ID: 961123179

View in Genome Browser
Species Human (GRCh38)
Location 3:124391561-124391583
Sequence CATGTTCTTCAGCGCTAAAT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 116
Summary {0: 1, 1: 0, 2: 0, 3: 2, 4: 113}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961123179 Original CRISPR CATGTTCTTCAGCGCTAAAT CGG Intronic
900809957 1:4794391-4794413 CCTGCTCTTCAGAGCTAATTAGG - Intergenic
902101025 1:13989175-13989197 CATGGTCTTCAGCTCTCATTAGG + Intergenic
903737090 1:25536974-25536996 CAGGTTCCTCAGCTCTAAAATGG - Intergenic
903878191 1:26490682-26490704 CATGTTATTCAGCTGTAAAATGG - Intergenic
906536885 1:46555929-46555951 CAGTTTCTTCAACTCTAAATGGG - Intergenic
909124940 1:71656045-71656067 CATTTTCTTCAGTTATAAATGGG - Intronic
909232891 1:73114828-73114850 CATGTTCTTCAACTTTAAAATGG + Intergenic
914331434 1:146674258-146674280 GTTGTTCTTCAGGGCTGAATTGG - Intergenic
916871120 1:168915933-168915955 CATCTTCTTCAGCTGTAAAATGG + Intergenic
917820833 1:178762083-178762105 CATGTTCTTCACTAATAAATAGG - Intronic
920780066 1:208981234-208981256 CACTTTCTTCAGCTCTAAAATGG + Intergenic
920975245 1:210779885-210779907 GATGTTCTTCAGTCCTACATTGG - Intronic
1064391013 10:14942208-14942230 CATGTGCTTCAGAGCCAAAGCGG + Intronic
1064401376 10:15024217-15024239 CATGTGCTTCAGAGCCAAAGCGG + Intergenic
1067589672 10:47498337-47498359 AATGTTCTTCAGCCTTAAAAAGG - Intergenic
1070018444 10:72559235-72559257 CATCTTCTTCAGAGGTAAACTGG - Intronic
1070841986 10:79493780-79493802 CATGTTATTCAGCCATAAAAAGG - Intergenic
1072363258 10:94681871-94681893 CATGTGCTTCAGTGGTGAATGGG - Intergenic
1073166986 10:101463676-101463698 CATTTTCTTCATCTATAAATTGG - Intronic
1073835840 10:107440880-107440902 CATTGTCTGCAGAGCTAAATGGG - Intergenic
1075139952 10:119823726-119823748 AATTTCATTCAGCGCTAAATGGG + Intronic
1079016025 11:16869439-16869461 CAGGTTCTTCATCTCTAAAATGG + Intronic
1079579540 11:22046166-22046188 CACGTGCTGCAGCTCTAAATAGG + Intergenic
1086176521 11:83897916-83897938 CAGTTTCTTCATCGCAAAATGGG - Intronic
1088891580 11:114048911-114048933 CATTTTCTTCAGCTGTAAAATGG + Intergenic
1096867608 12:54574467-54574489 CATTTTCTTCAACTCTAAAATGG - Intronic
1100151003 12:91737623-91737645 GATGTCCTTCAGCACTAAAAGGG - Intergenic
1106612492 13:31297111-31297133 AATGTTATTCAGCCTTAAATAGG - Intronic
1108763303 13:53596609-53596631 CATGTTCTTGTCTGCTAAATGGG - Intergenic
1110700128 13:78537426-78537448 CATTTTCTTCAGTCCAAAATGGG - Intergenic
1110770296 13:79335297-79335319 CATTTTCTTCACCTCTAAAATGG + Intronic
1112164176 13:96899953-96899975 CATTTTCCTCATCTCTAAATTGG - Intergenic
1112703322 13:102037037-102037059 CATGTTCATCAGTGCACAATTGG + Intronic
1113242077 13:108349365-108349387 CATTTTATTCAGTTCTAAATTGG - Intergenic
1114826653 14:26088910-26088932 CATGTTCTTCTGCTATAAAATGG - Intergenic
1117130421 14:52681283-52681305 AATGTTATTCAGCGTTAAAAAGG + Intronic
1120001203 14:79305110-79305132 CATGTTCTTCATCTGTAAAATGG + Intronic
1124713659 15:32036269-32036291 CATATTATTCAGTGCTAAAAAGG - Intronic
1128745144 15:70108778-70108800 CATATTTTTCAGCTCTAAAAAGG + Intergenic
1130770615 15:86920011-86920033 AATGTTCGACAGCACTAAATTGG - Intronic
1131847834 15:96506667-96506689 CCAGTTCTTCAGCTGTAAATTGG + Intergenic
1132321039 15:100925770-100925792 CATGTTCCTCAGCTATAAAACGG - Intronic
1138364424 16:56462138-56462160 CAAGTTTTTCAGCACTAAAATGG - Intronic
1140002119 16:71036642-71036664 GTTGTTCTTCAGGGCTGAATTGG + Intronic
1140664370 16:77214227-77214249 AATTTTCCTCATCGCTAAATTGG - Intergenic
1143805495 17:9422632-9422654 AATGTTATTCAGCCATAAATAGG - Intronic
1145386251 17:22413614-22413636 CATATTCTACAGTGCTTAATAGG + Intergenic
1147479672 17:40747747-40747769 CAGGTTCTTCATCTGTAAATGGG - Intergenic
1151992018 17:77581342-77581364 CAGGGTCTTCAGTGCTAAGTTGG + Intergenic
1152490241 17:80626616-80626638 CATGTTCCTCAGCTCTCAAATGG - Intronic
1153569638 18:6456189-6456211 CATGTTATTCAGCTATAAAAAGG - Intergenic
1162254466 19:9477253-9477275 GATTTTTTTCAGCACTAAATAGG - Intronic
932979239 2:76643630-76643652 CATGATCTACAGCTCTAAACTGG - Intergenic
933140028 2:78780871-78780893 TATGTTCTTCATCTTTAAATTGG + Intergenic
939007229 2:136803712-136803734 CATGTTCTTCAGCGTGAAGATGG - Intronic
941729377 2:168899095-168899117 CATGGTCTTCCCCGCTATATGGG - Intronic
943319292 2:186427965-186427987 CATGTTCTACATCAATAAATAGG - Intergenic
943992460 2:194714065-194714087 CATAATCTTCACCGCTAAATTGG + Intergenic
1169145944 20:3252393-3252415 GATGCTCTTCAGCGCTATACAGG + Exonic
1169537628 20:6562285-6562307 CATGTTTTTCAAAGCTAAACAGG + Intergenic
1172020479 20:31910252-31910274 CAAGTTCTTCATTGCTAAAATGG - Intronic
1174967114 20:55228769-55228791 AATGTTATTCAGCTCTAAAAAGG - Intergenic
1179527320 21:41990468-41990490 CATGTTCTTAAGTCCAAAATAGG - Exonic
1181624571 22:24114528-24114550 CATATTCTTCAGCTATAAAATGG - Intronic
1184087776 22:42275541-42275563 CAATTTCTTCAGCTGTAAATTGG + Intronic
1184227602 22:43138327-43138349 CAGGTTCTCCAGCTCTAAGTGGG - Intronic
1185018567 22:48359836-48359858 CAGTTTCTTCATCTCTAAATGGG - Intergenic
1185202649 22:49517529-49517551 CATGTTTCTCAGCTCTAAAACGG - Intronic
949865832 3:8546460-8546482 CAGGTTCTTCAGCTGTAAAAAGG - Intronic
950179967 3:10904479-10904501 CATGTTCTGCAGCAATGAATGGG - Intronic
959641048 3:108635376-108635398 CTTGTTCTTCACCTCTAAAATGG - Intronic
961123179 3:124391561-124391583 CATGTTCTTCAGCGCTAAATCGG + Intronic
962462746 3:135629798-135629820 CATGTTCTCCAGAGCTGAAAAGG - Intergenic
962581826 3:136804894-136804916 CAAGTTCCTCAGCTCTAAAATGG - Intergenic
962678763 3:137777053-137777075 CTTGTTCTCCTGCGCTTAATCGG + Intergenic
966669758 3:182513815-182513837 CATGTTCTTCATCTATAAAATGG + Intergenic
970289270 4:14553636-14553658 CATGTTATTGAGCGCTAAGAAGG - Intergenic
971666104 4:29487608-29487630 CATGTTTTTCAGGGTTAAATGGG - Intergenic
975234507 4:71976390-71976412 CATCTTCTACAGTGATAAATGGG - Intergenic
975615211 4:76239074-76239096 CATATTATTCAGCCTTAAATAGG - Intronic
975920580 4:79381223-79381245 CATGATATTCATCACTAAATTGG + Intergenic
980187190 4:129476748-129476770 CAGGTTCCTCAGCTTTAAATAGG + Intergenic
981959558 4:150520180-150520202 CTTGTTCTTCAATGGTAAATGGG + Intronic
982807688 4:159786955-159786977 CATATTATTCAGCCTTAAATAGG + Intergenic
984421766 4:179532409-179532431 CAATTTCTTCAGCTCTAAAATGG - Intergenic
988676005 5:33433861-33433883 CATGTTCCTCAGCTATAAAATGG - Intergenic
995220804 5:109645571-109645593 CAGGTTTTTCAGCTCTAAAATGG + Intergenic
997878281 5:137568426-137568448 CAAGTTCTTCAGAGTTCAATAGG + Intronic
999035951 5:148349759-148349781 CATGTTCTTCATCCCTTGATGGG - Intergenic
999635103 5:153613742-153613764 GATATTCTTCAGCGTTAAAGGGG + Intronic
1000542696 5:162559779-162559801 AATTTTCTTCAGTCCTAAATTGG - Intergenic
1000728947 5:164806584-164806606 CATTTTTTTCAGTGCTAAAACGG - Intergenic
1001746841 5:174098864-174098886 CTAGTTCTCCAGCGCTACATTGG - Intronic
1002587349 5:180257888-180257910 CATGTCCTTCATCCCTTAATAGG + Intronic
1014902845 6:126988836-126988858 CATGTCCTTCACAGCAAAATGGG + Intergenic
1017242204 6:152183079-152183101 TATGTTCTTCAGTGCTATTTGGG - Intronic
1018967471 6:168499866-168499888 CATGTTCTTCTCCGCACAATTGG + Intronic
1020785477 7:12568206-12568228 CATGTTCCTCATCTCTAAAATGG - Intergenic
1029943507 7:104506636-104506658 CATTTTCTTCATTACTAAATAGG - Intronic
1032614435 7:133451398-133451420 TATTTTCTTTAGCTCTAAATGGG + Intronic
1033430301 7:141283055-141283077 CAAGTTCTTCAGTGCCAAAACGG - Intronic
1040751719 8:50717689-50717711 CATTTTCTTCATCTCTAAAATGG + Intronic
1042841256 8:73126091-73126113 CAGGTTCTTTTGCTCTAAATAGG - Intergenic
1047504375 8:125467135-125467157 GATGTCCTTCAGCTCTAAAGAGG - Intergenic
1052716802 9:32127632-32127654 CATGTTCTTCTTCTGTAAATAGG - Intergenic
1052922901 9:33986820-33986842 CATTTTCTTCACCTCTAACTAGG + Exonic
1060290185 9:122295281-122295303 CATTTTCTTCATCCCTAAAAAGG - Intronic
1185888118 X:3801046-3801068 AATATTCTTCAGCCCTAAAAAGG - Intergenic
1185999668 X:4994575-4994597 CATGATCTTCAGCACTCCATCGG - Intergenic
1188260883 X:28022311-28022333 CATGTTATTCAGCCATTAATAGG - Intergenic
1188943887 X:36273017-36273039 CAGGTTCTTCAGCTTTAAAATGG + Intronic
1189647391 X:43148384-43148406 CATTTTCTTCAGCTGTAAAATGG - Intergenic
1191820636 X:65302698-65302720 CTTGTTCTTCAGTTCTAAGTTGG - Intergenic
1197663581 X:129199492-129199514 AATGTTATTCAGCCCTAAAATGG + Intergenic
1199232838 X:145458936-145458958 CATTTTCTTCAAATCTAAATTGG + Intergenic
1199968648 X:152842049-152842071 CATATTCTTCAGCCATAAAAAGG - Intronic