31437728-31437750 ACAATGAGGCAACAAGTCTGAGG + Intergenic
905466107 1:38154803-38154825 CCAGAGAGTAGACAAGACTCAGG + Intergenic
908113971 1:60923449-60923471 CCAGTCAGGTCACAAGTCTCAGG + Intronic
910237380 1:85048936-85048958 CCAGGGAGGGAACAAGGTTCAGG - Intronic
910371390 1:86519785-86519807 CCAAAGAGGAAATAAGTCACTGG + Intergenic
911272098 1:95814690-95814712 CCTGTGAGGCAACAAGTTCCAGG + Intergenic
914944679 1:152053453-152053475 CCAGTGTGGTTTCAAGTCTCAGG + Intergenic
918350582 1:183651847-183651869 CCAGAGAGGAAACAATGCTCGGG - Intronic
921332086 1:214049695-214049717 TCAGAGAGGAAACAAGATTCTGG + Intergenic
923556502 1:235004860-235004882 TCAGTGAGAAAACAGGTCTGTGG + Intergenic
924004108 1:239588201-239588223 CCAGTGAGTAGACGAGTCTAGGG + Intronic
1062789236 10:290955-290977 TCACTCAGGAAACAAGGCTCTGG + Intronic
1070188825 10:74092848-74092870 CCAGTGTGGATAAAAGTCACTGG - Intronic
1071464371 10:85926137-85926159 ACTGTCAGGAAACAAGTCTCTGG + Intronic
1072284866 10:93904721-93904743 CAAGTGAGGAAAACAGGCTCAGG - Intronic
1074593950 10:114842625-114842647 TTAGTGAGGAAAAAAGTTTCAGG - Intronic
1074792892 10:116909727-116909749 CCAGGTAGAAAACAAGTCTCTGG - Intronic
1074910258 10:117902274-117902296 CCATGGAGTAAACAAGACTCAGG + Intergenic
1075091376 10:119445848-119445870 TCAGTGAGGAAGCCAGTCTCTGG + Intronic
1075125117 10:119693322-119693344 CAAGTGAGGAGACAAGTCATAGG + Intergenic
1075772069 10:124947338-124947360 CCAGTGAGAAAAGCAGTCTATGG - Intronic
1077075914 11:702103-702125 CCAGTGAGGAACCAAGGCTGCGG + Intronic
1080130885 11:28793035-28793057 CCAGTGAGGAAGGATGTGTCAGG + Intergenic
1082079225 11:47999283-47999305 CCAGTAAGCAAGCAAGTCTTGGG - Intronic
1084196200 11:67524540-67524562 CTAGGGAGGATACAAGACTCTGG - Intergenic
1086562955 11:88189022-88189044 ACAGTGAGGTCACAAGTCACTGG + Intergenic
1088697727 11:112382796-112382818 CCAGTGAGGAAAGATGAGTCTGG - Intergenic
1092487742 12:8916792-8916814 GCAGTGAGGAAACAGGTATAAGG + Intronic
1097187360 12:57202944-57202966 CCAGAGAGGACACAGGTCCCTGG - Intronic
1101325820 12:103714964-103714986 CCAGTGAGGGATCAAGTCTAGGG + Intronic
1104340768 12:127946487-127946509 GCAGGTAAGAAACAAGTCTCCGG + Intergenic
1104798626 12:131537617-131537639 CCTGTGAGGAAACTGGTTTCCGG + Intergenic
1105509864 13:21041942-21041964 CCAGAGAGAAAACAAGTCCCAGG + Intronic
1107705185 13:43095801-43095823 CCAGTGTGGAAAAAATACTCTGG - Intronic
1107884707 13:44865786-44865808 CCAGAGAGGAAACAAGAGTGAGG + Intergenic
1109844643 13:67971333-67971355 CCAGTGAAGGAGCAAGTCTGTGG - Intergenic
1109893114 13:68644636-68644658 CCAGTGAAGAAACTATACTCTGG - Intergenic
1110242989 13:73289433-73289455 CCAGTGTGGAAACTTCTCTCAGG + Intergenic
1111770933 13:92594642-92594664 CCAATGGTGAAACATGTCTCAGG + Intronic
1113409473 13:110072342-110072364 GCAGTGAGGAAGCTGGTCTCGGG + Intergenic
1114082808 14:19216227-19216249 CCCGTGGGGACACAAGTGTCAGG + Intergenic
1114277417 14:21159279-21159301 CCCATGAGGAAACAAGTGGCTGG + Intergenic
1114277949 14:21164959-21164981 CCCATGAGGAAACAAGTGGCTGG - Intergenic
1114350513 14:21845356-21845378 CCAGTAAGGAGAAAAATCTCAGG - Intergenic
1114831811 14:26152671-26152693 CCAGAGAGGAAAAAAGAGTCTGG - Intergenic
1116067939 14:40008061-40008083 CCAGTCAGGAAACCAGTGTGGGG - Intergenic
1121204266 14:92148856-92148878 CAAGTGAAAATACAAGTCTCAGG - Intronic
1124079811 15:26481492-26481514 CCTGTGAGGACACCAGTCACTGG + Intergenic
1124704799 15:31954680-31954702 CCAGTGAGGGAAGAAAGCTCAGG + Intergenic
1125427899 15:39568003-39568025 CCAGTTAGCGATCAAGTCTCAGG + Intergenic
1125772618 15:42180089-42180111 ACTGTGAGGAAACAAATTTCTGG + Intronic
1126506475 15:49409762-49409784 CAAGTGATGAAACTAGTCTTAGG - Intronic
1127573292 15:60265185-60265207 CCAGGGAGGAAAGAAGACTTGGG - Intergenic
1128342736 15:66834077-66834099 CCAGTGGGGCCAGAAGTCTCCGG - Intergenic
1128698394 15:69786305-69786327 CAACTGAGGAAACAAGTGCCAGG - Intergenic
1128784908 15:70387671-70387693 CCAGTGAGGAAACTTGTGTCTGG + Intergenic
1132193442 15:99890412-99890434 CCAATGGTGAAACATGTCTCAGG - Intergenic
1133466471 16:6031965-6031987 CCAGTGAGGGAACAATTCAGGGG - Intronic
1134307247 16:13044041-13044063 CCAGTTAGAAAAGAAGCCTCTGG + Intronic
1138577052 16:57914739-57914761 CCAGTGATGAAACGGGTGTCTGG + Intronic
1139868541 16:70084368-70084390 ATAGTGAGGAAACAACTCACAGG - Intergenic
1140386795 16:74547512-74547534 ATAGTGAGGAAACAACTCACAGG + Intronic
1140775144 16:78242641-78242663 CCAGAGAGGAGAGAAGGCTCGGG - Intronic
1147911363 17:43858135-43858157 CCAGTGAGGACAAAAGACTCAGG + Intronic
1148568023 17:48645274-48645296 CCTTTGAGGAAGCAAGTCTGGGG - Intergenic
1150475694 17:65472711-65472733 CTAGAGAGGGAACAATTCTCGGG - Intergenic
1151832204 17:76560146-76560168 CAAATGAAGAAACAAGACTCTGG - Intergenic
1152459123 17:80432143-80432165 CCGGTGAGGAAACAGGTTCCAGG - Intronic
1161651338 19:5487332-5487354 CCAGCCAGGAAACTAGGCTCAGG + Intergenic
1163394811 19:17053620-17053642 CCGATGAGGACACAAGTCACTGG - Intronic
1164815950 19:31203631-31203653 CCAGTGAAGAAACAGCTCTGGGG + Intergenic
1166351626 19:42201550-42201572 CAGATGAGGAAACAAGGCTCTGG + Intronic
925107649 2:1306636-1306658 CCAGTCAGGTCTCAAGTCTCAGG - Intronic
926004337 2:9361230-9361252 CCACTGAGGAAAAAAGACTTGGG - Intronic
926255345 2:11189408-11189430 CCAGGGAGGAATCAAGCCTCAGG - Intronic
926598653 2:14817901-14817923 CTAGTGAGGAAATTAGTCTCCGG - Intergenic
926728883 2:16019777-16019799 CCCATGAGGAAAGAAGTCGCTGG - Intergenic
926750844 2:16197453-16197475 CCAGTGAGAAACCAAGGCTCGGG + Intergenic
927607215 2:24497091-24497113 TAAATGAGGAAACAAGGCTCAGG + Intronic
927638466 2:24832269-24832291 CCAGAGAGGGAACAACTCACAGG + Intronic
929240514 2:39648705-39648727 CCAGAGAAGCAACAGGTCTCAGG + Intergenic
930360144 2:50367565-50367587 AAATTGAGGAAACAAGTCTTTGG + Intronic
930951358 2:57147013-57147035 CCAGTGAGGAAGGATGGCTCTGG - Intergenic
931701676 2:64914180-64914202 CCTCTGAGGAATCGAGTCTCCGG - Intergenic
932278616 2:70470714-70470736 CCAGAGTGGAAACAAGCCTGAGG + Intronic
933271282 2:80235699-80235721 CCAGTGAAGAATCAAGTACCTGG + Intronic
933650612 2:84847116-84847138 CCAGTGAGGAGCCAAGTCCAGGG + Intronic
935214164 2:100963127-100963149 CCACTGAGGAGACAGGGCTCAGG - Intronic
936140914 2:109939300-109939322 CCAGTGAGGATACCAGGCTCTGG - Intergenic
936177605 2:110237245-110237267 CCAGTGAGGATACCAGGCTCTGG - Intergenic
936203779 2:110432186-110432208 CCAGTGAGGATACCAGGCTCTGG + Intronic
937011742 2:118568968-118568990 CCAGGGAGGTAATAAATCTCAGG - Intergenic
938434844 2:131276637-131276659 ACAGAGAGGAAACAAGCCGCAGG + Intronic
938493769 2:131780392-131780414 CCCGTGGGGACACAAGTGTCAGG - Intergenic
938779658 2:134573897-134573919 CCAGGGAGTAAAGAACTCTCAGG + Intronic
939544093 2:143530942-143530964 ACAGTGAGGAAACATTTCTTTGG - Intronic
940291924 2:152085489-152085511 GCAGTGTGAAAACAAGTATCTGG + Intronic
941486419 2:166087498-166087520 CCAGAGAGGAAACAAGAGACAGG - Intronic
943263911 2:185700978-185701000 CCAGTGGGGAAAAAAAACTCAGG + Intergenic
947992644 2:234498602-234498624 CCAGTGAGGTAACAAGGCCTAGG + Intergenic
948486407 2:238284011-238284033 CAAATGAGGACACAAGGCTCAGG - Intronic
948976248 2:241465409-241465431 CCAAGGTGGAAACAAGTCCCAGG - Intronic
1169385848 20:5148773-5148795 CCTGTGAGAAAACAAAGCTCAGG - Intronic
1171401521 20:24875544-24875566 CCAGTGAGGAGAAATGCCTCAGG + Intergenic
1173038939 20:39442023-39442045 CCAGGTAGTAAATAAGTCTCAGG - Intergenic
1173433896 20:43015757-43015779 ACAGTGAGGACACCAGTCTCTGG - Intronic
1173551968 20:43938714-43938736 CCAGTGTGGAAATAAGTCCTGGG - Intronic
1173928527 20:46798986-46799008 CCAGAGAGGACAGAAGTCCCAGG - Intergenic
1176614139 21:9013984-9014006 CCCGTGGGGACACAAGTGTCAGG + Intergenic
1176711052 21:10149903-10149925 CCCGTGGGGACACAAGTGTCAGG - Intergenic
1177830894 21:26137565-26137587 CCAGTGAGGAAAGAGCTCTCTGG - Intronic
1178984829 21:37294052-37294074 TCACTGAGGACACAAATCTCTGG - Intergenic
1179920375 21:44504096-44504118 ACAGTGGGGAAGCAAGGCTCTGG + Intronic
1179920398 21:44504190-44504212 ACAGTGGGGAAGCAAGACTCTGG + Intronic
1179920485 21:44504494-44504516 ACAGTGGGGAAGCAAGGCTCTGG + Intronic
1179920547 21:44504729-44504751 ACAGTGGGGAAGCAAGGCTCTGG + Intronic
1180497972 22:15906442-15906464 CCCGTGGGGACACAAGTGTCAGG - Intergenic
1183221565 22:36517281-36517303 ATGGTGAGGAAACGAGTCTCTGG - Exonic
1183221784 22:36519052-36519074 CCAGTGAGCCAGCAAGTTTCGGG + Intronic
949890474 3:8730146-8730168 TCAGTGAGCTAACAAGTCTAGGG - Intronic
950202784 3:11056774-11056796 CCAGTGAGGACACCTGTCACTGG + Intergenic
950624130 3:14231792-14231814 AAAATGAGGAAGCAAGTCTCGGG - Intergenic
951600345 3:24367436-24367458 CCATTGAGGAAATAAGCCTAAGG - Intronic
952204405 3:31165604-31165626 CCACTGAGTAAACCAGTCCCTGG + Intergenic
952840333 3:37640711-37640733 CCAGGGAGGAAAGAAGCCCCGGG - Intronic
953744663 3:45565115-45565137 CCAGTGAGGAAGGCTGTCTCTGG - Intronic
955701047 3:61682503-61682525 CCAGTGAGGAAAAAGGTAGCTGG + Intronic
957584330 3:82114609-82114631 CCAGTGAGGAAGGATGTGTCAGG + Intergenic
958478664 3:94618689-94618711 CCAGTGAGAATAAAAGTCTCAGG + Intergenic
960233457 3:115255045-115255067 CCAGTGAGGAAGGATGTGTCAGG - Intergenic
960502547 3:118454951-118454973 CCAGTGAGGAGAAATGTATCTGG + Intergenic
961122797 3:124387250-124387272 CCAGTGAGGAAACAAGTCTCAGG - Intronic
962404489 3:135089199-135089221 CCAGTAAGCTATCAAGTCTCTGG + Intronic
964141091 3:153400437-153400459 CCATTGAAGAAACAAGTGTGAGG + Intergenic
964384021 3:156128001-156128023 CCAGTTAGGAAAGAACCCTCTGG - Intronic
964470394 3:157047373-157047395 CCAGTGAGGTAGAAAGTCTGGGG - Intergenic
964615619 3:158661290-158661312 CAAGTGTGGAAGCAGGTCTCAGG - Intronic
964670203 3:159216657-159216679 TCAGTCAAGAAACAAGTCACAGG - Intronic
967408476 3:189143338-189143360 ACAATGAGGACACAAGTTTCAGG + Intronic
968245614 3:197143933-197143955 CCACTGGTGAAACAAGTCCCTGG + Intronic
972191296 4:36594353-36594375 GCAGTGAGGAAGCAGGTCTGGGG - Intergenic
972613127 4:40673522-40673544 CCAGTGAGGAAACAAGGCCTCGG - Intergenic
973956806 4:56070621-56070643 CAAGTCAGGAAAGAATTCTCAGG - Intergenic
974499703 4:62684252-62684274 CCAGTGAGGAGAGATGGCTCAGG - Intergenic
974828408 4:67158847-67158869 ACAGTGAGGAAACAACTGACAGG + Intergenic
977269334 4:94897020-94897042 CCTGTGAGGAAAAATATCTCAGG - Intronic
978657927 4:111088625-111088647 CCTCTGAGGAAACCAGTGTCAGG + Intergenic
981115262 4:140982655-140982677 CCAGTCAGAAAACATGTCCCTGG + Intronic
981291491 4:143081885-143081907 CTACTTAGGAAACAAATCTCAGG + Intergenic
982020327 4:151196475-151196497 CCAGAGATGAAAAAATTCTCAGG + Intronic
983550434 4:169011860-169011882 ACAATGAGGAAACAAGCCTGAGG + Intergenic
985142904 4:186861198-186861220 CCAGTGAAGCAATAAGACTCTGG - Intergenic
985528564 5:420599-420621 CCCATGAGGAAACATTTCTCAGG + Intronic
987937652 5:24487969-24487991 CCATTGAGGAAAAAAAGCTCCGG - Exonic
996023746 5:118620455-118620477 CCAATGAGGAAACCTGACTCAGG + Intergenic
997587891 5:135054605-135054627 ACAGGGAGGAATCAAGTCCCAGG - Intronic
999272930 5:150308054-150308076 CCAGTGATGACAGAAGCCTCTGG - Intronic
1001591886 5:172871242-172871264 CCAGTGAGGTCAGAGGTCTCGGG - Intronic
1002452892 5:179329824-179329846 CCATTAAAGAAACAAGTTTCAGG + Intronic
1002485214 5:179530488-179530510 GCAGTGAGGAAACCAGGCTCCGG - Intergenic
1004760116 6:18656786-18656808 CCAGTGAGGAAGGATGTGTCAGG - Intergenic
1005605124 6:27469317-27469339 CTAGTGAGGGAAGATGTCTCTGG + Intronic
1005763221 6:28986700-28986722 CCAGAGAGAAAATCAGTCTCTGG + Intergenic
1005768429 6:29038874-29038896 CCATTTAGGGAACAAGTCTTGGG + Intergenic
1006095207 6:31652060-31652082 CCGGTGATGACACTAGTCTCTGG - Intronic
1008087181 6:47257505-47257527 CCAGTGAGGAGACCAGACTGGGG + Intronic
1008689710 6:53964360-53964382 CCAGAGACCAAACAAATCTCTGG + Intronic
1008762376 6:54867967-54867989 CCAATGAAGGAACAAGTATCTGG - Intronic
1009298496 6:61985052-61985074 CCAGTAAGGTAACAAGCCACAGG - Intronic
1010497205 6:76549422-76549444 GCAGTGAGGAAACAAGAATCAGG - Intergenic
1010631102 6:78199377-78199399 CCAGAGAGGAAACAAGGGTGGGG - Intergenic
1010776928 6:79897791-79897813 GCAGGGAGGAAACAGGTCTGTGG - Intergenic
1012789229 6:103672541-103672563 CCAGTCAGGAAACAAAGCTATGG - Intergenic
1012915508 6:105166142-105166164 CCAATGAGGAAACCAGTCTAAGG - Intronic
1013806904 6:114006450-114006472 CCATTTAGGGAGCAAGTCTCAGG + Intronic
1020715489 7:11669877-11669899 TCAGTGAGGCAACAAAGCTCTGG - Intronic
1021155699 7:17207127-17207149 CTATTGAGGAAAATAGTCTCAGG - Intergenic
1022497591 7:30862692-30862714 CCAGTGAGGTGGCAAGTCACAGG + Intronic
1025262532 7:57428732-57428754 CCAGTGAGCGATCAAGACTCAGG - Intergenic
1026928061 7:74207421-74207443 CCAGTGAGGAAGCCAGGCTTTGG + Intronic
1026971852 7:74473286-74473308 CAAGGGAGGAACCCAGTCTCAGG + Intronic
1028974611 7:96897841-96897863 CCAGTGATTACAGAAGTCTCAGG - Intergenic
1030646298 7:112065342-112065364 CCAGAGAGGGAAGCAGTCTCAGG - Intronic
1035269161 7:157709870-157709892 TCAGTGAGCAGACAAGGCTCTGG + Intronic
1035309565 7:157956718-157956740 CCACAGAGGAATCAAGTTTCAGG + Intronic
1035396205 7:158536658-158536680 CCATTGACAAAACAAGACTCAGG + Intronic
1037833577 8:22203082-22203104 CCTGTGAGGTATCAAGTCCCAGG - Intronic
1038050132 8:23801232-23801254 TCAAAGAGGAAACAAGTGTCTGG + Intergenic
1038162866 8:25056642-25056664 CTCGAGAGTAAACAAGTCTCAGG - Intergenic
1038167222 8:25097518-25097540 CCAGTGAGAAAACAGTTCACTGG + Intergenic
1042551735 8:70000141-70000163 CCAGTCAGGGAAGGAGTCTCTGG + Intergenic
1042881715 8:73499811-73499833 CCAGTGAGAAAACAAGTCCCAGG + Intronic
1047416816 8:124671310-124671332 ACTGTGAGGAGACAGGTCTCTGG - Intronic
1047610366 8:126514961-126514983 CCAGTGAGGAAAAAAGTTACAGG - Intergenic
1048327566 8:133451075-133451097 CCAGGGAGGCCACAGGTCTCTGG - Intergenic
1048527075 8:135213004-135213026 GCAGTGTGGAAACAAGCTTCAGG + Intergenic
1048630302 8:136234957-136234979 CCAGTGAAGAAACATATGTCAGG - Intergenic
1049237775 8:141521008-141521030 CTACTGAGGAAACTAGTCTGAGG - Intergenic
1050841769 9:10158603-10158625 CCAGGGAGGAAACAGTTCCCTGG + Intronic
1051589254 9:18759535-18759557 CCAGGGAGGAAAAAACTCTTAGG + Intronic
1053648042 9:40135598-40135620 CCCGTGGGGACACAAGTGTCAGG - Intergenic
1053665791 9:40316714-40316736 ACATTGAGGAAACAAGTTTTGGG - Intronic
1053757696 9:41328247-41328269 CCCGTGGGGACACAAGTGTCAGG + Intergenic
1053892757 9:42711170-42711192 CCAGGGTGGAAATTAGTCTCTGG - Intergenic
1054376946 9:64456743-64456765 ACATTGAGGAAACAAGTTTTGGG - Intergenic
1054518820 9:66059569-66059591 ACATTGAGGAAACAAGTTTTGGG + Intergenic
1054536538 9:66240573-66240595 CCCGTGGGGACACAAGTGTCAGG + Intergenic
1056005470 9:82265843-82265865 CCAGGGAGCAAACAAGCTTCTGG - Intergenic
1056503139 9:87230515-87230537 CGAGGGAGGAGCCAAGTCTCAGG - Intergenic
1058100986 9:100917390-100917412 ACAGTGAGGAAACAAGCTGCAGG - Intergenic
1059760187 9:117330222-117330244 CCAAAGAGGGAACAATTCTCAGG + Intronic
1059902697 9:118945771-118945793 CCACTAAGGAGACATGTCTCTGG + Intergenic
1061264055 9:129495600-129495622 CCGGGGAGGAAACAGGGCTCAGG - Intergenic
1202795809 9_KI270719v1_random:118892-118914 CCCGTGGGGACACAAGTGTCAGG - Intergenic
1186235480 X:7504006-7504028 CCAGAGAATAAACAGGTCTCTGG - Intergenic
1187115343 X:16344186-16344208 TCAGTCATAAAACAAGTCTCAGG - Intergenic
1187269962 X:17770932-17770954 CCTGTGTGGAAATGAGTCTCAGG - Intergenic
1187649232 X:21382015-21382037 CCAGTGTGTAAAAAAGTATCTGG + Intronic
1188092169 X:25977170-25977192 CCAGTGAGGAAGGATGTGTCAGG - Intergenic
1192852091 X:74967895-74967917 CCAGTGAACAAATAAGGCTCAGG - Intergenic
1193423695 X:81315759-81315781 CCAGTGAGTATACCAGGCTCTGG + Intergenic
1194438999 X:93906216-93906238 CCAGCGAGGCTACAAGGCTCTGG + Intergenic
1197380149 X:125729054-125729076 CCAGTCAGGAAACCAGTGTGGGG + Intergenic
1197460906 X:126739649-126739671 AAAGTGAGAAAATAAGTCTCTGG + Intergenic
1199860413 X:151796297-151796319 CCAATGAGGAATCAGGCCTCAGG - Intergenic
1202092536 Y:21208943-21208965 CCAGTGAAGAAAGATGTGTCAGG - Intergenic