ID: 961125797

View in Genome Browser
Species Human (GRCh38)
Location 3:124416464-124416486
Sequence CTCTTCAGTGCCTCTTACTG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 250
Summary {0: 1, 1: 0, 2: 4, 3: 26, 4: 219}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
961125793_961125797 15 Left 961125793 3:124416426-124416448 CCTGTTCTAGAAATGAGCTTTGT 0: 1
1: 0
2: 2
3: 21
4: 172
Right 961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 219
961125789_961125797 27 Left 961125789 3:124416414-124416436 CCCCCACAATATCCTGTTCTAGA 0: 1
1: 0
2: 0
3: 12
4: 137
Right 961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 219
961125791_961125797 25 Left 961125791 3:124416416-124416438 CCCACAATATCCTGTTCTAGAAA 0: 1
1: 0
2: 2
3: 18
4: 220
Right 961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 219
961125788_961125797 30 Left 961125788 3:124416411-124416433 CCACCCCCACAATATCCTGTTCT 0: 1
1: 1
2: 1
3: 27
4: 251
Right 961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 219
961125792_961125797 24 Left 961125792 3:124416417-124416439 CCACAATATCCTGTTCTAGAAAT 0: 1
1: 0
2: 1
3: 28
4: 307
Right 961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 219
961125790_961125797 26 Left 961125790 3:124416415-124416437 CCCCACAATATCCTGTTCTAGAA 0: 1
1: 0
2: 0
3: 15
4: 180
Right 961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG 0: 1
1: 0
2: 4
3: 26
4: 219

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
961125797 Original CRISPR CTCTTCAGTGCCTCTTACTG AGG Intronic
901436818 1:9251580-9251602 CCGTTCAGTGCCTCTCACCGAGG + Intronic
902977124 1:20097023-20097045 ATCTTCAGCTCCTCTTACTTCGG + Intergenic
905151228 1:35929942-35929964 ATCTTCAGTTCCCCTCACTGTGG - Intergenic
907626794 1:56038345-56038367 CTCTTCACTGTCTCTTTCTAAGG + Intergenic
908763626 1:67534826-67534848 CCCTTCAGGGCCTCATAGTGAGG + Intergenic
909850321 1:80454111-80454133 CTCAGCAGTGCCTCTTACCATGG + Intergenic
910639899 1:89447758-89447780 CTCTTCAGTGCCTCTTTTAGTGG + Intergenic
911759470 1:101599532-101599554 CTCTTAACTGCCTCTTAGAGTGG - Intergenic
912308366 1:108594389-108594411 CTTTTCAGTCCCTCTTAATCAGG - Intronic
913048662 1:115095853-115095875 TTCTGCAGTGGCTGTTACTGAGG - Intergenic
915202559 1:154243252-154243274 GTCTTCAGTGCCTCTGCCTGCGG + Exonic
915704365 1:157829848-157829870 CTCATCCTTGCCTCTTCCTGGGG - Intergenic
916812824 1:168320481-168320503 CTTGTCAGTGCCTCAGACTGAGG + Intergenic
917727991 1:177846019-177846041 GTCTGCTGTGCCTTTTACTGAGG - Intergenic
917781586 1:178403152-178403174 CACTTCAGTTCCTGTTAATGAGG - Intronic
918277770 1:182970250-182970272 CTTTACAGTGCCCCGTACTGCGG - Intergenic
918932458 1:190872453-190872475 CACTTCAGTGATTGTTACTGAGG + Intergenic
920069538 1:203292324-203292346 CTCATCAGTGCCTCTGGCTTTGG + Intergenic
921018905 1:211218284-211218306 CTCTTTAATGCCCCCTACTGTGG + Intergenic
921222307 1:212981735-212981757 CTCTTCCGCACCTCTGACTGAGG - Intronic
923399931 1:233607126-233607148 CTCTTCAGTGCCACTTTCACTGG - Intergenic
923885766 1:238153566-238153588 GTCTTCAGTGCATCTTTCTGTGG - Intergenic
924631425 1:245744388-245744410 CTCTGCAGTCCCTCCTAATGAGG + Intergenic
924895319 1:248332369-248332391 CTCTTAAGTGTCCCTTACTCAGG + Intergenic
1062828653 10:590121-590143 CAGTTCCGTGCCTCTCACTGTGG - Intronic
1062931095 10:1353163-1353185 CTCTTAAGTCCCTCTTAGAGTGG + Intronic
1064297899 10:14094788-14094810 ATCTTCAGTGCATCTTTCTGGGG - Intronic
1065297746 10:24292782-24292804 CTTTGCAGTGCCTCTCACTCAGG - Intronic
1067813810 10:49455434-49455456 CTCTTCAGTGTCTTATACTTGGG - Exonic
1071262603 10:83934299-83934321 CTCTTAATTGCCTCACACTGTGG + Intergenic
1071365939 10:84900687-84900709 ATCTTCCGTGCCCCTTGCTGTGG - Intergenic
1072031951 10:91529791-91529813 CTCTTTCTTGCCTCTTACTGTGG + Intergenic
1073224330 10:101904213-101904235 CTCTTCTGTGTTTCTCACTGAGG - Intronic
1073235169 10:102008441-102008463 CTCTTCTATGCCAATTACTGTGG + Intronic
1074776441 10:116771223-116771245 CTCTTCAGAGCGTGTCACTGGGG - Intergenic
1075020313 10:118947404-118947426 CTTTGCAGTTCCTCTTACTGAGG + Intergenic
1075175732 10:120159086-120159108 GTCTTCCATGCATCTTACTGTGG + Intergenic
1075708319 10:124516288-124516310 CACTCCAGTGCCTCTTCCTCTGG + Intronic
1076222357 10:128744661-128744683 GTCTTTAGTGCCTCTTGGTGGGG + Intergenic
1077455327 11:2674963-2674985 CTCTTCGTTTCCTCTTACAGTGG + Intronic
1077915267 11:6607577-6607599 CTGTTCAGTGCATGTTAGTGGGG - Intronic
1078828119 11:14951152-14951174 CTCTTCAGTCCCACCTCCTGGGG + Intronic
1078855504 11:15203391-15203413 CTCTTCAGTGCCTGGCACAGAGG - Intronic
1079516890 11:21280409-21280431 CTCTTCAATACCTCTTTCAGTGG - Intronic
1079792117 11:24751350-24751372 CTCTTGCATGCCTCCTACTGCGG - Intronic
1081019200 11:37922279-37922301 CTCTCCAGTGCCTCCTCCTTGGG - Intergenic
1083728817 11:64642521-64642543 ATCTACAGTGCCACTTACCGTGG + Intronic
1083884528 11:65565647-65565669 CTCTAATGTGCCACTTACTGTGG + Intergenic
1085970755 11:81587819-81587841 CTCTACAGGGCTTTTTACTGTGG + Intergenic
1089593249 11:119558632-119558654 TTCTCCATTGCCTCTGACTGGGG - Intergenic
1089747172 11:120625555-120625577 CTCTTCCGTGGCTCTTTCTCTGG + Intronic
1091427314 12:402227-402249 CTCTTCATTGCCTCTTCCAAAGG - Intronic
1092201814 12:6589453-6589475 CTTTTCAGTTCATCATACTGGGG - Intronic
1092661015 12:10738499-10738521 CTCTTCAGTGCCCAGTTCTGTGG - Intergenic
1093286729 12:17272900-17272922 CCTTTCACTGCCTCTTGCTGGGG + Intergenic
1093830920 12:23756870-23756892 CTCTAAAATGCATCTTACTGTGG - Intronic
1095693351 12:45116530-45116552 CTCTTCCAGGCCTCTTTCTGTGG + Intergenic
1097014330 12:55974429-55974451 CTCTTCAGCGCTGCTTAATGAGG - Intronic
1097915614 12:65017895-65017917 CTTTTCCCTGCCTCTTTCTGAGG + Intergenic
1100360956 12:93878820-93878842 CTCTTCAGTGGCTCTTTCATCGG + Intronic
1101457118 12:104845629-104845651 CTCTTTGATGCCTCTTTCTGGGG - Intronic
1102554907 12:113720513-113720535 CTCTTCTCTGGCTCTTTCTGTGG + Intergenic
1103424282 12:120818104-120818126 TTCTTCAGGCCCTCCTACTGAGG + Intronic
1105727388 13:23177995-23178017 CTCTTCTGTGCCTTGTCCTGGGG - Intergenic
1107172549 13:37359664-37359686 CTATCCAGTGGCTCTTATTGGGG + Intergenic
1107537104 13:41346395-41346417 CTCTCCAGTGTCTCCTATTGTGG - Intronic
1108256079 13:48612204-48612226 CTCTTCAATGCCTCTTTCAATGG + Intergenic
1108776183 13:53767950-53767972 CTCTTCTCTACCTCTTACAGTGG - Intergenic
1110533513 13:76624545-76624567 CTCGTAAGTGACTCTTAGTGGGG - Intergenic
1113413964 13:110113626-110113648 CTCTCCTGGGCCTCTTACTCTGG - Intergenic
1115133810 14:30085708-30085730 CTCTTCAATGACTCTTTCCGTGG - Intronic
1116988903 14:51252252-51252274 TTCTTTAGTGACTTTTACTGTGG - Intronic
1117014458 14:51504625-51504647 CTCTTCAGATCCTCTTTCTCTGG + Intronic
1120696555 14:87651338-87651360 CTCTTGATTGCTTCTTAATGTGG - Intergenic
1121298098 14:92846589-92846611 TTATTCACTGCCTCTTACTGTGG + Intergenic
1121568274 14:94926854-94926876 CTCTTCTCTGCCTCTAACTCAGG - Intergenic
1126062124 15:44792790-44792812 CTCTGCAGAGCCTTTGACTGTGG - Intergenic
1126076922 15:44920433-44920455 GTCTTCAATGCATCTTACTGAGG - Intergenic
1126081789 15:44970397-44970419 GTCTTCAATGCATCTTACTGAGG + Intronic
1126116470 15:45212260-45212282 GTCTTCTGTGAATCTTACTGTGG - Intergenic
1126706731 15:51413396-51413418 CTCTCTAGTGCCTCTTTCAGTGG - Intergenic
1127622851 15:60751108-60751130 CTCCTTAGGGCCTCTGACTGTGG - Intronic
1129989096 15:79946379-79946401 CTTTCCAGTGCATCATACTGGGG - Intergenic
1130323468 15:82859367-82859389 CTCTTCAGTGCCTTTTTCTTTGG - Intronic
1131095089 15:89649547-89649569 CACCTCAGTGCCTCTCACTCTGG + Intronic
1131395128 15:92079835-92079857 CTCTGCACTGCCCCTTGCTGGGG + Intronic
1132333734 15:101030030-101030052 CTGATCATTGCCTCTTTCTGTGG + Intronic
1132560963 16:593735-593757 CTCTTCCGTGTCTCCTAATGTGG + Intronic
1134890043 16:17832808-17832830 CCATTCAGTACCTCTTCCTGGGG + Intergenic
1139532177 16:67547787-67547809 CACTTCACTGGCTCTTCCTGAGG - Intergenic
1140942583 16:79735792-79735814 CTCCTTATTGCCTCCTACTGAGG + Intergenic
1143478997 17:7218015-7218037 CTCTTTAGTGCCTGAAACTGGGG + Intronic
1146272264 17:31492200-31492222 CTCTTCACTCCCTCTGCCTGTGG + Intronic
1146272534 17:31493775-31493797 CTCTTCACTCCCTCTGCCTGTGG + Intronic
1148342806 17:46883673-46883695 TTCTTCACTGCCTCTTCCCGGGG + Intronic
1148864913 17:50623493-50623515 CCCTTCAGAGCCTCTAAATGGGG + Intronic
1150670329 17:67190618-67190640 CTTTTCAGTGCCTCTTTTGGAGG - Intronic
1150858734 17:68778713-68778735 CTCTTCAGTTCCTCTGTCTGAGG + Intergenic
1152484783 17:80583489-80583511 CTGTTCACTGCCTCTTTCTGAGG + Intronic
1154230437 18:12551862-12551884 CTCTTTGGTGCCTCTTTCGGTGG - Intronic
1156382917 18:36580233-36580255 CTCTTCAGGGCCTCTGTCTAAGG + Intronic
1158296579 18:56003181-56003203 CCCTTCATTGTCTCTTACTGAGG - Intergenic
1161747906 19:6072775-6072797 CTCTTCAGTGCTGCCTACGGAGG + Intronic
1163041487 19:14606235-14606257 CTGTGCAGAGCCTCATACTGTGG - Intronic
1166270535 19:41710718-41710740 CTCCTCTGTTCCTCTTCCTGGGG - Intronic
1167222423 19:48209600-48209622 CTCTTCTGAGACTCTTATTGTGG - Exonic
1167421291 19:49405001-49405023 CTCTTCAGGCCCTCATTCTGTGG - Intronic
925163188 2:1701172-1701194 CGCTTCAGTGCTTCCTACTAAGG + Intronic
925651382 2:6093216-6093238 TTCTTCAGTGCCTGTTCTTGTGG + Intergenic
928277745 2:29918501-29918523 CTCATCAGTGCCTCTTAGGATGG + Intronic
932318299 2:70801130-70801152 CTCTTCCGTGACTCTCATTGGGG + Intergenic
933185323 2:79271748-79271770 CTGTTAAATTCCTCTTACTGGGG - Intronic
934615460 2:95767995-95768017 CTCTGCAGTGCTCATTACTGGGG - Intergenic
934645443 2:96056563-96056585 CTCTGCAGTGCTCATTACTGGGG + Intergenic
934838847 2:97612652-97612674 CTCTGCAGTGCTCATTACTGGGG + Intergenic
934869554 2:97850289-97850311 TTCTTCACTGCCCCTTTCTGTGG - Intronic
937193939 2:120133336-120133358 CTCTTCAGTGCCTCCTTCCTTGG - Intronic
939204306 2:139080469-139080491 TTCTTCAATGTCTTTTACTGAGG - Intergenic
940368430 2:152874717-152874739 GTCTTCACTGCTTCCTACTGTGG + Intergenic
940468551 2:154063960-154063982 CTCTTCTGTGCCTCTTTCAATGG - Intronic
944133397 2:196370945-196370967 CTGTTCAATGCCTCTTTCAGTGG + Intronic
944473311 2:200078764-200078786 CTCTTCAGTATCTGTTACTAGGG - Intergenic
946768764 2:223065572-223065594 CTTTGCAGTGCCTCTTAGTTGGG - Intronic
1168742201 20:201312-201334 TTCTTCAGTGCCTCATTCAGTGG + Intergenic
1169810528 20:9604915-9604937 CTCTACAGTTCCTTGTACTGGGG - Intronic
1171185996 20:23124709-23124731 GTCTTCAGAGCATCTTTCTGGGG - Intergenic
1174018973 20:47513826-47513848 CTCTTGAGTGCCAGTTACTTAGG + Intronic
1175567863 20:59995037-59995059 CTCTTCTGTGCCTCTAGCCGTGG + Intronic
1177569740 21:22871524-22871546 CTCTTCAGTGCCTCTTGAAGCGG + Intergenic
1179890591 21:44333332-44333354 CCCATGAGTGCCTTTTACTGGGG - Intronic
1180244755 21:46539532-46539554 CTCTCCAGTGCCTCTTCCCATGG + Intronic
949127542 3:464508-464530 CTCTTCAGCCACTCTTTCTGGGG - Intergenic
950109350 3:10408566-10408588 CTCTTCCCTGCCTCTGGCTGGGG - Intronic
950111611 3:10422240-10422262 CTGTTAAGTGGCTCTTACAGGGG - Intronic
950925615 3:16738191-16738213 CTCTTCAGCTCATCTTAATGTGG + Intergenic
953496493 3:43391838-43391860 TACTTCAGTGCCTCTGACTCAGG - Intronic
957491894 3:80938149-80938171 CTCTTCAGGGACTCTTATTTAGG + Intergenic
957647880 3:82957242-82957264 CTCTGCAGTGCCTCTCACTATGG + Intergenic
958131312 3:89428637-89428659 CTCTTTTGTGCCGCTTAGTGGGG - Intronic
958434729 3:94082483-94082505 CCTTTCACTGCCTCTTACTATGG - Intronic
958617489 3:96514547-96514569 CTCTTCAGTGCCTCTCTCAGAGG - Intergenic
958765451 3:98361631-98361653 CTCATCAGTGCCTCTTTCAGTGG + Intergenic
959156301 3:102670290-102670312 CTCTTCAATACCTCTTTCTTAGG - Intergenic
960455192 3:117862681-117862703 CTTTTTCCTGCCTCTTACTGAGG - Intergenic
960869560 3:122235002-122235024 CTCTTCAGGGGCTCTTTCTTTGG - Intronic
961125797 3:124416464-124416486 CTCTTCAGTGCCTCTTACTGAGG + Intronic
962870977 3:139492604-139492626 CTCTTCAGTGCCTCTTTCCTTGG + Intergenic
965458470 3:168932091-168932113 CTCTTAACTCCCTCTTACAGTGG - Intergenic
966156604 3:176923091-176923113 CTCTTAAGTGTCTCATACTCTGG - Intergenic
967994330 3:195155216-195155238 CTCTTCACCCCCTCTTTCTGAGG + Intronic
969248018 4:5948117-5948139 CTGCTCTGTGCCTCTTGCTGGGG - Intronic
969867528 4:10085444-10085466 CAGCTCAGTGTCTCTTACTGGGG - Intronic
972322759 4:37987917-37987939 CTCTCCAGAGCATCATACTGTGG + Intronic
974696232 4:65376768-65376790 CTCTTCTGAGGCTTTTACTGTGG - Intronic
974697144 4:65390524-65390546 CTCTTCCGTGTTTCTTCCTGTGG + Intronic
974904283 4:68036404-68036426 CTCTTAACTGCCTCTTAGAGTGG + Intergenic
975880873 4:78906147-78906169 CTCTCCAGTACCTCCTGCTGAGG - Intronic
975947380 4:79724000-79724022 TTATTCAGTCCCTCTTTCTGCGG - Intergenic
978762919 4:112374459-112374481 CTCCTCAGTTCCTGTTAATGTGG + Intronic
979503786 4:121469971-121469993 CTACTCAGTGCATCATACTGTGG + Intergenic
980646560 4:135651212-135651234 CTCTTAAGTGACTCTTTCAGTGG - Intergenic
981186251 4:141807381-141807403 ATTTTCAGTGCCTCTAATTGTGG - Intergenic
981456881 4:144962714-144962736 CTCTTCAGTGCCTGTGTGTGTGG + Intergenic
982113236 4:152075216-152075238 CTCCTCTGTCCCTCTTGCTGAGG - Intergenic
983645556 4:169987513-169987535 CTCTTCAGTGGCAGTCACTGTGG - Exonic
984994606 4:185417369-185417391 CTCATCTGTACATCTTACTGAGG + Intronic
985959958 5:3293897-3293919 CTCTTTTCTGCCTCTCACTGAGG + Intergenic
986850886 5:11812452-11812474 CTCCACAGTGTCTGTTACTGGGG - Intronic
986961854 5:13222601-13222623 CTCTTCAATGCCTCTCTCAGTGG - Intergenic
989628835 5:43460524-43460546 CCCTTCTGTGCCTCTTTCAGTGG - Intronic
991953796 5:71972272-71972294 GTCCTCAGTGCCTGTCACTGAGG + Intergenic
992397917 5:76384563-76384585 CACTTAGGGGCCTCTTACTGAGG - Intergenic
994217996 5:97160033-97160055 CTCTTCAGTGCCTCTTTCAGTGG + Intronic
996082500 5:119271335-119271357 CTCTGCAGTGCCTGGCACTGTGG - Intronic
996463474 5:123773025-123773047 CTCTTCAATGCCTCTTTCCTTGG + Intergenic
999320296 5:150610274-150610296 CTCTGCCGTGCCTGTGACTGTGG - Intronic
1004285486 6:14317156-14317178 CTCTTCTGTGCTTATTATTGGGG - Intergenic
1004429077 6:15527622-15527644 CTCTTCAGTGTCGCTTTCTTTGG - Intronic
1007250620 6:40492555-40492577 ATCTTTAGAGCCACTTACTGAGG + Intronic
1009362502 6:62832042-62832064 CTCTTTTGTGCCTCTCACTCAGG - Intergenic
1010121798 6:72384602-72384624 TTCTTCTGTACCTCTAACTGTGG + Intronic
1010756865 6:79675570-79675592 CTCTTGAGTGCCTATTAATTTGG + Intronic
1011446840 6:87450769-87450791 CTCTTCAGTACCTCTTTCCTTGG - Intronic
1012059783 6:94463541-94463563 CTCTTCAGTGCCTCTAAACCAGG + Intergenic
1015947942 6:138522129-138522151 CTCTTCAGTGCATCTGACTCTGG - Intronic
1016194507 6:141317442-141317464 CTCTTCAGTGCTTCTTTCCTTGG - Intergenic
1016898042 6:149073457-149073479 CTCTTCCATGCCTCCTTCTGAGG + Intronic
1018902798 6:168059726-168059748 CTCTTCAGGGCCTCATACACAGG + Intronic
1019082903 6:169447788-169447810 CTCTTCAGGGATTCTAACTGGGG + Intergenic
1019230961 6:170562412-170562434 CTGTTAAGAGCCTTTTACTGAGG - Intronic
1022340105 7:29459867-29459889 CTCTTCTCTGCCTCTTCTTGTGG - Intronic
1022516731 7:30979456-30979478 CTCATCCATTCCTCTTACTGGGG + Exonic
1024339695 7:48244619-48244641 CTCTTCAGTGCCGGCCACTGGGG - Exonic
1024624158 7:51189962-51189984 CTCACCAGTGGCTCTAACTGTGG + Intronic
1027469538 7:78556153-78556175 ATCTTCTGTGCCTCTTACTCTGG - Intronic
1033288275 7:140061010-140061032 CTCTTCAGTCTCTGTTCCTGCGG - Intronic
1033965702 7:146972879-146972901 TTCATTAGTGCCTCTGACTGAGG - Intronic
1035962294 8:4150435-4150457 AACTTCAGTGCCTTTTACCGGGG + Intronic
1036222346 8:6931248-6931270 CTCTTCTGAGTCTGTTACTGAGG - Intergenic
1036290541 8:7485629-7485651 GTCTTTAATGCCTCTTACTGTGG + Intronic
1036330946 8:7825908-7825930 GTCTTTAATGCCTCTTACTGTGG - Intronic
1036417889 8:8567193-8567215 CTTTTCAGTGTCTGTTGCTGGGG + Intergenic
1037394518 8:18428016-18428038 TTCTTTAGTGCTTCTTACTTTGG + Intergenic
1037712047 8:21362544-21362566 CTCTTCACTCCCACTTCCTGGGG - Intergenic
1038327534 8:26583617-26583639 CTCTGCATTGCCTCTTGCTGGGG + Intronic
1039361344 8:36880752-36880774 TTCCTGAGTGCCTCTTGCTGAGG + Intronic
1039680440 8:39730072-39730094 TCCTCCAGTGCCTCTTGCTGTGG + Intergenic
1040849872 8:51888467-51888489 CCCTTTAGTGCCTTCTACTGTGG - Intronic
1043251912 8:78085756-78085778 GTCTTCACTGCCTCTGACTTTGG + Intergenic
1043351066 8:79361293-79361315 CTTTGAAATGCCTCTTACTGAGG - Intergenic
1045895906 8:107216462-107216484 CTCTCCAGAGCCACTTTCTGGGG - Intergenic
1046071429 8:109259590-109259612 CACTTCACTGCCTATTAATGAGG + Intronic
1047529440 8:125661787-125661809 CACTTCAATGCCTCTAATTGAGG + Intergenic
1047724276 8:127670626-127670648 CTCTGCAGTCCCTATTCCTGTGG + Intergenic
1049993190 9:1009489-1009511 CACTCCTGTGCCTCTCACTGTGG + Intergenic
1052411283 9:28124813-28124835 TTCTTCAGTGATTCTTGCTGTGG + Intronic
1053543303 9:38996973-38996995 CTCTTTAGTGCATCATAGTGAGG - Intergenic
1056410970 9:86326633-86326655 CTCTTAAGAGCATCTTACAGTGG - Intronic
1057430618 9:94990325-94990347 TCCTTCAGTGACTCTTTCTGTGG - Intronic
1057453662 9:95188241-95188263 ATCTTCACTGTCTCTTCCTGGGG + Intronic
1057539514 9:95953241-95953263 CTCTTGATTTCCTCTTATTGTGG - Intronic
1057599465 9:96444803-96444825 ATCTTCAGTGCCTTTTATTCAGG - Intergenic
1059881317 9:118692798-118692820 CAATTCACTGCCTCTTACTATGG - Intergenic
1060506460 9:124201668-124201690 CTCTTCACTCCCTCCTACTGAGG + Intergenic
1060809806 9:126605112-126605134 CTCTTCCGTGGCTCCTACTCAGG + Intergenic
1061232320 9:129321967-129321989 CCCTTCAGTGCCTCTTCCTCTGG + Intergenic
1061377690 9:130235873-130235895 CTCTGCAGAGCCTCGCACTGGGG + Exonic
1061912017 9:133729976-133729998 CTCTGCAGGGCTTCTTTCTGGGG - Intronic
1186039251 X:5457898-5457920 CTCTTTTGTTCCTCTGACTGTGG + Intergenic
1186675071 X:11808087-11808109 CTATTGAGGGCATCTTACTGTGG - Intergenic
1187027976 X:15455921-15455943 CTTTTCAGTTCCTGGTACTGAGG + Exonic
1187252767 X:17613720-17613742 CTATTCAGTTCCTCTTAAGGTGG + Intronic
1187703736 X:21989156-21989178 TTCTTCTGTACCTGTTACTGAGG + Intronic
1188118674 X:26277891-26277913 CTCTTCAGTTCCTCTTTCGGTGG + Intergenic
1189332850 X:40153853-40153875 CTCTCCACTGCCTCTCGCTGCGG - Intronic
1191736466 X:64393748-64393770 CTCTTCAGGGCCTTTCTCTGTGG - Intronic
1194724107 X:97374384-97374406 TTGTTCAGTGTCTGTTACTGAGG + Intronic
1194937761 X:99971243-99971265 CTCTTCAGTGCCTCTTTCAGTGG + Intergenic
1195849274 X:109265229-109265251 CTCTTCATTGCCTCTTTAAGTGG + Intergenic
1196264983 X:113632990-113633012 CTCTTAAGTGCATCTTCCAGTGG - Intergenic
1196464386 X:115958120-115958142 ATCCTCAGTGCCTATTTCTGGGG + Intergenic
1196567511 X:117226679-117226701 CTCCTCAGTGACTCTATCTGTGG + Intergenic
1197020540 X:121682619-121682641 CTCTTCAGTGCCTGTAACCATGG - Intergenic
1197561804 X:128033647-128033669 CTGTTCAGTGCCTCTTTCTGTGG - Intergenic
1199158363 X:144576849-144576871 CTCTTCAGTAACTATTACAGTGG - Intergenic
1199317440 X:146396659-146396681 CTCTTCAGTGCCTCTTTCAGTGG + Intergenic
1199962802 X:152791655-152791677 ATCTTCAGTGCCCCTTTCAGTGG - Intergenic
1200965419 Y:9031731-9031753 CTCTTCTGTCCCTTTCACTGAGG + Intergenic
1201061187 Y:10048313-10048335 CTCTTGACTCCCTCTTACAGTGG - Intergenic
1202147684 Y:21817057-21817079 CTCTTCTGTCCCTTTCACTGAGG - Intergenic