ID: 961125259

View in Genome Browser
Species Human (GRCh38)
Location 3:124411874-124411896
Sequence TGGGGCATCCTTGGGGGATC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 210
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 192}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961125259_961125265 -6 Left 961125259 3:124411874-124411896 CCAGATCCCCCAAGGATGCCCCA 0: 1
1: 0
2: 0
3: 17
4: 192
Right 961125265 3:124411891-124411913 GCCCCACAATAAGTAATACTGGG 0: 1
1: 0
2: 0
3: 2
4: 84
961125259_961125264 -7 Left 961125259 3:124411874-124411896 CCAGATCCCCCAAGGATGCCCCA 0: 1
1: 0
2: 0
3: 17
4: 192
Right 961125264 3:124411890-124411912 TGCCCCACAATAAGTAATACTGG 0: 1
1: 0
2: 1
3: 2
4: 76

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961125259 Original CRISPR TGGGGCATCCTTGGGGGATC TGG (reversed) Intronic
900235832 1:1589970-1589992 TGGGGCTTCCTTGGGTGACAGGG + Intergenic
900371585 1:2334519-2334541 CGGGGCTCCCTTGGGGGAGCAGG + Intronic
900601881 1:3506228-3506250 TGGGGCAGCCTGGGGGCAGCGGG + Exonic
901672245 1:10862782-10862804 GGGGGCAGACTTGGGGGATGAGG - Intergenic
903372331 1:22844736-22844758 TGGGGGCTTCCTGGGGGATCCGG - Intronic
904000041 1:27333752-27333774 TGGGGGATCCTGGGGGGATATGG - Intronic
904703935 1:32376466-32376488 AGAGGCATCCTTGGAGGAACAGG - Exonic
904982613 1:34519402-34519424 TGGAGCACCCTTTGTGGATCTGG + Intergenic
905529990 1:38670402-38670424 TGGAGCAGCCATGGGGGATGGGG - Intergenic
907420933 1:54346850-54346872 TATGGCAGCCTTGGGGGATTGGG + Intronic
915352611 1:155235778-155235800 TGGGTCCTCCTTCGGGGTTCAGG + Exonic
918464549 1:184808040-184808062 AGGGGCATCCGTGGTGGATGAGG - Intronic
919978773 1:202629585-202629607 TGGGACACCCTTGGGGAGTCTGG - Intronic
920299932 1:204982478-204982500 CGGGGAAGCCTTGAGGGATCAGG + Intronic
921378310 1:214497109-214497131 TGGGGCAGCGGTGGGGGGTCGGG + Intronic
922787548 1:228290467-228290489 CGGAGCATCCTTGGGGCTTCAGG - Intronic
922814278 1:228438280-228438302 TGTGGCATCCTTTGGGGAGGGGG - Intergenic
922978768 1:229806935-229806957 TGGGGCATCCTTGGCCAAGCAGG + Intergenic
923108827 1:230875020-230875042 TGGGGCATCCCTGGGAGGCCTGG + Intergenic
1063212994 10:3898398-3898420 TGGGACATCCTTGAAGGATTTGG - Intergenic
1064007821 10:11712479-11712501 TGGCACAGGCTTGGGGGATCAGG - Intergenic
1068707568 10:60093500-60093522 TGAGGCATCTTTTGGGGAACTGG + Intronic
1069626555 10:69871469-69871491 TGGGGAGTCCTTGGGGAATGTGG - Intronic
1069678456 10:70266493-70266515 GGGGACATGCTTGGGGGACCAGG - Intronic
1069759693 10:70800182-70800204 TGAGGCATCCCTAAGGGATCTGG + Intergenic
1075359207 10:121814701-121814723 TGGAGCATCCTGGCGGGATGAGG + Intronic
1075405415 10:122192515-122192537 TGGGGCAGCCTCGGGGCCTCCGG + Intronic
1075779584 10:125008381-125008403 TGGGGCAACCCTGGGGTATGTGG - Intronic
1076628149 10:131834398-131834420 TGGGGCTTCCCTGGCGGAACAGG - Intergenic
1076781002 10:132724574-132724596 TGGGGCCTCCTTGTGAGTTCTGG - Intronic
1077021440 11:418855-418877 GAGGGCATTCTTGGGGGATGGGG + Intronic
1077051617 11:569135-569157 CGGGGCGCCCTTGGGGGCTCTGG + Intergenic
1077152061 11:1077008-1077030 AGGGGCAGCCTGGGGGGCTCTGG + Intergenic
1078289854 11:9997937-9997959 TGGGGGATCTTAGGGGAATCAGG + Intronic
1078619581 11:12894620-12894642 TGGGGAAGCCTTGTGGGGTCTGG - Intronic
1079334870 11:19562386-19562408 TGGGGCATCTCTGGGGGCTCCGG + Intronic
1080570353 11:33550605-33550627 TGGGGGAACCTTGGGGGCACCGG - Intronic
1083235898 11:61350533-61350555 TGGGGCTTCCCTGAGGGATTTGG - Intronic
1083292975 11:61700016-61700038 TGGGGCAGCCTTGGGGATGCAGG - Intronic
1083581436 11:63827727-63827749 TGGGCCATCATTGGGGGAGAGGG + Intergenic
1085039231 11:73317297-73317319 TGGGGCTACCTTGGGGGGTAGGG - Intronic
1089205948 11:116762969-116762991 TGAGGCCTCCTTGGGGGAGAAGG + Exonic
1090182829 11:124716104-124716126 TGGGCCTTCCTGGGGGGATATGG - Intergenic
1092004146 12:5054927-5054949 TGGGGCAGCCCTGGGTGGTCAGG + Intergenic
1095785130 12:46101644-46101666 TGGGGCATCCTGGCGTAATCAGG - Intergenic
1097950396 12:65420631-65420653 TGGGGCCTACTTGAGGGAGCAGG - Intronic
1099856826 12:88178584-88178606 TGGAGCTTCCTTGGGGTAGCAGG + Intronic
1099920435 12:88950918-88950940 TGGGGCTTTCTTGGGAGATTGGG - Intergenic
1100081456 12:90856795-90856817 TAAGGCATCCTTGAAGGATCAGG - Intergenic
1101345536 12:103882882-103882904 GGGGGCTTCCTGGGTGGATCAGG - Intergenic
1102700484 12:114834885-114834907 TGGGGTCTCCATGGGGGATCAGG + Intergenic
1104536250 12:129620809-129620831 TGGGGCCCTCTTGGGGGATGAGG + Intronic
1105071379 12:133236004-133236026 TGAGGGGTCCGTGGGGGATCTGG + Exonic
1106793809 13:33183827-33183849 TGGGGCAGCCTGGGGGAATTGGG - Intronic
1107879463 13:44820512-44820534 TGGGGCTTCCCTGGGGGAGCTGG + Intergenic
1121283136 14:92713787-92713809 TGGGGCAGCCTTGTGGGGGCGGG - Intronic
1122021281 14:98839955-98839977 TCGGGGATCTTTGGGGGTTCAGG + Intergenic
1122737855 14:103854130-103854152 TGCGTCATCCCTGGGCGATCTGG - Intergenic
1124170320 15:27367019-27367041 TGGGGCCTCCTTGGTGCCTCTGG - Intronic
1124494383 15:30177483-30177505 TGGGACATCCTTGGGGAGTCTGG - Intergenic
1124749187 15:32361162-32361184 TGGGACATCCTTGGGGAGTCTGG + Intergenic
1127703835 15:61527885-61527907 GGGGGAATCCTAAGGGGATCTGG + Intergenic
1129172542 15:73817027-73817049 TGGGGCCTCCATGGGGAAGCAGG + Intergenic
1129787402 15:78318889-78318911 TGGGGGATCCCTGGGGGTGCAGG + Intergenic
1131648620 15:94374734-94374756 AGGGGCATCCTGGGAGGAACAGG - Intronic
1133220332 16:4316774-4316796 AGGGGCGTCCCTGGGGGGTCAGG + Intronic
1134070431 16:11256629-11256651 TGTGGCCTCCTAGGGGGATCTGG - Intronic
1135187147 16:20324946-20324968 TGGGGCATGCTGGTGGGATCTGG - Intronic
1136475897 16:30513223-30513245 TGGGGCATACCTGGGGGACAGGG + Intronic
1138584564 16:57961484-57961506 TGGGCCATACTTGGGGGAACCGG - Intronic
1140405710 16:74709924-74709946 TGGGTCATCCCTGGAGAATCAGG + Intergenic
1141808358 16:86357294-86357316 TGGGGCAGCATTCGGGGCTCAGG - Intergenic
1141845459 16:86605400-86605422 TTGGGGAACCTTGGGGGATAAGG + Intergenic
1142157956 16:88541197-88541219 AGCGGCCTCCTGGGGGGATCTGG - Intergenic
1142205764 16:88782443-88782465 TGCTGGAGCCTTGGGGGATCAGG - Intronic
1142641453 17:1288296-1288318 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641471 17:1288332-1288354 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641526 17:1288459-1288481 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641593 17:1288621-1288643 TGGGGAACCCATGGGGGATGGGG - Intronic
1142641634 17:1288712-1288734 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641652 17:1288748-1288770 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641684 17:1288820-1288842 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641702 17:1288856-1288878 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641709 17:1288874-1288896 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641726 17:1288911-1288933 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641790 17:1289040-1289062 TGGGGAACCCGTGGGGGATGAGG - Intronic
1142641805 17:1289077-1289099 TGGGGAACCCGTGGGGGATGGGG - Intronic
1142641857 17:1289187-1289209 TGGGGAACCCGTGGGGGATGAGG - Intronic
1143851229 17:9813586-9813608 GGGGACATCCTTGGGAGAACCGG - Intronic
1150265330 17:63828594-63828616 AAGGGCATCATTGAGGGATCTGG + Intronic
1151222431 17:72623034-72623056 TGGGGCTTCCCTGAGGGAACTGG - Intergenic
1151427147 17:74038440-74038462 TGGAGCATTCTTGGGGGCTTGGG + Intergenic
1152381120 17:79942711-79942733 TGGGGCATGATTGGGGGGTGTGG - Intronic
1152457038 17:80422538-80422560 TGGGACATCTTTTGGTGATCAGG - Intronic
1152569553 17:81115679-81115701 TGGGGAATCCCTGGGGCATCGGG + Intronic
1154123611 18:11671169-11671191 TGGGGCAGCCCAGGGGCATCAGG - Intergenic
1154313442 18:13284936-13284958 AGGGGCGTCCTTTGGGGATGTGG + Intronic
1155988004 18:32251233-32251255 TGGGACAGCCTTGGGAGAACAGG + Intronic
1156384610 18:36594042-36594064 TGCGGCAGCCTTGGGGTCTCTGG - Intronic
1156465710 18:37346912-37346934 CGGGGTATCTTTGGTGGATCTGG + Intronic
1156500455 18:37554199-37554221 TGGGGCAGCCTCGGGGGCTGGGG + Intronic
1157312899 18:46565583-46565605 TCGGGTATGCTTGGGGGTTCTGG - Intronic
1158450192 18:57557385-57557407 TGGAGCGTCCTTGTGGGACCGGG - Intronic
1160218849 18:76957665-76957687 TGGGGCCTCCTTGAGGGAGGAGG - Intronic
1160307251 18:77751455-77751477 AAGGTCATCCTTGGGGGTTCTGG - Intergenic
1160492760 18:79351812-79351834 TGGGGAAGCCTAGGGGGATGGGG + Intronic
1161411709 19:4121597-4121619 TGGGGGATTCTGGGGGGGTCAGG - Intronic
1161626050 19:5327498-5327520 CAGGGGATCTTTGGGGGATCGGG - Intronic
1161733552 19:5977291-5977313 TGGTGCCTTCTCGGGGGATCTGG + Intronic
1162728220 19:12702279-12702301 TGGGCCAAGCTTGGGGGACCAGG - Intronic
1162743363 19:12785965-12785987 TGGTGAAGCCTTGGGGGACCTGG - Intronic
1162829711 19:13276655-13276677 GGGGGCATTCTTGGAGGCTCAGG + Intronic
1163738117 19:18994256-18994278 TGTGGCATTTTTGGGGGAGCAGG + Exonic
1164572108 19:29382031-29382053 TGGGGCACCCTTCAGGCATCTGG - Intergenic
1165493849 19:36140825-36140847 TGGGGCAGGTATGGGGGATCAGG - Intronic
1166755435 19:45187778-45187800 TGGGGCATCAGTGGGGGTCCTGG - Intronic
1167048732 19:47066542-47066564 TGGGGCACCCTCGGGGGGTGGGG + Exonic
1168538711 19:57192579-57192601 TGGAATTTCCTTGGGGGATCTGG + Intronic
1168543995 19:57235074-57235096 TTGGGCATTCATGGGGGAGCTGG + Intronic
926434866 2:12827546-12827568 AGGGGCAGGCTTTGGGGATCCGG + Intergenic
927110258 2:19859386-19859408 TCGGGCAGCCTTGGGGATTCTGG - Intergenic
927240889 2:20918764-20918786 TTGGGCATCCTGGAGGGTTCTGG + Intergenic
930856501 2:56024731-56024753 AGGATCATCCTTGGGGGAGCAGG + Intergenic
931677028 2:64707631-64707653 TGGGGCCTACTTGAGGGAGCAGG + Intronic
932398713 2:71465419-71465441 TGGGGTGTCCTAGGGGCATCCGG + Intronic
932625391 2:73292531-73292553 AGGGGCATCCAGCGGGGATCTGG + Exonic
936499286 2:113053075-113053097 TGAGGCATCCTTGGAAGAGCAGG - Intergenic
936499953 2:113059178-113059200 TGAGGCATCCTTGGAGGAACAGG + Exonic
939034350 2:137113124-137113146 TGGGGAATCCTTGGAGGAAGAGG + Intronic
939242521 2:139579513-139579535 TGGGGCCTGCTGGGGGGTTCTGG + Intergenic
942253922 2:174072853-174072875 TTGTGCTTCCTTGGGAGATCCGG + Exonic
944315181 2:198276952-198276974 TGTGGCATCATTGGGGGAGGGGG + Intronic
947034372 2:225835389-225835411 TCCAGCATCCTTGGGAGATCAGG - Intergenic
947427587 2:229997916-229997938 TGGGGTAGCATTGGGGGTTCTGG - Intronic
1171459812 20:25292176-25292198 TGGGGCATCCTTGAGGCAGAAGG - Intronic
1172433880 20:34914683-34914705 TGGGGTATCCTTGTGGGCACAGG + Intronic
1174677354 20:52371376-52371398 TGGAGGATCCATGGGGCATCTGG + Intergenic
1175808883 20:61846848-61846870 TGGGGCATCCAAGGGGCACCAGG + Intronic
1175828539 20:61950171-61950193 TGGGGCAGCCTGGGGGGTCCTGG - Intergenic
1179495415 21:41768324-41768346 GGGGGCCTCCTGGGGGGACCAGG + Intergenic
1179577523 21:42317294-42317316 GGGGAAATCCCTGGGGGATCTGG + Intergenic
1180711174 22:17840761-17840783 TGGGGCCTCCATGGGTGCTCTGG + Intronic
1180997438 22:19972442-19972464 TGTGGCAGCCAGGGGGGATCGGG + Intronic
1181305859 22:21916877-21916899 GGGGGCATCCTTAGGGAAGCAGG - Intergenic
1182062144 22:27406045-27406067 TGGGGCAAACTTGGGGGCTGGGG - Intergenic
1182557487 22:31137070-31137092 TGGGGCCTCCCTGGTGGATTGGG - Intronic
1183473016 22:38019519-38019541 CAGGGCGTGCTTGGGGGATCAGG - Intronic
1184648811 22:45910312-45910334 AGGGGCATCCTTGGAGGTTTTGG + Intergenic
1184785123 22:46667950-46667972 TGGGACATCCCTTGGGGACCTGG - Intronic
949332540 3:2938188-2938210 TTGGGGATCCTTGGGGATTCAGG + Intronic
952768627 3:36977021-36977043 TGGGACACCCTTGGGGGCCCTGG - Intergenic
953103336 3:39851768-39851790 TGGAGCCTCCATGGGGCATCAGG + Intronic
954104373 3:48401751-48401773 TGTGGCATCCTTAGGGAACCTGG + Intergenic
960751641 3:120961426-120961448 TGGGGCCTCGTTGGGGGACGAGG - Intronic
961061409 3:123832039-123832061 TGGGGCATTCTGGAGGGAGCTGG + Intronic
961125259 3:124411874-124411896 TGGGGCATCCTTGGGGGATCTGG - Intronic
962413050 3:135158271-135158293 TGGGACTTCCTTGGGGGAAGAGG - Intronic
962983998 3:140517996-140518018 TGTGGCTGCCTTGGGGGATGGGG + Intronic
967493316 3:190117732-190117754 TGGGGCTTTCTTGGGGGCTGGGG + Intronic
969642957 4:8410100-8410122 TGGGGCATGCTTCTGGCATCTGG - Intronic
972344409 4:38180787-38180809 TGGGGCATCTTTGTGAGTTCAGG - Intergenic
973229974 4:47829602-47829624 GGGGGCAGTCTTGTGGGATCTGG + Intronic
976292170 4:83431021-83431043 TGGGGCATCAGTGGAGAATCTGG - Intronic
982816062 4:159886227-159886249 TGGGGCATCTTTGAAGGAACAGG + Intergenic
985832281 5:2242641-2242663 TGAGGGAGCCTTGGGGGATGTGG - Intergenic
987119051 5:14749148-14749170 TGGGCCATGCTTTGGGGATGTGG - Intronic
995900318 5:117058298-117058320 TGGGGGATCCTTGGTGGAGCTGG - Intergenic
997338626 5:133125173-133125195 TGGGGCTTCCTTTGGGCAACAGG + Intergenic
998374171 5:141680475-141680497 AGGGGCAGCCATGGGGGCTCAGG + Exonic
1000207513 5:159076383-159076405 TGTGGCATGCTTGGGGGAGGTGG - Intronic
1009900255 6:69800694-69800716 TGGGCCATTCTTGTGGGCTCAGG - Intergenic
1011746626 6:90413179-90413201 TGGGGCATTCTTGGTGGAACAGG - Intergenic
1015006074 6:128283217-128283239 TGGGGCACCCTTGGGGGAAGTGG - Intronic
1016684618 6:146867169-146867191 TGTGGAATCCTTGGGGCTTCAGG - Intergenic
1016882124 6:148921708-148921730 TGGAGCATCCTTGTGGGTTATGG + Intronic
1018701411 6:166430416-166430438 TGGGGCAGCCTTCGGGGAGGAGG - Intronic
1019205279 6:170356564-170356586 TTTGGCATCCTTGGGGGTCCTGG - Intronic
1019997594 7:4734616-4734638 TGGGGCTTCATGGGGGGCTCAGG + Intronic
1023050336 7:36245539-36245561 TGGGGGCCCCTTGTGGGATCAGG + Intronic
1023995302 7:45155986-45156008 TGGTGCAGGCTTGGGGGAACTGG + Intergenic
1024181672 7:46901422-46901444 TGGAGCAGCCCTGGGGAATCAGG - Intergenic
1026826725 7:73587105-73587127 TGGGGCACACTTGGAGGACCAGG + Intergenic
1030832939 7:114249367-114249389 TGGGGCCTACTGGGGGGAACGGG - Intronic
1032192725 7:129773782-129773804 TGGGGCATCCTTGGGAGCCCAGG + Intergenic
1037931179 8:22881179-22881201 TGGGGCATCCCTGGGGACACTGG - Intronic
1040284289 8:46092093-46092115 GGGGGCACCCTTGGGGCTTCTGG - Intergenic
1040287590 8:46108352-46108374 TGGGGCATCCCTGAGGTTTCTGG + Intergenic
1040294628 8:46142808-46142830 TGGGACAGCCTTGGGGCTTCTGG + Intergenic
1041914040 8:63121695-63121717 TGGGGCCTCCTTGAGGGAGGAGG - Intergenic
1042103804 8:65302372-65302394 TGGGGCATGCTTGGTTCATCTGG - Intergenic
1045402928 8:101836476-101836498 TGGGGAATCCCTGGGGACTCTGG + Intronic
1045641939 8:104261070-104261092 TGGGGCATCCCTGCTGGATTTGG + Intergenic
1046733174 8:117747903-117747925 TGGGGCATACTGGGGGGAGTGGG + Intergenic
1049444718 8:142624674-142624696 TGGGGCATGCTTGTGGGGTGGGG - Intergenic
1051867444 9:21697071-21697093 TGCGGCAAGCTTGGGGGCTCAGG + Intergenic
1055067413 9:72132635-72132657 TGGGGCATTTTTGGGGGTACAGG - Intronic
1057259915 9:93577393-93577415 TGGGGAGTCCGTGGGGGCTCCGG + Intronic
1057637330 9:96781755-96781777 TGCTGCATCCTTGGGGGATGGGG + Intergenic
1060546042 9:124459844-124459866 TTTGGCATCCTTGGGGGTCCTGG + Intronic
1060937907 9:127526677-127526699 TGGGGCTTCCCTGAGGGCTCAGG + Intronic
1186154187 X:6708470-6708492 TGTGGAATCCTTGGGGCCTCTGG + Intergenic
1186529611 X:10282105-10282127 TGGGGCAGCCTGGAGGGAGCTGG - Intergenic
1186676286 X:11821026-11821048 TTGGGTATCCATGGGGGTTCTGG + Intergenic
1187217482 X:17290993-17291015 AATGGCATCCTTGGGGCATCTGG - Intergenic
1189693289 X:43638711-43638733 TGGGGCAACCCTGAGGGATTTGG + Intergenic
1197319874 X:125015155-125015177 TGGGACATCCTTGGGTGTTTAGG + Intergenic
1197324515 X:125075615-125075637 TGGGGCTTCTTTTGGGGATAGGG - Intergenic
1197727819 X:129788079-129788101 CAGGGCATCCTTGTGGGATCTGG + Intronic
1198422404 X:136480970-136480992 TGGAGGAGACTTGGGGGATCAGG - Intergenic
1201321734 Y:12706498-12706520 TGGGGCATATATGTGGGATCAGG + Intronic