ID: 961124914

View in Genome Browser
Species Human (GRCh38)
Location 3:124408693-124408715
Sequence GTGGGTAGACCATAGGAAGT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 149
Summary {0: 1, 1: 0, 2: 0, 3: 13, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961124909_961124914 5 Left 961124909 3:124408665-124408687 CCAATGTTGCAGGTGATAAAGAG 0: 1
1: 0
2: 2
3: 17
4: 207
Right 961124914 3:124408693-124408715 GTGGGTAGACCATAGGAAGTGGG 0: 1
1: 0
2: 0
3: 13
4: 135

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961124914 Original CRISPR GTGGGTAGACCATAGGAAGT GGG Intronic
901237515 1:7675484-7675506 GCAGGGAGACCATAGGAAGAAGG + Intronic
902640978 1:17765964-17765986 GAGGGCAGGCCACAGGAAGTTGG - Intronic
903630242 1:24763309-24763331 GTGGGCAGATCATCTGAAGTCGG + Intronic
906874386 1:49521035-49521057 GTGGGTGGATCATATGAAGTCGG - Intronic
910416007 1:86999404-86999426 GTGGGTGGATCATCTGAAGTCGG - Intronic
911381239 1:97117483-97117505 GTGGGTAAACCTTAGGAAATAGG - Intronic
914390448 1:147217010-147217032 GTGGGTAGATCATCTGAGGTCGG + Intronic
915488517 1:156238804-156238826 GTGGGGAGAGCAGAGGGAGTGGG - Intronic
915626909 1:157119446-157119468 GTGGTTAGAGCACAGGAACTGGG + Intergenic
918545094 1:185673198-185673220 ATGGGTTGACTACAGGAAGTGGG + Intergenic
919816627 1:201444937-201444959 GTGGTCAGACCATAGGAGGCTGG + Intergenic
920632538 1:207666701-207666723 GAGGGTAGAGGATAGGAAGAGGG + Intronic
920888490 1:209957653-209957675 GTGGGTAGATCACCTGAAGTAGG - Intronic
921081111 1:211738995-211739017 GTGGGCAGAGCATAGGTACTAGG - Intergenic
1065629455 10:27662676-27662698 ATGGGTAGACCATAGGAAAAGGG + Intergenic
1072134868 10:92535805-92535827 GTGGGTAGATCATCTGAGGTCGG + Intronic
1072451023 10:95539817-95539839 GTGGAAAGAGCATAGGAAGGAGG - Intronic
1076332283 10:129678841-129678863 GTGGGTAGATCACTTGAAGTCGG + Intronic
1078072724 11:8128365-8128387 ATGGGTAGACTACAGGAAGCAGG + Intronic
1083259829 11:61516965-61516987 GTGGGGAGACCATTGGCATTTGG - Intronic
1085243578 11:75078630-75078652 GTGGGTGGATCATCTGAAGTTGG + Intergenic
1087258695 11:95986127-95986149 GTGGGGAAAGCATAGGAGGTAGG + Intronic
1089419704 11:118322406-118322428 GTGGGCAGATCATCTGAAGTGGG - Intergenic
1090060372 11:123459481-123459503 GTGGGTGGATCATCTGAAGTCGG - Intergenic
1090917545 11:131178917-131178939 GTGGGTGGAAAGTAGGAAGTTGG + Intergenic
1092121789 12:6049489-6049511 GAGGCTAGACTATAGGAAGTTGG - Intronic
1093742467 12:22704437-22704459 GTTGGTAGACCCTATGATGTTGG + Intergenic
1093916599 12:24809277-24809299 GTGGGGAGGACAGAGGAAGTGGG - Intergenic
1097631629 12:62071295-62071317 GTGGCTAGAGCACAGGAAGCGGG + Intronic
1100150363 12:91729263-91729285 GTGGATAGACCATGGGAGGAAGG + Intergenic
1101183894 12:102252540-102252562 TTGTGTAGACCACACGAAGTTGG + Intergenic
1101396858 12:104356205-104356227 GTGGGGAAACTATAGGAAGATGG + Intergenic
1109304604 13:60624796-60624818 GTGGGTGGATCATATGAGGTCGG + Intergenic
1110478513 13:75946306-75946328 GTGGGTAGACACTAGGTAATAGG + Intergenic
1110529602 13:76580773-76580795 GTGGGTAGATCAGGGCAAGTGGG + Intergenic
1111003543 13:82216826-82216848 GTGAGTGGATCATATGAAGTCGG - Intergenic
1115186531 14:30695207-30695229 GAGGGTAGACCAAAGTAATTAGG - Intronic
1115499040 14:34033268-34033290 GTTGGGAGCCCATAGGAGGTGGG - Intronic
1118698455 14:68409472-68409494 GTGGGTGGACCTTAGGGAGTGGG - Intronic
1120430747 14:84411440-84411462 GTGGGTGGATCACAGGAGGTCGG + Intergenic
1127633418 15:60847405-60847427 CTGAGTAGGCCACAGGAAGTAGG - Intronic
1129121444 15:73399283-73399305 GTGGGAGGAGCTTAGGAAGTAGG - Intergenic
1137320872 16:47380390-47380412 GTGGGCAGAGCATAGGAATGGGG - Intronic
1139519578 16:67473173-67473195 GTGGGAAGAGCATAGGGAGAAGG - Intronic
1144526574 17:15995488-15995510 GTGGGCAGATCATCTGAAGTCGG - Intronic
1144687503 17:17236016-17236038 ATGAGAACACCATAGGAAGTAGG - Intronic
1145805713 17:27727868-27727890 GTGGGTGGACCATTTGAGGTGGG + Intergenic
1146922659 17:36723572-36723594 GTGGGTAGATGACAGGAAGATGG - Intergenic
1150578498 17:66451678-66451700 GTGGGTGGAGCAGAGGGAGTGGG + Intronic
1154983402 18:21523514-21523536 GTGGGTAAAGCAAAGGAATTAGG - Exonic
1155970805 18:32081884-32081906 GTGAGTAGAAAAAAGGAAGTTGG + Intergenic
1160737145 19:668141-668163 GTGGGTGGATCATCTGAAGTTGG + Intergenic
1162048972 19:8020723-8020745 GTGGGTAGACCACCTGAGGTTGG - Intronic
1166088786 19:40494766-40494788 GGGGGTAGAACATAGAAAGATGG - Intronic
1166556969 19:43706709-43706731 GTGGGAGGACCATTTGAAGTTGG + Intergenic
1168466578 19:56606969-56606991 TTTGGTAGACAATAGTAAGTGGG - Intronic
925789727 2:7471800-7471822 GTGGGGAGTGCATAGGCAGTGGG - Intergenic
925907283 2:8547051-8547073 GTGGGTGGAGGAGAGGAAGTGGG - Intergenic
926702668 2:15814080-15814102 GAGGATAGACTAGAGGAAGTGGG - Intergenic
929671008 2:43876400-43876422 GTGGGGAGACCATGGGAATATGG + Intronic
930617576 2:53609472-53609494 CTGTGTCCACCATAGGAAGTTGG + Intronic
931859724 2:66342164-66342186 GTGGATAGACCAAAGGAGGAAGG - Intergenic
932607507 2:73175208-73175230 CTGGGCAGACCACAGGAAGCAGG + Intergenic
935903052 2:107813350-107813372 GTGGGGTGAGCATAGGAAGCTGG - Intergenic
935942957 2:108260428-108260450 GTGGAAAGACCAGAGGGAGTGGG + Intronic
936589373 2:113788595-113788617 GTGGGTACAGCATAGACAGTAGG + Intergenic
936755189 2:115700068-115700090 GTGGCTAGAGCAGAGGAAGGGGG + Intronic
938923504 2:136017543-136017565 GCGGGTGGATCATATGAAGTCGG + Intergenic
940711272 2:157165615-157165637 GTGGGGAGACGTTAGGGAGTGGG + Intergenic
941688089 2:168468288-168468310 GGGGCTAGACCAGGGGAAGTAGG - Intronic
1174201317 20:48808535-48808557 GCGGGTAGATGATAGGAGGTGGG - Intronic
1175151971 20:56941978-56942000 GTGGGAAGATCAAAGGAAGGAGG - Intergenic
1175391443 20:58630078-58630100 GTGGGTAGACTGTGGCAAGTGGG + Intergenic
1177611491 21:23455100-23455122 GTGAATAGATCAAAGGAAGTGGG + Intergenic
1181993766 22:26858753-26858775 GTGGGTAGCCCATACAATGTAGG - Intergenic
1183731484 22:39621082-39621104 GTTCCTGGACCATAGGAAGTGGG - Intronic
949635549 3:5978149-5978171 GTGGAAAAACCATAGGCAGTGGG + Intergenic
950085529 3:10254849-10254871 GTAGGTAGACCATGGGCAGAAGG - Intronic
950284305 3:11732840-11732862 GTGGCTGGACCATAGGAAATAGG + Intergenic
951388782 3:22076288-22076310 GTGGGTAGGACATGAGAAGTCGG - Intronic
954855913 3:53643324-53643346 GTGGGTAAACCACAGGAGGCTGG - Intronic
957146215 3:76427295-76427317 TTCTGGAGACCATAGGAAGTGGG + Intronic
961124914 3:124408693-124408715 GTGGGTAGACCATAGGAAGTGGG + Intronic
962900979 3:139761272-139761294 ATGGAAAGACCATAGGAGGTTGG + Intergenic
964395826 3:156244576-156244598 GTGGGAAGAGCTGAGGAAGTAGG - Intronic
964427795 3:156571406-156571428 CTGTGTGGACCAAAGGAAGTAGG + Intergenic
970914877 4:21321511-21321533 ATGGGTAGACAATACGAAGAAGG + Intronic
972468598 4:39382844-39382866 GTGGGTGGATCATCTGAAGTCGG - Intergenic
972610438 4:40651109-40651131 TTGGGTAGACAGTAAGAAGTTGG + Intergenic
972973862 4:44609932-44609954 GTGGGTAGAGGACAGGGAGTAGG - Intergenic
976343899 4:83977715-83977737 TTGGGGAGAGCGTAGGAAGTGGG - Intergenic
977265695 4:94850729-94850751 GAGGCTAGACCACAGGTAGTAGG - Intronic
978907169 4:114019801-114019823 TTGGTCAGAACATAGGAAGTTGG - Intergenic
981421467 4:144555315-144555337 GTGGGGAGACCATTGGCAATGGG - Intergenic
986079547 5:4375828-4375850 GTGGGTAGAGCACAGGAAAAGGG - Intergenic
987140971 5:14945888-14945910 GTGGGTAAAGCATGGGAGGTGGG - Intergenic
990852741 5:60225195-60225217 ATGGGTAGAACAAAGGAACTAGG - Intronic
992828807 5:80574030-80574052 GTGGGTGGATCATCTGAAGTCGG + Intergenic
993462737 5:88204465-88204487 CTGGGTAAACCATCGGATGTGGG + Intronic
994240920 5:97419612-97419634 GAGGGTAGGCCATAGGATGAAGG + Intergenic
995612307 5:113923571-113923593 TTGGGAAGACCATAGTAACTGGG - Intergenic
995714316 5:115067212-115067234 GAGGGCAGACCCTAGGAAGAGGG - Intergenic
999364515 5:151013324-151013346 GTAGGTAGCCCATGGGAAGTAGG + Intergenic
999620344 5:153466542-153466564 GTGGGCAGACCATTTGAGGTCGG - Intergenic
1000243047 5:159426425-159426447 GAGGGAACACCTTAGGAAGTGGG + Intergenic
1002421060 5:179149272-179149294 GTGAGGAGACCACAGGAAGATGG + Intronic
1002423171 5:179160750-179160772 GTGGACAGACCAGAGGAAGCTGG + Intronic
1002580087 5:180203382-180203404 GTGGGTAGTCCCGAGGAACTGGG + Intronic
1003146800 6:3516602-3516624 GTGGGTAGATGATGGGGAGTGGG - Intergenic
1004754885 6:18600654-18600676 GTGGGTCGGCCAGAGGGAGTAGG + Intergenic
1005815440 6:29548273-29548295 GTGGGTAGACAATTGGACATAGG + Intergenic
1006907025 6:37539491-37539513 GTGGGGAGAGCAGAGGAAGGGGG - Intergenic
1007385658 6:41518596-41518618 GTGGGAGAACCATGGGAAGTGGG - Intergenic
1011651885 6:89514147-89514169 GTGGGCAGATCACATGAAGTCGG + Intronic
1011681857 6:89791107-89791129 GGGGGTATTCCATGGGAAGTAGG + Intronic
1013035449 6:106378179-106378201 GTGGGAAGACCACAGGAAGAGGG - Intergenic
1013454411 6:110317360-110317382 GTGGGTGGAGAATAGGAGGTGGG - Intronic
1013481057 6:110553205-110553227 GTGGGTAGATCATCTGAGGTCGG - Intergenic
1015102364 6:129496392-129496414 GTGGGCAGACCACCTGAAGTTGG - Intronic
1017276849 6:152579662-152579684 GAGGGTAGAGGATAGGAAGAGGG - Intronic
1017421530 6:154277893-154277915 GTGGGTGGACCACAGGAAGCTGG - Intronic
1019988633 7:4676845-4676867 GTGGATAGATCATTTGAAGTCGG - Intergenic
1023403347 7:39806689-39806711 GTGGGTAGATCATCTGAGGTGGG + Intergenic
1024790436 7:52959461-52959483 GTGGGTACAGCCTAGGAAATGGG + Intergenic
1029582541 7:101446980-101447002 GTGGGTAGAGGCTCGGAAGTTGG + Intronic
1029920249 7:104254823-104254845 GTGGGGAGGCCATTGCAAGTGGG - Intergenic
1031948347 7:127864938-127864960 GGGGGTAGACCATATGAATGAGG + Intronic
1033010643 7:137619001-137619023 GTCTGGAGACCACAGGAAGTAGG + Intronic
1033343629 7:140510824-140510846 GTGGGTGGATCATCTGAAGTTGG + Intergenic
1034721664 7:153299467-153299489 GTGGGGAGAACCCAGGAAGTGGG + Intergenic
1034977403 7:155456465-155456487 GTGGGTAGACAAGAGCAAATGGG + Intergenic
1036814300 8:11889689-11889711 TTGGGCAGACAGTAGGAAGTGGG - Intergenic
1043318742 8:78954577-78954599 GTGGGTATGCCATATTAAGTTGG - Intergenic
1043350094 8:79349996-79350018 TTGGGTCCCCCATAGGAAGTGGG + Intergenic
1046468950 8:114642946-114642968 GTGGGTAGATCATTTGAGGTCGG - Intergenic
1049103420 8:140596353-140596375 GCGGGTAGACCATCTGAGGTCGG + Intronic
1049182480 8:141230143-141230165 GTGAGTAGACTCTTGGAAGTAGG + Intronic
1049276048 8:141720688-141720710 GTGGTGACCCCATAGGAAGTGGG + Intergenic
1051175435 9:14355289-14355311 GAGGGAAGACCATATGAAGACGG + Intronic
1052528095 9:29647617-29647639 GTGATTAGACCACAGGAAATAGG + Intergenic
1053541040 9:38974069-38974091 GTGCGTAGACCCAAGGAAGTGGG - Intergenic
1053805461 9:41797117-41797139 GTGCGTAGACCCAAGGAAGTGGG - Intergenic
1054625100 9:67389838-67389860 GTGCGTAGACCCAAGGAAGTGGG + Intergenic
1056687929 9:88782162-88782184 GTGGGTAAAACACAGCAAGTGGG + Intergenic
1056767289 9:89452679-89452701 GTGGGTAGATCATCTGAGGTGGG - Intronic
1058371368 9:104271438-104271460 GTGGGCAGTCCTGAGGAAGTTGG + Intergenic
1061313794 9:129781286-129781308 GTGGTTACACCATAGTAGGTTGG + Intergenic
1186067235 X:5779002-5779024 GAGGGAAGACCATTGGAAGATGG + Intergenic
1188959727 X:36476195-36476217 GAGGGTAGACAATAGGAAGAAGG + Intergenic